Skip to content

Commit

Permalink
Merge pull request #156 from colin-combe/master
Browse files Browse the repository at this point in the history 
new nucleic acid interactor types
  • Loading branch information
@colin-combe
colin-combe authored Nov 17, 2020
2 parents 2716ab4 + 990edbe commit 3ca0d59
Show file tree
Hide file tree
Showing 8 changed files with 3,113 additions and 11 deletions.
947 changes: 947 additions & 0 deletions data/EBI-25570228.json
View file

Large diffs are not rendered by default.

277 changes: 277 additions & 0 deletions data/EBI-25816865.json
View file
Original file line number Diff line number Diff line change
@@ -0,0 +1,277 @@
{
"data": [
{
"object": "interactor",
"id": "uniprotkb_P0DTD1-PRO_0000449630",
"sequence": "AVGACVLCNSQTSLRCGACIRRPFLCCKCCYDHVISTSHKLVLSVNPYVCNAPGCDVTDVTQLYLGGMSYYCKSHKPPISFPLCANGQVFGLYKNTCVGSDNVTDFNAIATCDWTNAGDYILANTCTERLKLFAAETLKATEETFKLSYGIATVREVLSDRELHLSWEVGKPRPPLNRNYVFTGYRVTKNSKVQIGEYTFEKGDYGDAVVYRGTTTYKLNVGDYFVLTSHTVMPLSAPTLVPQEHYVRITGLYPTLNISDEFSSNVANYQKVGMQKYSTLQGPPGTGKSHFAIGLALYYPSARIVYTACSHAAVDALCEKALKYLPIDKCSRIIPARARVECFDKFKVNSTLEQYVFCTVNALPETTADIVVFDEISMATNYDLSVVNARLRAKHYVYIGDPAQLPAPRTLLTKGTLEPEYFNSVCRLMKTIGPDMFLGTCRRCPAEIVDTVSALVYDNKLKAHKDKSAQCFKMFYKGVITHDVSSAINRPQIGVVREFLTRNPAWRKAVFISPYNSQNAVASKILGLPTQTVDSSQGSEYDYVIFTQTTETAHSCNVNRFNVAITRAKVGILCIMSDRDLYDKLQFTSLEIPRRNVATLQ",
"type": {
"id": "MI:0326",
"name": "protein"
},
"organism": {
"taxid": "2697049",
"common": "SARS-CoV-2",
"scientific": "SARS-CoV-2"
},
"identifier": {
"db": "uniprotkb",
"id": "P0DTD1-PRO_0000449630"
},
"label": "p0dtd1-pro_0000449630"
},
{
"object": "interactor",
"id": "intact_EBI-25816901",
"sequence": "CGCGUAGCAUGCUACGUCAUUCUCCUAAGAAGCUA",
"type": {
"id": "IA:2966",
"name": "double stranded ribonucleic acid"
},
"organism": {
"taxid": "32630",
"common": "synthetic construct",
"scientific": "synthetic construct"
},
"identifier": {
"db": "intact",
"id": "EBI-25816901"
},
"label": "product-rna"
},
{
"object": "interactor",
"id": "intact_EBI-25816965",
"sequence": "CUAUCCCCAUGUGAUUUUAAUAGCUUCUUAGGAGAAUGACGUAGCAUGCUACGCG",
"type": {
"id": "MI:0318",
"name": "nucleic acid"
},
"organism": {
"taxid": "32630",
"common": "synthetic construct",
"scientific": "synthetic construct"
},
"identifier": {
"db": "intact",
"id": "EBI-25816965"
},
"label": "template-rna"
},
{
"object": "interactor",
"id": "complex portal_CPX-5742",
"type": {
"id": "MI:1302",
"name": "stable complex"
},
"organism": {
"taxid": "2697049",
"common": "SARS-CoV-2",
"scientific": "SARS-CoV-2"
},
"identifier": {
"db": "complex portal",
"id": "CPX-5742"
},
"label": "nsp7-nsp8-nsp12_sars2"
},
{
"object": "interaction",
"id": "intact_EBI-25816865",
"interactionType": {
"id": "MI:0915",
"name": "physical association"
},
"experiment": {
"detmethod": {
"id": "MI:0410",
"name": "3D electron microscopy"
},
"host": {
"taxid": "-1",
"common": "in vitro",
"scientific": "In vitro"
},
"pubid": [
{
"db": "intact",
"id": "EBI-25815170"
},
{
"db": "pubmed",
"id": "32676607"
},
{
"db": "imex",
"id": "IM-28291"
}
],
"sourceDatabase": {
"id": "MI:0469",
"name": "European Bioinformatics Institute"
},
"figures": [
"Table S1"
]
},
"identifiers": [
{
"db": "intact",
"id": "EBI-25816865"
},
{
"db": "wwpdb",
"id": "6XEZ"
},
{
"db": "emdb",
"id": "EMD-22160"
},
{
"db": "imex",
"id": "IM-28291-1"
}
],
"participants": [
{
"id": "1",
"interactorRef": "uniprotkb_P0DTD1-PRO_0000449630",
"stoichiometry": "2",
"bioRole": {
"id": "MI:0499",
"name": "unspecified role"
},
"expRole": {
"id": "MI:0497",
"name": "neutral component"
},
"identificationMethods": [
{
"id": "MI:2287",
"name": "identification by structure determination"
}
],
"expressedIn": {
"taxid": "83333",
"common": "ecoli",
"scientific": "Escherichia coli (strain K12)"
}
},
{
"id": "2",
"interactorRef": "intact_EBI-25816901",
"stoichiometry": "1",
"bioRole": {
"id": "MI:0499",
"name": "unspecified role"
},
"expRole": {
"id": "MI:0497",
"name": "neutral component"
},
"identificationMethods": [
{
"id": "MI:2287",
"name": "identification by structure determination"
}
],
"expressedIn": {
"taxid": "32630",
"common": "synthetic construct",
"scientific": "synthetic construct"
},
"features": [
{
"id": "3",
"name": "whole molecule",
"category": "bindingSites",
"type": {
"id": "MI:0442",
"name": "sufficient binding region"
},
"sequenceData": [
{
"pos": "?-?",
"interactorRef": "intact_EBI-25816901",
"participantRef": "2"
}
],
"linkedFeatures": [
"4"
]
}
]
},
{
"id": "5",
"interactorRef": "intact_EBI-25816965",
"stoichiometry": "1",
"bioRole": {
"id": "MI:0499",
"name": "unspecified role"
},
"expRole": {
"id": "MI:0497",
"name": "neutral component"
},
"identificationMethods": [
{
"id": "MI:2287",
"name": "identification by structure determination"
}
],
"expressedIn": {
"taxid": "32630",
"common": "synthetic construct",
"scientific": "synthetic construct"
},
"features": [
{
"id": "4",
"name": "whole molecule",
"category": "bindingSites",
"type": {
"id": "MI:0442",
"name": "sufficient binding region"
},
"sequenceData": [
{
"pos": "?-?",
"interactorRef": "intact_EBI-25816901",
"participantRef": "2"
}
],
"linkedFeatures": [
"3"
]
}
]
},
{
"id": "6",
"interactorRef": "complex portal_CPX-5742",
"stoichiometry": "1",
"bioRole": {
"id": "MI:0499",
"name": "unspecified role"
},
"expRole": {
"id": "MI:0497",
"name": "neutral component"
},
"identificationMethods": [
{
"id": "MI:2287",
"name": "identification by structure determination"
}
],
"expressedIn": {
"taxid": "83333",
"common": "ecoli",
"scientific": "Escherichia coli (strain K12)"
}
}
]
}
]
}
Loading

0 comments on commit 3ca0d59

Please sign in to comment.