himal_scripts

himal_scripts is a collection of custom scripts for processing MDU data.

---

Usage

To use these scripts, you need to clone this repository and make the scripts executable:

git clone https://github.com/MDU-PHL/himal_scripts.git
cd himal_scripts
chmod +x *.sh

run_mlst

This script checks the MLST outputs for a sample with genomes assembled using spades, shovill and skesa. It takes two arguments: the run ID and the sample ID.

Example:

conda activate /home/khhor/conda/envs/mlst/
./run_mlst <runid> <sampleid>

This will output the MLST scheme using genomes from each assembly method.

test-hicap-run.sh

This script runs hicap on a set of samples. It takes one argument: a file containing the sample IDs, one per line.

Before running this script, you need to create a new folder for the test run and copy the script to that folder. You also need to activate the conda environment for hicap:

mkdir 231205-test
cd 231205-test
cp /home/himals/3_resources/github-repos/himal_scripts/test-hicap-run.sh test-hicap-run.sh
conda activate /home/himals/.conda/envs/hicap_dev

Then, you need to create a file called sample_ids and paste the sample IDs in the file:

nano sample_ids

Finally, you can run the script with the following command:

./test-hicap-run.sh sample_ids

This will run hicap on each sample and generate a folder called hicap_ssummary files in the current directory, which contains the hicap results for each sample.

seqkit-pcr.sh

This script runs in sillico PCR on a fasta file using seqkit amplicon. It takes two arguments: a file containing the primer information (primer_info) and a file containing sample_IDs (sample_ids).

1. primer_info file should contain the following information as a tab separated file, example:

Serotype  Forward primer  Reverse primer
Hia   GGTCTGCGGTGTCCTGTGT   CCGGTCATCTTTTATGCTCCAA
Hib GGGGGGGGGGGGGGGGGGG   CCCCCCCCCCCCCCCCCCCC

2. sample_IDs file should contain the sample IDs, one per line, example:

2015-11111
2015-11112
2015-11113

Usage:

./seqkit-pcr.sh primer_info sample_ids

This will output the PCR results for each sample_IDs tested for a different serotype in the file detection_results.csv and detailed PCR results for each sample in the folder detailed_results.

Contributing

If you want to contribute to this project, please follow these steps:

• Fork this repository and create a new branch for your feature or bug fix.
• Make your changes and commit them with a clear and descriptive message.
• Push your branch to your fork and open a pull request to the main branch.
• Wait for a review and feedback from the maintainer.

License

This project is licensed under the MIT License. See the LICENSE file for details.