adding Paired-tag EM multimapping and csi index output (#1482)

added EM multimapping and csi index output to PairedTag WDL
broadinstitute · Jan 21, 2025 · eedabad · eedabad
1 parent 256b324
commit eedabad
Show file tree

Hide file tree

Showing 7 changed files with 21 additions and 13 deletions.
diff --git a/pipeline_versions.txt b/pipeline_versions.txt
@@ -27,12 +27,12 @@ BroadInternalImputation	 1.1.14	2024-11-04
 BroadInternalArrays	 1.1.14	2024-11-04 
 BroadInternalRNAWithUMIs	 1.0.36	2024-11-04 
 RNAWithUMIsPipeline	 1.0.18	2024-11-04 
-Multiome	 5.9.5	2025-01-13 
+Multiome	 5.9.6	2025-01-21 
 MultiSampleSmartSeq2SingleNucleus	 2.0.7	2025-01-13 
 BuildIndices	 4.0.0	2025-01-17 
 SlideSeq	 3.4.8	2025-01-13 
-PairedTag	 1.9.1	2025-01-13 
-atac	 2.5.4	2025-01-13 
+PairedTag	 1.10.0	2025-01-21 
+atac	 2.6.0	2025-01-21 
 scATAC	 1.3.2	2023-08-03 
 snm3C	 4.0.4	2024-08-06 
 Optimus	 7.9.1	2025-01-13 

diff --git a/pipelines/skylab/atac/atac.changelog.md b/pipelines/skylab/atac/atac.changelog.md
@@ -1,7 +1,8 @@
-# 2.5.4
-2025-01-13 (Date of Last Commit)
+# 2.6.0
+2025-01-21 (Date of Last Commit)
 
 * Added reference_gtf_file to the output h5ad unstructured metadata
+* Added the fragment file CSI index as a workflow output
 
 # 2.5.3
 2024-11-22 (Date of Last Commit)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
@@ -49,7 +49,7 @@ workflow ATAC {
     String adapter_seq_read3 = "TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG"
   }
 
-  String pipeline_version = "2.5.4"
+  String pipeline_version = "2.6.0"
 
   # Determine docker prefix based on cloud provider
   String gcr_docker_prefix = "us.gcr.io/broad-gotc-prod/"
@@ -164,12 +164,14 @@ workflow ATAC {
 
   File bam_aligned_output_atac = select_first([BBTag.bb_bam, BWAPairedEndAlignment.bam_aligned_output])
   File fragment_file_atac = select_first([BB_fragment.fragment_file, CreateFragmentFile.fragment_file])
+  File fragment_file_index_atac = select_first([BB_fragment.fragment_file_index, CreateFragmentFile.fragment_file_index])
   File snap_metrics_atac = select_first([BB_fragment.Snap_metrics,CreateFragmentFile.Snap_metrics])
   File library_metrics = select_first([BB_fragment.atac_library_metrics, CreateFragmentFile.atac_library_metrics])
 
   output {
     File bam_aligned_output = bam_aligned_output_atac
     File fragment_file = fragment_file_atac
+    File fragment_file_index = fragment_file_index_atac
     File snap_metrics = snap_metrics_atac
     File library_metrics_file = library_metrics
   }

diff --git a/pipelines/skylab/multiome/Multiome.changelog.md b/pipelines/skylab/multiome/Multiome.changelog.md
@@ -1,8 +1,9 @@
-# 5.9.5
-2025-01-13 (Date of Last Commit)
+# 5.9.6
+2025-01-21 (Date of Last Commit)
 
 * Added a boolean variable is_slidetags; default is false but it is set to true if the Slide-Tags pipeline is calling Optimus
 * Added reference_gtf_file to the output h5ad unstructured metadata
+* Added the ATAC fragment file CSI index as high-level ATAC workflow output; this does not impact the Multiome workflow as Multiome already produces the csi index from ATAC
 
 # 5.9.4
 2024-12-05 (Date of Last Commit)

diff --git a/pipelines/skylab/multiome/Multiome.wdl b/pipelines/skylab/multiome/Multiome.wdl
@@ -7,7 +7,7 @@ import "../../../tasks/broad/Utilities.wdl" as utils
 
 workflow Multiome {
 
-    String pipeline_version = "5.9.5"
+    String pipeline_version = "5.9.6"
 
     input {
         String cloud_provider

diff --git a/pipelines/skylab/paired_tag/PairedTag.changelog.md b/pipelines/skylab/paired_tag/PairedTag.changelog.md
@@ -1,8 +1,10 @@
-# 1.9.1
-2025-01-13 (Date of Last Commit)
+# 1.10.0
+2025-01-21 (Date of Last Commit)
 
 * Added a boolean variable is_slidetags; default is false, but set to true if Slide-Tags pipeline is calling Optimus
 * Added reference_gtf_file to the output h5ad unstructured metadata 
+* Added the fragment file CSI index as workflow output
+* Updated the default STARsolo multimapping parameter to the "EM" tehcnique
 
 # 1.9.0
 2024-12-05 (Date of Last Commit)

diff --git a/pipelines/skylab/paired_tag/PairedTag.wdl b/pipelines/skylab/paired_tag/PairedTag.wdl
@@ -8,7 +8,7 @@ import "../../../tasks/broad/Utilities.wdl" as utils
 
 workflow PairedTag {
 
-    String pipeline_version = "1.9.1"
+    String pipeline_version = "1.10.0"
 
 
     input {
@@ -33,7 +33,7 @@ workflow PairedTag {
         Boolean count_exons = false
         File gex_whitelist = if cloud_provider == "gcp" then "gs://gcp-public-data--broad-references/RNA/resources/arc-v1/737K-arc-v1_gex.txt" else "https://datasetpublicbroadref.blob.core.windows.net/dataset/RNA/resources/arc-v1/737K-arc-v1_gex.txt?sv=2020-04-08&si=prod&sr=c&sig=DQxmjB4D1lAfOW9AxIWbXwZx6ksbwjlNkixw597JnvQ%3D"
 
-        String? soloMultiMappers = "Uniform"
+        String? soloMultiMappers = "EM"
         # ATAC inputs
         # Array of input fastq files
         Array[File] atac_r1_fastq
@@ -153,6 +153,7 @@ workflow PairedTag {
     }
 
     File atac_fragment_out = select_first([ParseBarcodes.atac_fragment_tsv,Atac_preindex.fragment_file])
+    File atac_fragment_index_out = select_first([ParseBarcodes.atac_fragment_tsv_tbi,Atac_preindex.fragment_file_index])
     File atac_h5ad_out = select_first([ParseBarcodes.atac_h5ad_file, Atac_preindex.snap_metrics])
 
     output {
@@ -164,6 +165,7 @@ workflow PairedTag {
         File fragment_file_atac = atac_fragment_out
         File snap_metrics_atac = atac_h5ad_out
         File atac_library_final = Atac_preindex.library_metrics_file
+        File fragment_file_index_atac = atac_fragment_index_out
 
         # optimus outputs
         File genomic_reference_version_gex = Optimus.genomic_reference_version