Merge pull request #20 from biosustain/upload-articles

Article (in progress)

_static/custom.css

@@ -7,4 +7,10 @@
 
 figure.align-center {
     text-align: center;
-}
+}
+
+.admonition.my-custom-admonition {
+    background-color: #e8daed;
+    border-left: 4px solid #ab86ba;
+    padding: 10px;
+}

guides/sequence_creation.md

@@ -0,0 +1,42 @@
+# Create and import sequences
+
+## Introduction 
+
+One of the first steps to start using Benchling’s Molecular Biology tool is to upload the sequences of interest into the platform. This will allow you to view, annotate and modify the DNA and RNA sequences you need to work with. It is possible to create plasmids, DNA fragments, genes, primers and more, and there are several ways to do this. This guide will cover the most common ones.  
+
+## Get started
+
+Locate the sequence creation menu:
+
+(VIDEO)
+
+**Note**: Always double-check which folder you are saving to!
+
+## Create a new sequence
+
+This can be useful for raw sequences. For example, if you have a .docx file with a sequence, or the PDF of a paper with a sequence you are interested in, you can easily copy and paste it. The menu allows you to set the topology and schema depending on what your sequence corresponds to.  
+
+(VIDEO)
+
+```{admonition} *Try it out!*
+:class: my-custom-admonition
+
+➜ Create a file for the **pCAT** promoter (agaggttccaactttcaccataatgaaaca) 
+```
+
+## Upload a file
+
+If you have one or more sequences saved to your computer, you can upload them. The sequence, annotations and comments will be imported.  
+
+(Video)
+
+```{admonition} *Try it out!*
+:class: my-custom-admonition
+
+➜ Download the file for the **pET-28b(+)** plasmid and upload it to Benchling.
+[pET-28b(+)](https://www.snapgene.com/plasmids/pet_and_duet_vectors_(novagen)/pET-28b(%2B))
+
+```
+
+## Import from databases
+

index.md

@@ -42,6 +42,7 @@ FAQ
 
 Overview <guides/introduction>
 Register your strains <guides/strain_registration>
+Create sequences <guides/sequence_creation.md>
 ```
 
 ```{toctree}