diff --git a/_sources/back-matter/glossary.md b/_sources/back-matter/glossary.md
index 6f67d42..c8d6e5d 100644
--- a/_sources/back-matter/glossary.md
+++ b/_sources/back-matter/glossary.md
@@ -124,6 +124,9 @@ Semantic Type
When associated with a {term}`directory format`, the combination defines an {term}`artifact class`.
These types may be extended by {term}`pluginsGlossary
When associated with a directory format, the combination defines an artifact class.
These types may be extended by plugins.
A plugin that is intended for one specific use case, such as generating figures for a single manuscript, as opposed to a plugin that is intended for general widespread usage.
+“Too long; didn’t read.” In other words, a quick summary of the content that follows.
PluginManag
Inputs and outputs#
-
-qiime2.sdk.Result()[source]#
+qiime2.sdk.Result()[source]#
Base class for QIIME 2 result classes (Artifact and Visualization).
This class is not intended to be instantiated. Instead, it acts as a public
factory and namespace for interacting with Artifacts and Visualizations in
@@ -494,7 +494,7 @@
Inputs and outputs
-
-qiime2.sdk.Results(fields, values)[source]#
+qiime2.sdk.Results(fields, values)[source]#
Tuple class representing the named results of an Action
.
Provides an interface similar to a namedtuple
type (e.g. fields are
accessible as attributes).
@@ -503,7 +503,7 @@ Inputs and outputs
-
-qiime2.sdk.Artifact()[source]#
+qiime2.sdk.Artifact()[source]#
Base class for QIIME 2 result classes (Artifact and Visualization).
This class is not intended to be instantiated. Instead, it acts as a public
factory and namespace for interacting with Artifacts and Visualizations in
@@ -513,7 +513,7 @@
Inputs and outputs
-
-qiime2.sdk.Visualization()[source]#
+qiime2.sdk.Visualization()[source]#
Base class for QIIME 2 result classes (Artifact and Visualization).
This class is not intended to be instantiated. Instead, it acts as a public
factory and namespace for interacting with Artifacts and Visualizations in
@@ -523,7 +523,7 @@
Inputs and outputs
-
-qiime2.sdk.ResultCollection(collection=None)[source]#
+qiime2.sdk.ResultCollection(collection=None)[source]#
@@ -531,25 +531,25 @@ Inputs and outputs#
-
-qiime2.sdk.Action()[source]#
+qiime2.sdk.Action()[source]#
QIIME 2 Action
-
-qiime2.sdk.Method()[source]#
+qiime2.sdk.Method()[source]#
QIIME 2 Method
-
-qiime2.sdk.Visualizer()[source]#
+qiime2.sdk.Visualizer()[source]#
QIIME 2 Visualizer
-
-qiime2.sdk.Pipeline()[source]#
+qiime2.sdk.Pipeline()[source]#
QIIME 2 Pipeline
@@ -558,7 +558,7 @@ Actions#<
Utility functions#
-
-qiime2.sdk.parse_type(string, expect=None)[source]#
+qiime2.sdk.parse_type(string, expect=None)[source]#
Convert a string into a type expression
- Parameters:
@@ -576,12 +576,12 @@ Utility functions
-
-qiime2.sdk.parse_format(format_str)[source]#
+qiime2.sdk.parse_format(format_str)[source]#
-
-qiime2.sdk.type_from_ast(ast, scope=None)[source]#
+qiime2.sdk.type_from_ast(ast, scope=None)[source]#
Convert a type ast (from .to_ast()) to a type expression.
- Parameters:
@@ -604,19 +604,19 @@ Utility functions#
-
-qiime2.sdk.ValidationError()[source]#
+qiime2.sdk.ValidationError()[source]#
Common base class for all non-exit exceptions.
-
-qiime2.sdk.ImplementationError()[source]#
+qiime2.sdk.ImplementationError()[source]#
Common base class for all non-exit exceptions.
-
-qiime2.sdk.UninitializedPluginManagerError()[source]#
+qiime2.sdk.UninitializedPluginManagerError()[source]#
Common base class for all non-exit exceptions.
diff --git a/objects.inv b/objects.inv
index c6938c1..dec0fb3 100644
Binary files a/objects.inv and b/objects.inv differ
diff --git a/plugins/references/api/citations.html b/plugins/references/api/citations.html
index faf991e..5f452d7 100644
--- a/plugins/references/api/citations.html
+++ b/plugins/references/api/citations.html
@@ -447,12 +447,12 @@ Contents
(list
and Citations
).
-
-class qiime2.plugin.Citations[source]#
+class qiime2.plugin.Citations[source]#
A simple subclass of collections.OrderedDict
but iterates over values instead of keys by default.
-
-classmethod load(path, package=None)[source]#
+classmethod load(path, package=None)[source]#
Load a bibtex file from a path (or relative package path)
- Parameters:
@@ -470,13 +470,13 @@ Contents
-
-__iter__()[source]#
+__iter__()[source]#
Iterates over the contained CitationRecord
’s
-
-save(f)[source]#
+save(f)[source]#
Save object as bibtex to a filepath or filehandle
- Parameters:
@@ -492,7 +492,7 @@ Contents
-
-class qiime2.plugin.CitationRecord(type, fields)[source]#
+class qiime2.plugin.CitationRecord(type, fields)[source]#
A collections.namedtuple()
of bibtex entry type and entry fields.
- Parameters:
diff --git a/plugins/references/api/context.html b/plugins/references/api/context.html
index 6b679d0..db72fc6 100644
--- a/plugins/references/api/context.html
+++ b/plugins/references/api/context.html
@@ -441,7 +441,7 @@ Pipeline Context Object
-
-Context.get_action(plugin, action)[source]#
+Context.get_action(plugin, action)[source]#
Return a function matching the callable API of an action.
This function is aware of the pipeline context and manages its own
cleanup as appropriate.
@@ -451,7 +451,7 @@ Pipeline Context Object
-
-Context.make_artifact(type, view, view_type=None)[source]#
+Context.make_artifact(type, view, view_type=None)[source]#
Return a new artifact from a given view.
This artifact is automatically tracked and cleaned by the pipeline
context.
diff --git a/plugins/references/api/formats.html b/plugins/references/api/formats.html
index 654dc16..3258681 100644
--- a/plugins/references/api/formats.html
+++ b/plugins/references/api/formats.html
@@ -442,27 +442,27 @@ Contents
Formats#
-
-class qiime2.plugin.TextFileFormat(path=None, mode='w')[source]#
+class qiime2.plugin.TextFileFormat(path=None, mode='w')[source]#
-
-class qiime2.plugin.BinaryFileFormat(path=None, mode='w')[source]#
+class qiime2.plugin.BinaryFileFormat(path=None, mode='w')[source]#
-
-class qiime2.plugin.DirectoryFormat(path=None, mode='w')[source]#
+class qiime2.plugin.DirectoryFormat(path=None, mode='w')[source]#
-
-qiime2.plugin.SingleFileDirectoryFormat(name, pathspec, format)[source]#
+qiime2.plugin.SingleFileDirectoryFormat(name, pathspec, format)[source]#
-
-class qiime2.plugin.ValidationError[source]#
+class qiime2.plugin.ValidationError[source]#
diff --git a/plugins/references/api/plugin.html b/plugins/references/api/plugin.html
index 9c5b077..647532f 100644
--- a/plugins/references/api/plugin.html
+++ b/plugins/references/api/plugin.html
@@ -462,7 +462,7 @@ Contents
Plugin & Registration#
-
-class qiime2.plugin.Plugin(name, version, website, package=None, project_name=None, citation_text=None, user_support_text=None, short_description=None, description=None, citations=None)[source]#
+class qiime2.plugin.Plugin(name, version, website, package=None, project_name=None, citation_text=None, user_support_text=None, short_description=None, description=None, citations=None)[source]#
A QIIME 2 Plugin.
An instance of this class defines all features of a given plugin
and is instantiated as a module global (i.e. a singleton).
@@ -495,7 +495,7 @@ Contents
-
-register_formats(*formats, citations=None)[source]#
+register_formats(*formats, citations=None)[source]#
Register file formats to the plugin
- Parameters:
@@ -516,7 +516,7 @@ Contents
-
-register_views(*views, citations=None)[source]#
+register_views(*views, citations=None)[source]#
Register arbitrary views (Python classes or formats) to the plugin
- Parameters:
@@ -534,7 +534,7 @@ Contents
-
-register_validator(semantic_expression)[source]#
+register_validator(semantic_expression)[source]#
Decorator which registers a validator
- Parameters:
@@ -569,7 +569,7 @@ Contents
-
-register_transformer(_fn=None, *, citations=None)[source]#
+register_transformer(_fn=None, *, citations=None)[source]#
Decorator which registers a transformer to convert data
This decorator may be used with or without arguments.
@@ -618,7 +618,7 @@ Contents
-
-register_semantic_types(*type_fragments)[source]#
+register_semantic_types(*type_fragments)[source]#
Register semantic type fragments to the plugin
- Parameters:
@@ -638,7 +638,7 @@ Contents
-
-register_semantic_type_to_format(semantic_type, artifact_format=None, directory_format=None)[source]#
+register_semantic_type_to_format(semantic_type, artifact_format=None, directory_format=None)[source]#
Connect a semantic type expression to a format. Deprecated
Permits an arbitrary type expression and expands it to all concrete
variants which are then associated with the supplied
@@ -664,7 +664,7 @@
Contents
-
-register_artifact_class(semantic_type, directory_format, description=None, examples=None)[source]#
+register_artifact_class(semantic_type, directory_format, description=None, examples=None)[source]#
Register an artifact class which defines an Artifact
- Parameters:
@@ -706,11 +706,11 @@ Action registration
-
-class qiime2.plugin.plugin.PluginMethods(plugin)[source]#
+class qiime2.plugin.plugin.PluginMethods(plugin)[source]#
Accessed via plugin.methods
-
-register_function(function, inputs, parameters, outputs, name, description, input_descriptions=None, parameter_descriptions=None, output_descriptions=None, citations=None, deprecated=False, examples=None)[source]#
+register_function(function, inputs, parameters, outputs, name, description, input_descriptions=None, parameter_descriptions=None, output_descriptions=None, citations=None, deprecated=False, examples=None)[source]#
Register a method to the associated plugin.
- Parameters:
@@ -774,11 +774,11 @@ Action registration
-
-class qiime2.plugin.plugin.PluginVisualizers(plugin)[source]#
+class qiime2.plugin.plugin.PluginVisualizers(plugin)[source]#
Accessed via plugin.visualizers
-
-register_function(function, inputs, parameters, name, description, input_descriptions=None, parameter_descriptions=None, citations=None, deprecated=False, examples=None)[source]#
+register_function(function, inputs, parameters, name, description, input_descriptions=None, parameter_descriptions=None, citations=None, deprecated=False, examples=None)[source]#
Register a visualizer to the associated plugin.
- Parameters:
@@ -826,11 +826,11 @@ Action registration
-
-class qiime2.plugin.plugin.PluginPipelines(plugin)[source]#
+class qiime2.plugin.plugin.PluginPipelines(plugin)[source]#
Accessed via plugin.pipelines
-
-register_function(function, inputs, parameters, outputs, name, description, input_descriptions=None, parameter_descriptions=None, output_descriptions=None, citations=None, deprecated=False, examples=None)[source]#
+register_function(function, inputs, parameters, outputs, name, description, input_descriptions=None, parameter_descriptions=None, output_descriptions=None, citations=None, deprecated=False, examples=None)[source]#
Register a pipeline to the associated plugin.
- Parameters:
diff --git a/plugins/references/api/testing.html b/plugins/references/api/testing.html
index 0724444..f03cdba 100644
--- a/plugins/references/api/testing.html
+++ b/plugins/references/api/testing.html
@@ -451,7 +451,7 @@ Contents
Testing#
-
-class qiime2.plugin.testing.TestPluginBase(methodName='runTest')[source]#
+class qiime2.plugin.testing.TestPluginBase(methodName='runTest')[source]#
Test harness for simplifying testing QIIME 2 plugins.
TestPluginBase
extends unittest.TestCase
, with a few extra helpers
and assertions.
@@ -484,7 +484,7 @@ Contents
not have a method with the specified name.
-
-setUp()[source]#
+setUp()[source]#
Test runner setup hook.
If overriding this hook in a test, call __super__
to invoke this
method in the overridden hook, otherwise the harness might not work
@@ -493,7 +493,7 @@
Contents
-
-tearDown()[source]#
+tearDown()[source]#
Test runner teardown hook.
If overriding this hook in a test, call __super__
to invoke this
method in the overridden hook, otherwise the harness might not work
@@ -502,7 +502,7 @@
Contents
-
-get_data_path(filename, result_as_str=True)[source]#
+get_data_path(filename, result_as_str=True)[source]#
Convenience method for getting a data asset while testing.
Test data stored in the data/
dir local to the running test
can be accessed via this method.
@@ -526,7 +526,7 @@ Contents
-
-get_transformer(from_type, to_type)[source]#
+get_transformer(from_type, to_type)[source]#
Convenience method for getting a registered transformer.
This helper deliberately side-steps the framework’s validation
machinery, so that it is possible for plugin developers to test
@@ -549,7 +549,7 @@
Contents
-
-assertRegisteredSemanticType(semantic_type)[source]#
+assertRegisteredSemanticType(semantic_type)[source]#
Test assertion for ensuring a plugin’s semantic type is registered.
Fails if the semantic type requested is not found in the Plugin
Manager.
@@ -562,7 +562,7 @@ Contents
-
-assertSemanticTypeRegisteredToFormat(semantic_type, exp_format)[source]#
+assertSemanticTypeRegisteredToFormat(semantic_type, exp_format)[source]#
Test assertion for ensuring a semantic type is registered to a
format.
Fails if the semantic type requested is not registered to the format
@@ -580,7 +580,7 @@
Contents
-
-transform_format(source_format, target, filename=None, filenames=None)[source]#
+transform_format(source_format, target, filename=None, filenames=None)[source]#
Helper utility for loading data and transforming it.
Combines several other utilities in this class, will load files from
data/
, as source_format
, then transform to the target
view.
@@ -612,7 +612,7 @@ Contents
-
-execute_examples()[source]#
+execute_examples()[source]#
Runs all usage examples defined in the plugin.
@@ -620,7 +620,7 @@ Contents
-
-qiime2.plugin.testing.assert_no_nans_in_tables(fh)[source]#
+qiime2.plugin.testing.assert_no_nans_in_tables(fh)[source]#
Checks for NaNs present in any of the tables in the indicated file then
resets to the head of the file.
diff --git a/plugins/references/api/types.html b/plugins/references/api/types.html
index 6e3c13a..a032b58 100644
--- a/plugins/references/api/types.html
+++ b/plugins/references/api/types.html
@@ -488,7 +488,7 @@ Contents
Semantic Type#
-
-qiime2.plugin.SemanticType(name, field_names=None, field_members=None, variant_of=None)[source]#
+qiime2.plugin.SemanticType(name, field_names=None, field_members=None, variant_of=None)[source]#
Create a new semantic type.
- Parameters:
@@ -520,7 +520,7 @@ Semantic Type#
-
-class qiime2.plugin.Properties(*include, exclude=())[source]#
+class qiime2.plugin.Properties(*include, exclude=())[source]#
A one or more semantic properties to add to an existing type.
Semantic properties make an existing semantic type “smaller” than it
would otherwise be. If a union causes types to become larger, then a
@@ -777,7 +777,7 @@
Basic types#
-
-class qiime2.plugin.Choices(*choices)[source]#
+class qiime2.plugin.Choices(*choices)[source]#
A predicate which defines a set of allowable values.
Can be used with Str
and Bool
.
@@ -798,7 +798,7 @@ Predicates#
-
-class qiime2.plugin.Range([start, ]end, inclusive_start=True, inclusive_end=False)[source]#
+class qiime2.plugin.Range([start, ]end, inclusive_start=True, inclusive_end=False)[source]#
A predicate which defines a contiguous range of allowable values.
Can be used with Int
and Float
.
@@ -863,7 +863,7 @@ Predicates#
-
-qiime2.plugin.Start(start, inclusive=True)[source]#
+qiime2.plugin.Start(start, inclusive=True)[source]#
Shorthand to generate a Range
The end of the resulting range is None
(infinity).
@@ -888,7 +888,7 @@ Predicates#
-
-qiime2.plugin.End(end, inclusive=False)[source]#
+qiime2.plugin.End(end, inclusive=False)[source]#
Shorthand to generate a Range
The start of the resulting range is None
(negative infinity).
@@ -1056,7 +1056,7 @@ Collections#
-
-class qiime2.plugin.TypeMap(mapping)[source]#
+class qiime2.plugin.TypeMap(mapping)[source]#
A table of input types which match to output types.
The TypeMap is best thought of as a table in which QIIME 2 is trying to
find a row that matches the user’s input. Once found, the row-wise search
@@ -1134,7 +1134,7 @@
Dependent Types
-
-class qiime2.plugin.TypeMatch(listing)[source]#
+class qiime2.plugin.TypeMatch(listing)[source]#
A trivial TypeMap
such that every entry maps to itself.
A TypeMatch which looked like this:
T = TypeMatch([Foo, Bar, Baz])
diff --git a/plugins/references/api/usage.html b/plugins/references/api/usage.html
index ad986f6..df15e07 100644
--- a/plugins/references/api/usage.html
+++ b/plugins/references/api/usage.html
@@ -493,7 +493,7 @@ Initializers
-
-Usage.init_artifact(name, factory)[source]#
+Usage.init_artifact(name, factory)[source]#
Communicate that an artifact will be needed.
Driver implementations may use this to intialize data for an example.
@@ -530,7 +530,7 @@ Initializers
-
-Usage.init_artifact_from_url(name, url)[source]#
+Usage.init_artifact_from_url(name, url)[source]#
Obtain an artifact from a url.
Driver implementations may use this to intialize data for an example.
@@ -556,7 +556,7 @@ Initializers
-
-Usage.init_artifact_collection(name, factory)[source]#
+Usage.init_artifact_collection(name, factory)[source]#
Communicate that a result collection containing artifacts will be needed.
Driver implementations may use this to intialize data for an example.
@@ -597,7 +597,7 @@ Initializers
-
-Usage.init_metadata(name, factory)[source]#
+Usage.init_metadata(name, factory)[source]#
Communicate that metadata will be needed.
Driver implementations may use this to intialize data for an example.
@@ -634,7 +634,7 @@ Initializers
-
-Usage.init_metadata_from_url(name, url)[source]#
+Usage.init_metadata_from_url(name, url)[source]#
Obtain metadata from a url.
Driver implementations may use this to intialize example metadata.
@@ -671,7 +671,7 @@ Initializers
-
-Usage.init_format(name, factory, ext=None)[source]#
+Usage.init_format(name, factory, ext=None)[source]#
Communicate that a file/directory format will be needed.
Driver implementations may use this to intialize data for an example.
@@ -713,7 +713,7 @@ Importing
-
-Usage.import_from_format(name, semantic_type, variable, view_type=None)[source]#
+Usage.import_from_format(name, semantic_type, variable, view_type=None)[source]#
Communicate that an import should be done.
- Parameters:
@@ -766,7 +766,7 @@ Collections
-
-Usage.construct_artifact_collection(name, members)[source]#
+Usage.construct_artifact_collection(name, members)[source]#
Return a UsageVariable of type artifact_collection given a list or dict
of its members.
@@ -802,7 +802,7 @@ Collections
-
-Usage.get_artifact_collection_member(name, variable, key)[source]#
+Usage.get_artifact_collection_member(name, variable, key)[source]#
Accesses and returns a member of a ResultCollection as a UsageVariable.
- Parameters:
@@ -848,7 +848,7 @@ Metadata
These methods demonstrate how to manipulate metadata.
-
-Usage.get_metadata_column(name, column_name, variable)[source]#
+Usage.get_metadata_column(name, column_name, variable)[source]#
Communicate that a column should be retrieved.
- Parameters:
@@ -895,7 +895,7 @@ Metadata
-
-Usage.view_as_metadata(name, variable)[source]#
+Usage.view_as_metadata(name, variable)[source]#
Communicate that an artifact should be views as metadata.
- Parameters:
@@ -935,7 +935,7 @@ Metadata
-
-Usage.merge_metadata(name, *variables)[source]#
+Usage.merge_metadata(name, *variables)[source]#
Communicate that these metadata should be merged.
- Parameters:
@@ -996,7 +996,7 @@ Annotations
-
-Usage.comment(text)[source]#
+Usage.comment(text)[source]#
Communicate that a comment should be made.
Default implementation is to do nothing.
@@ -1012,7 +1012,7 @@ Annotations
-
-Usage.help(action)[source]#
+Usage.help(action)[source]#
Communicate that help text should be displayed.
Default implementation is to do nothing.
@@ -1028,7 +1028,7 @@ Annotations
-
-Usage.peek(variable)[source]#
+Usage.peek(variable)[source]#
Communicate that an artifact should be peeked at.
Default implementation is to do nothing.
@@ -1056,7 +1056,7 @@ Actions#<
These methods invoke a plugin’s action.
-
-Usage.action(action, inputs, outputs)[source]#
+Usage.action(action, inputs, outputs)[source]#
Communicate that some action should be performed.
- Parameters:
@@ -1111,14 +1111,14 @@ Parameter Objects for
-
-Usage.UsageAction: Type[UsageAction] = <class 'qiime2.sdk.usage.UsageAction'>[source]#
+Usage.UsageAction: Type[UsageAction] = <class 'qiime2.sdk.usage.UsageAction'>[source]#
-
-class qiime2.sdk.usage.UsageAction(plugin_id, action_id)[source]#
+class qiime2.sdk.usage.UsageAction(plugin_id, action_id)[source]#
An object which represents a deferred lookup for a QIIME 2 action.
One of three “argument objects” used by Usage.action()
. The other two
are UsageInputs
and UsageOutputNames
.
@@ -1162,12 +1162,12 @@ Parameter Objects for
-
-Usage.UsageInputs: Type[UsageInputs] = <class 'qiime2.sdk.usage.UsageInputs'>[source]#
+Usage.UsageInputs: Type[UsageInputs] = <class 'qiime2.sdk.usage.UsageInputs'>[source]#
-
-class qiime2.sdk.usage.UsageInputs(**kwargs)[source]#
+class qiime2.sdk.usage.UsageInputs(**kwargs)[source]#
A dict-like mapping of parameters to arguments for invoking an action.
One of three “argument objects” used by Usage.action()
. The other two
are UsageAction
and UsageOutputNames
.
@@ -1200,12 +1200,12 @@ Parameter Objects for
-
-Usage.UsageOutputNames: Type[UsageOutputNames] = <class 'qiime2.sdk.usage.UsageOutputNames'>[source]#
+Usage.UsageOutputNames: Type[UsageOutputNames] = <class 'qiime2.sdk.usage.UsageOutputNames'>[source]#
-
-class qiime2.sdk.usage.UsageOutputNames(**kwargs)[source]#
+class qiime2.sdk.usage.UsageOutputNames(**kwargs)[source]#
A dict-like mapping of action outputs to desired names.
One of three “argument objects” used by Usage.action()
. The other two
are UsageAction
and UsageInputs
.
@@ -1251,7 +1251,7 @@ Results and Assertions
-
-class qiime2.sdk.usage.UsageOutputs(fields, values)[source]#
+class qiime2.sdk.usage.UsageOutputs(fields, values)[source]#
A vanity class over qiime2.sdk.Results
.
Returned by Usage.action()
with order defined by
UsageOutputNames
.
@@ -1259,7 +1259,7 @@ Results and Assertions
-
-class qiime2.sdk.usage.UsageVariable(name, factory, var_type, usage)[source]#
+class qiime2.sdk.usage.UsageVariable(name, factory, var_type, usage)[source]#
A variable which represents some QIIME 2 generate-able value.
These should not be used to represent primitive values such as strings,
numbers, booleans, or lists/sets thereof.
@@ -1269,7 +1269,7 @@ Results and Assertions
-
-UsageVariable.assert_has_line_matching(path, expression, key=None)[source]#
+UsageVariable.assert_has_line_matching(path, expression, key=None)[source]#
Communicate that the result of this variable should match a regex.
The default implementation is to do nothing.
@@ -1322,7 +1322,7 @@ Results and Assertions
-
-UsageVariable.assert_output_type(semantic_type, key=None)[source]#
+UsageVariable.assert_output_type(semantic_type, key=None)[source]#
Communicate that this variable should have a given semantic type.
The default implementation is to do nothing.
diff --git a/plugins/references/api/utils.html b/plugins/references/api/utils.html
index ba56b13..78fd41d 100644
--- a/plugins/references/api/utils.html
+++ b/plugins/references/api/utils.html
@@ -449,7 +449,7 @@ Contents
General Utils#
-
-qiime2.util.duplicate(src, dst)[source]#
+qiime2.util.duplicate(src, dst)[source]#
Alternative to shutil.copyfile()
this will use os.link()
when possible.
See shutil.copyfile()
for documention.
@@ -459,7 +459,7 @@
General Utils
-
-qiime2.util.redirected_stdio(stdout=None, stderr=None)[source]#
+qiime2.util.redirected_stdio(stdout=None, stderr=None)[source]#
A context manager to redirect stdio to a new file (if provided).
- Parameters:
@@ -481,12 +481,12 @@ General Utils#
-
-qiime2.plugin.util.transform(data, *, from_type=None, to_type)[source]#
+qiime2.plugin.util.transform(data, *, from_type=None, to_type)[source]#
-
-qiime2.plugin.util.get_available_cores(n_less=0)[source]#
+qiime2.plugin.util.get_available_cores(n_less=0)[source]#
Finds the number of currently available (logical) cores. Useful for plugins
that need to convert a 0 to a concrete number of cores when 0 is not
supported by the underlying/called software.
diff --git a/plugins/references/metadata-api.html b/plugins/references/metadata-api.html
index f5697d9..66a2d81 100644
--- a/plugins/references/metadata-api.html
+++ b/plugins/references/metadata-api.html
@@ -478,7 +478,7 @@ Contents
The qiime.Metadata
class#
-
-class qiime2.Metadata(dataframe, column_missing_schemes=None, default_missing_scheme='blank')[source]#
+class qiime2.Metadata(dataframe, column_missing_schemes=None, default_missing_scheme='blank')[source]#
Store metadata associated with identifiers in a study.
Metadata is tabular in nature, mapping study identifiers (e.g. sample or
feature IDs) to columns of metadata associated with each ID.
@@ -556,7 +556,7 @@ The qiime.Metad
-
-classmethod load(filepath, column_types=None, column_missing_schemes=None, default_missing_scheme='blank')[source]#
+classmethod load(filepath, column_types=None, column_missing_schemes=None, default_missing_scheme='blank')[source]#
Load a TSV metadata file.
The TSV metadata file format is described at https://docs.qiime2.org in
the Metadata Tutorial.
@@ -633,7 +633,7 @@ The qiime.Metad
-
-to_dataframe(encode_missing=False)[source]#
+to_dataframe(encode_missing=False)[source]#
Create a pandas dataframe from the metadata.
The dataframe’s index name (Index.name
) will match this metadata
object’s id_header
, and the index will contain this metadata
@@ -657,7 +657,7 @@
The qiime.Metad
-
-get_column(name)[source]#
+get_column(name)[source]#
Retrieve metadata column based on column name.
- Parameters:
@@ -679,7 +679,7 @@ The qiime.Metad
-
-get_ids(where=None)[source]#
+get_ids(where=None)[source]#
Retrieve IDs matching search criteria.
- Parameters:
@@ -704,7 +704,7 @@ The qiime.Metad
-
-merge(*others)[source]#
+merge(*others)[source]#
Merge this Metadata
object with other Metadata
objects.
Returns a new Metadata
object containing the merged contents of
this Metadata
object and others. The merge is not in-place and
@@ -744,7 +744,7 @@
The qiime.Metad
-
-filter_ids(ids_to_keep)[source]#
+filter_ids(ids_to_keep)[source]#
Filter metadata by IDs.
- Parameters:
@@ -771,7 +771,7 @@ The qiime.Metad
-
-filter_columns(*, column_type=None, drop_all_unique=False, drop_zero_variance=False, drop_all_missing=False)[source]#
+filter_columns(*, column_type=None, drop_all_unique=False, drop_zero_variance=False, drop_all_missing=False)[source]#
Filter metadata by columns.
- Parameters:
@@ -810,7 +810,7 @@ The qiime.Metad
Metadata columns#
-
-class qiime2.MetadataColumn(series, missing_scheme='blank')[source]#
+class qiime2.MetadataColumn(series, missing_scheme='blank')[source]#
Abstract base class representing a single metadata column.
Concrete subclasses represent specific metadata column types, e.g.
CategoricalMetadataColumn
and NumericMetadataColumn
.
@@ -862,7 +862,7 @@ Metadata columns
-
-to_series(encode_missing=False)[source]#
+to_series(encode_missing=False)[source]#
Create a pandas series from the metadata column.
The series index name (Index.name
) will match this metadata
column’s id_header
, and the index will contain this metadata
@@ -887,7 +887,7 @@
Metadata columns
-
-to_dataframe(encode_missing=False)[source]#
+to_dataframe(encode_missing=False)[source]#
Create a pandas dataframe from the metadata column.
The dataframe will contain exactly one column. The dataframe’s index
name (Index.name
) will match this metadata column’s id_header
,
@@ -913,7 +913,7 @@
Metadata columns
-
-get_missing()[source]#
+get_missing()[source]#
Return a series containing only missing values (with an index).
If the column was constructed with a missing scheme, then the values
of the series will be the original terms instead of NaN.
@@ -921,7 +921,7 @@ Metadata columns
-
-get_value(id)[source]#
+get_value(id)[source]#
Retrieve metadata column value associated with an ID.
- Parameters:
@@ -938,7 +938,7 @@ Metadata columns
-
-has_missing_values()[source]#
+has_missing_values()[source]#
Determine if the metadata column has one or more missing values.
- Returns:
@@ -957,7 +957,7 @@ Metadata columns
-
-drop_missing_values()[source]#
+drop_missing_values()[source]#
Filter out missing values from the metadata column.
- Returns:
@@ -975,7 +975,7 @@ Metadata columns
-
-get_ids(where_values_missing=False)[source]#
+get_ids(where_values_missing=False)[source]#
Retrieve IDs matching search criteria.
- Parameters:
@@ -998,7 +998,7 @@ Metadata columns
-
-filter_ids(ids_to_keep)[source]#
+filter_ids(ids_to_keep)[source]#
Filter metadata column by IDs.
- Parameters:
@@ -1027,7 +1027,7 @@ Metadata columns
-
-class qiime2.NumericMetadataColumn(series, missing_scheme='blank')[source]#
+class qiime2.NumericMetadataColumn(series, missing_scheme='blank')[source]#
A single metadata column containing numeric data.
See the Metadata
class docstring for details about Metadata
and
MetadataColumn
objects, including a description of column types and
@@ -1036,7 +1036,7 @@
Metadata columns
-
-class qiime2.CategoricalMetadataColumn(series, missing_scheme='blank')[source]#
+class qiime2.CategoricalMetadataColumn(series, missing_scheme='blank')[source]#
A single metadata column containing categorical data.
See the Metadata
class docstring for details about Metadata
and
MetadataColumn
objects, including a description of column types and
@@ -1048,7 +1048,7 @@
Metadata columns#
diff --git a/searchindex.js b/searchindex.js
index 3b16451..a564645 100644
--- a/searchindex.js
+++ b/searchindex.js
@@ -1 +1 @@
-Search.setIndex({"alltitles": {"": [[9, null], [10, null], [15, null], [29, null], [51, null], [68, null], [68, null], [68, null], [71, null]], "A few additional tests": [[68, "a-few-additional-tests"]], "A first test of our plugin action": [[68, "a-first-test-of-our-plugin-action"]], "A second test of our action": [[68, "a-second-test-of-our-action"]], "A visualizer for free!": [[51, "a-visualizer-for-free"]], "Accessibility and Transferability": [[10, "accessibility-and-transferability"]], "Acknowledgements": [[26, "acknowledgements"]], "Action registration": [[58, "action-registration"]], "Actions": [[24, "actions"], [61, "actions"]], "Activate the conda environment": [[47, "activate-the-conda-environment"]], "Add a Pipeline with parallel computing support": [[69, null]], "Add a Usage Example": [[71, null]], "Add a first (real) Method": [[68, null]], "Add a first Pipeline": [[70, null]], "Add a first Visualizer": [[66, null]], "Add a local alignment search Pipeline": [[69, "add-a-local-alignment-search-pipeline"]], "Add a new Artifact Class": [[67, null]], "Add a second transformer": [[65, null]], "Add an optional input to tabulate_las_results": [[74, "add-an-optional-input-to-tabulate-las-results"]], "Add parallel computing support to search_and_summarize": [[69, "add-parallel-computing-support-to-search-and-summarize"]], "Add tests and documentation": [[70, "add-tests-and-documentation"]], "Add unit tests and update the search-and-summarize usage example": [[74, "add-unit-tests-and-update-the-search-and-summarize-usage-example"]], "Add unit tests of the new transfomer": [[65, "add-unit-tests-of-the-new-transfomer"]], "Additional Objects": [[57, "additional-objects"]], "Advanced Filtering": [[51, "advanced-filtering"]], "Amplicon distribution": [[47, "amplicon-distribution"]], "An Analogy": [[16, "an-analogy"]], "An optional exercise": [[66, "an-optional-exercise"], [67, "an-optional-exercise"], [68, "an-optional-exercise"], [70, "an-optional-exercise"]], "Anatomy of an Archive": [[9, null]], "Annotations": [[61, "annotations"]], "Archive Version 0": [[21, "archive-version-0"]], "Archive Version 1": [[21, "archive-version-1"]], "Archive Version 2": [[21, "archive-version-2"]], "Archive Version 3": [[21, "archive-version-3"]], "Archive Version 4": [[21, "archive-version-4"]], "Archive Version 5": [[21, "archive-version-5"]], "Archive Version 6": [[21, "archive-version-6"]], "Archive Version 7": [[21, "archive-version-7"]], "Archive versions": [[21, null]], "Artifact classes": [[31, "artifact-classes"], [67, "artifact-classes"]], "Associating Formats with a Type": [[11, "associating-formats-with-a-type"]], "Automate testing of your plugin": [[33, null]], "Automated Testing using Continuous Integration (CI) and Github Actions (GHA)": [[33, "automated-testing-using-continuous-integration-ci-and-github-actions-gha"]], "Automated testing of usage examples": [[71, "automated-testing-of-usage-examples"]], "Back matter": [[3, null]], "Basic types": [[60, "basic-types"]], "Binary File Formats": [[11, "binary-file-formats"]], "Building your first plugin": [[47, "building-your-first-plugin"]], "Calling the action with q2cli and the Python 3 API": [[68, "calling-the-action-with-q2cli-and-the-python-3-api"]], "Categorical Metadata Columns": [[51, "categorical-metadata-columns"]], "Choices": [[16, "choices"]], "Citations": [[54, null]], "Collections": [[60, "collections"], [61, "collections"]], "Command line interface": [[71, "command-line-interface"]], "Comments can provide context": [[50, "comments-can-provide-context"]], "Community Contributions on the QIIME 2 Forum": [[45, "community-contributions-on-the-qiime-2-forum"]], "Compare the serial versus parallel run times of the search-and-summarize": [[69, "compare-the-serial-versus-parallel-run-times-of-the-search-and-summarize"]], "Conclusion": [[72, null]], "Configure Continuous Integration (CI) testing": [[33, "configure-continuous-integration-ci-testing"]], "Configure weekly automated testing": [[33, "configure-weekly-automated-testing"]], "Contributing": [[26, "contributing"]], "Contributing to existing plugins": [[47, "contributing-to-existing-plugins"]], "Contributing to the current user documentation": [[7, "contributing-to-the-current-user-documentation"]], "Create _pipelines.py and add a Pipeline": [[70, "create-pipelines-py-and-add-a-pipeline"]], "Create a function to register as a Method": [[34, "create-a-function-to-register-as-a-method"]], "Create a function to register as a Pipeline": [[35, "create-a-function-to-register-as-a-pipeline"]], "Create a function to register as a Visualizer": [[37, "create-a-function-to-register-as-a-visualizer"]], "Create and register a Method": [[34, null]], "Create and register a pipeline": [[35, null]], "Create and register a visualizer": [[37, null]], "Create your plugin from a template": [[73, null]], "Creating and registering a Transformer": [[36, null]], "Data Goes In /data/": [[9, "data-goes-in-data"]], "Data factories for usage examples": [[50, "data-factories-for-usage-examples"]], "Decentralized retrospective provenance tracking": [[15, null]], "Define a citation for this action": [[68, "define-a-citation-for-this-action"]], "Define a transformer from skbio.DNA to q2_dwq2.SingleRecordDNAFASTAFormat": [[65, "define-a-transformer-from-skbio-dna-to-q2-dwq2-singlerecorddnafastaformat"]], "Define input data for your usage example": [[71, "define-input-data-for-your-usage-example"]], "Defining a Type": [[16, "defining-a-type"]], "Defining a new directory format": [[67, "defining-a-new-directory-format"]], "Defining a new file format": [[67, "defining-a-new-file-format"]], "Defining a new semantic type": [[67, "defining-a-new-semantic-type"]], "Defining a split Method": [[69, "defining-a-split-method"]], "Defining a usage example for nw-align": [[71, "defining-a-usage-example-for-nw-align"]], "Defining and registering a combine method": [[69, "defining-and-registering-a-combine-method"]], "Defining and registering a transformer": [[67, "defining-and-registering-a-transformer"]], "Defining different Format validation levels": [[40, null]], "Defining the usage example": [[71, "defining-the-usage-example"]], "Defining usage examples": [[50, "defining-usage-examples"]], "Defining your plugin object as an entry point": [[46, "defining-your-plugin-object-as-an-entry-point"]], "Dependent Types": [[60, "dependent-types"]], "Detailed Component Diagram": [[8, "detailed-component-diagram"]], "Developer documentation": [[5, null]], "Developing a new artifact class": [[67, "developing-a-new-artifact-class"]], "Developing with QIIME 2": [[26, null]], "Development status of this content": [[26, null]], "Directory Formats": [[11, "directory-formats"]], "Discovering artifact classes": [[67, "discovering-artifact-classes"]], "Displaying usage examples": [[71, "displaying-usage-examples"]], "Distribute plugins on GitHub": [[38, null]], "Distribution Development": [[4, null]], "Docs Development": [[6, null]], "Dropping Empty Columns": [[51, "dropping-empty-columns"]], "Examples": [[49, "examples"]], "Exceptions": [[24, "exceptions"], [64, "exceptions"]], "Expanding on the install instructions": [[38, "expanding-on-the-install-instructions"]], "Explanations": [[13, null], [28, null]], "Extending a Type": [[16, "extending-a-type"]], "Facilitating installation of your plugin for users": [[39, null]], "File Formats": [[11, "file-formats"]], "File Formats and Directory Formats": [[11, null]], "File types (or formats) and data types (or objects)": [[31, "file-types-or-formats-and-data-types-or-objects"]], "Finding docstring sources": [[5, "finding-docstring-sources"]], "Fixed Layouts": [[11, "fixed-layouts"]], "Following A Command Through QIIME 2": [[8, "following-a-command-through-qiime-2"]], "Formats": [[56, null]], "Framework Development": [[20, null]], "Funding": [[26, "funding"]], "Garbage Collection": [[12, null]], "General Utils": [[62, "general-utils"]], "Generating metadata as output from visualizations": [[51, "generating-metadata-as-output-from-visualizations"]], "Getting Feedback on your Plugin": [[43, "getting-feedback-on-your-plugin"]], "Getting Help": [[26, "getting-help"]], "Glossary": [[2, null]], "Goals for data storage in QIIME 2": [[10, "goals-for-data-storage-in-qiime-2"]], "Handling exceptions in parallel Pipelines": [[41, null]], "Help others understand how your tool will help them": [[45, "help-others-understand-how-your-tool-will-help-them"]], "Hint": [[70, null]], "How Data is Stored": [[10, null]], "How are transformers used by a plugin?": [[30, "how-are-transformers-used-by-a-plugin"]], "How can the Metadata API Help Me?": [[51, "how-can-the-metadata-api-help-me"]], "How to play nicely with other plugins": [[44, null]], "How to test QIIME 2 plugins": [[49, null]], "How to use Metadata": [[51, null]], "How-To Guides": [[17, null], [42, null]], "Importing": [[61, "importing"]], "Index": [[1, null]], "Individual Topics": [[57, "individual-topics"]], "Initializers": [[61, "initializers"]], "Input Validation (Type Checking)": [[10, "input-validation-type-checking"]], "Inputs and outputs": [[24, "inputs-and-outputs"]], "Install Prerequisites": [[47, "install-prerequisites"]], "Install and test your new plugin": [[73, "install-and-test-your-new-plugin"]], "Install the latest development version of the QIIME 2 \u201cTiny Distribution\u201d": [[47, "install-the-latest-development-version-of-the-qiime-2-tiny-distribution"]], "Install the tools needed for templating your plugin": [[73, "install-the-tools-needed-for-templating-your-plugin"]], "Installing other QIIME 2 distributions": [[47, "installing-other-qiime-2-distributions"]], "Installing your plugin on top of an existing QIIME 2 Distribution (recommended)": [[39, "installing-your-plugin-on-top-of-an-existing-qiime-2-distribution-recommended"]], "Installing your plugin using the Tiny Distribution and any custom required plugins": [[39, "installing-your-plugin-using-the-tiny-distribution-and-any-custom-required-plugins"]], "Instantiating a plugin": [[46, "instantiating-a-plugin"]], "Integrate metadata in Actions": [[74, null]], "Interface Developer Note:": [[16, null]], "Interface Development": [[23, null]], "Interface developer API reference": [[24, null]], "Interface development API": [[24, "interface-development-api"]], "Interoperability and Extension": [[10, "interoperability-and-extension"]], "Intersections": [[16, "intersections"]], "License": [[26, "license"]], "List of works cited": [[0, null]], "Making Artifacts Viewable as Metadata": [[51, "making-artifacts-viewable-as-metadata"]], "Making the new type and formats publicly importable": [[67, "making-the-new-type-and-formats-publicly-importable"]], "Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)": [[43, null]], "Merging Metadata": [[51, "merging-metadata"]], "Metadata": [[51, "metadata"], [60, "metadata"], [61, "metadata"]], "Metadata Columns": [[51, "metadata-columns"]], "Metadata columns": [[64, "metadata-columns"]], "Metagenome distribution": [[47, "metagenome-distribution"]], "Metaprogramming": [[14, null]], "Next steps": [[47, "next-steps"]], "Normalizing TSV Files": [[51, "normalizing-tsv-files"]], "Numeric Metadata Columns": [[51, "numeric-metadata-columns"]], "Optional exercise": [[71, "optional-exercise"]], "Optionally initialize a git repository during plugin templating": [[73, null]], "Overview": [[46, "overview"]], "Pairwise sequence alignment": [[68, "pairwise-sequence-alignment"]], "Parallel configuration and usage in QIIME 2": [[18, null]], "Parameter Objects for Usage.action": [[61, "parameter-objects-for"]], "Pipeline Context Object": [[55, null]], "Pipeline Provenance": [[15, "pipeline-provenance"]], "Pipeline Resumption in QIIME 2": [[19, null]], "Pipeline provenance example": [[15, "pipeline-provenance-example"]], "Pipeline provenance take-aways": [[15, "pipeline-provenance-take-aways"]], "Pipeline resumption through the Python 3 API": [[19, "pipeline-resumption-through-the-python-3-api"]], "Pipeline resumption through the command line interface (CLI)": [[19, "pipeline-resumption-through-the-command-line-interface-cli"]], "Pipeline resumption \u267b\ufe0f": [[69, null]], "Plans for refactoring of user documentation": [[7, "plans-for-refactoring-of-user-documentation"]], "Plugin & Registration": [[58, null]], "Plugin API List": [[57, "plugin-api-list"]], "Plugin Development": [[52, null]], "Plugin Development API": [[57, null]], "Plugin Utils": [[62, "plugin-utils"]], "Plugin development anti-patterns": [[53, null]], "Post a pre-print": [[45, "post-a-pre-print"]], "Predicates": [[60, "predicates"], [60, "id1"]], "Primitive Types": [[16, "primitive-types"]], "Primitive types": [[60, "primitive-types"]], "Properties": [[16, "properties"]], "Provenance Goes In /provenance/": [[9, "provenance-goes-in-provenance"]], "Provenance Metadata": [[10, "provenance-metadata"]], "Provide technical support for your users": [[48, null]], "Providing input or output filepaths as parameters": [[53, "providing-input-or-output-filepaths-as-parameters"]], "Publicize your QIIME 2 plugins (or other QIIME 2-based tools)": [[45, null]], "Putting it together": [[31, "putting-it-together"]], "Python 3 API": [[71, "python-3-api"]], "QIIME 2 Library": [[45, "qiime-2-library"]], "QIIME 2 architecture overview": [[8, null]], "Range": [[16, "range"]], "References": [[22, null], [25, null], [63, null]], "Refining a Type": [[16, "refining-a-type"]], "Register a QIIME 2 plugin": [[46, null]], "Register the Method": [[34, "register-the-method"]], "Register the Pipeline": [[70, "register-the-pipeline"]], "Register the Visualizer": [[37, "register-the-visualizer"]], "Register the action in plugin_setup.py": [[68, "register-the-action-in-plugin-setup-py"]], "Register the wrapper function as a plugin action": [[68, "register-the-wrapper-function-as-a-plugin-action"]], "Register your Python function as a plugin action": [[66, "register-your-python-function-as-a-plugin-action"]], "Registering an Action that Returns an Output Collection": [[32, "registering-an-action-that-returns-an-output-collection"]], "Registering an Action that Takes an Input Collection": [[32, "registering-an-action-that-takes-an-input-collection"]], "Registering an artifact class": [[67, "registering-an-artifact-class"]], "Registering split_sequences": [[69, "registering-split-sequences"]], "Registering the Pipeline": [[35, "registering-the-pipeline"]], "Registering the type, formats, and artifact class": [[67, "registering-the-type-formats-and-artifact-class"]], "Registering the usage example": [[71, "registering-the-usage-example"]], "Registering usage examples": [[50, "registering-usage-examples"]], "Results and Assertions": [[61, "results-and-assertions"]], "Rules for identifying an archive": [[9, "rules-for-identifying-an-archive"]], "Run cookiecutter to create your plugin": [[73, "run-cookiecutter-to-create-your-plugin"]], "SQL Filtering": [[51, "sql-filtering"]], "Semantic Properties": [[16, "semantic-properties"]], "Semantic Subtyping": [[16, "semantic-subtyping"]], "Semantic Type": [[60, "semantic-type"]], "Semantic Types, Primitives, and Visualizations": [[16, null]], "Semantic types": [[31, "semantic-types"]], "Semantic types, data types, file formats, and artifact classes": [[31, null]], "Set up your development environment": [[47, null]], "Setting up your development environment": [[26, null]], "Share your plugin on GitHub": [[38, "share-your-plugin-on-github"]], "Should our sequence splitter take the size of each split or the number of splits to create as input?": [[69, null]], "Single File Directory Formats": [[11, "single-file-directory-formats"]], "Skipping format validation": [[53, "skipping-format-validation"]], "Summary": [[8, "summary"]], "Template your plugin": [[38, "template-your-plugin"]], "Testing": [[59, null]], "Testing the parallel Pipeline": [[69, "testing-the-parallel-pipeline"]], "Testing the semantic type and formats": [[67, "testing-the-semantic-type-and-formats"]], "Testing the transformer": [[67, "testing-the-transformer"]], "Testing usage examples": [[50, "testing-usage-examples"]], "Text File Formats": [[11, "text-file-formats"]], "The Config File": [[18, "the-config-file"]], "The Most Important File: metadata.yaml": [[9, "the-most-important-file-metadata-yaml"]], "The PluginManager Object": [[24, "the-pluginmanager-object"]], "The ResultCollection object": [[32, "the-resultcollection-object"]], "The action block": [[15, "the-action-block"]], "The action.yaml file": [[15, "the-action-yaml-file"]], "The environment block": [[15, "the-environment-block"]], "The execution block": [[15, "the-execution-block"]], "The input metadata": [[74, "the-input-metadata"]], "The qiime.Metadata class": [[64, "the-qiime-metadata-class"]], "The structure of QIIME 2 plugin packages": [[29, null]], "Transformers": [[30, null]], "Trying it out": [[50, "trying-it-out"]], "Trying the new action": [[68, "trying-the-new-action"]], "Tutorial table of contents": [[75, "tutorial-table-of-contents"]], "Tutorial: A step-by-step guide to building your first QIIME 2 plugin": [[75, null]], "Types": [[60, null]], "Types of QIIME 2 Actions": [[27, null]], "Unions": [[16, "unions"]], "Unique IDs": [[15, "unique-ids"]], "Unit testing": [[67, "unit-testing"]], "Unit testing the visualizer function": [[66, "unit-testing-the-visualizer-function"]], "Update plugin_setup.py": [[74, "update-plugin-setup-py"]], "Update search-and-summarize": [[74, "update-search-and-summarize"]], "Update search-and-summarize to use split and combine Methods": [[69, "update-search-and-summarize-to-use-split-and-combine-methods"]], "Update the nw_align action to avoid duplicating information": [[70, "update-the-nw-align-action-to-avoid-duplicating-information"]], "Updating nw-align to use the new artifact class": [[67, "updating-nw-align-to-use-the-new-artifact-class"]], "Usage Examples": [[61, null]], "Use Artifact Collections as Action inputs or outputs": [[32, null]], "User Metadata API": [[64, null]], "User documentation": [[7, null]], "Using Collections": [[32, "using-collections"]], "Using Collections with the Python API": [[32, "using-collections-with-the-python-api"]], "Using Collections with the command line interface (CLI)": [[32, "using-collections-with-the-command-line-interface-cli"]], "Using QIIME 2 in parallel through the Python 3 API": [[18, "using-qiime-2-in-parallel-through-the-python-3-api"]], "Using QIIME 2 in parallel through the command line interface (CLI)": [[18, "using-qiime-2-in-parallel-through-the-command-line-interface-cli"]], "Utilities": [[62, null]], "Utility functions": [[24, "utility-functions"]], "Validation": [[11, "validation"]], "Variable Layouts": [[11, "variable-layouts"]], "Version-agnostic format guarantees": [[21, "version-agnostic-format-guarantees"]], "Visualization type": [[60, "visualization-type"]], "What Provenance Data is Captured?": [[15, "what-provenance-data-is-captured"]], "What to test and what not to test": [[68, "what-to-test-and-what-not-to-test"]], "Why Capture Provenance Data?": [[15, "why-capture-provenance-data"]], "Why a ZIP File?": [[9, "why-a-zip-file"]], "Wrapping up testing": [[68, "wrapping-up-testing"]], "Write a wrapper function": [[68, "write-a-wrapper-function"]], "Write the visualizer function": [[66, "write-the-visualizer-function"]], "Write unit tests": [[68, "write-unit-tests"]], "Writing Usage Examples": [[50, null]], "Writing tutorials": [[71, "writing-tutorials"]], "init": [[32, "init"]], "load": [[32, "load"]], "q2-dwq2": [[29, "q2-dwq2"]], "q2-dwq2/.git": [[29, "q2-dwq2-git"]], "q2-dwq2/.github": [[29, "q2-dwq2-github"]], "q2-dwq2/.gitignore": [[29, "q2-dwq2-gitignore"]], "q2-dwq2/LICENSE": [[29, "q2-dwq2-license"]], "q2-dwq2/MANIFEST.in": [[29, "q2-dwq2-manifest-in"]], "q2-dwq2/Makefile": [[29, "q2-dwq2-makefile"]], "q2-dwq2/README.md": [[29, "q2-dwq2-readme-md"]], "q2-dwq2/ci": [[29, "q2-dwq2-ci"]], "q2-dwq2/q2_dwq2": [[29, "q2-dwq2-q2-dwq2"]], "q2-dwq2/q2_dwq2/__init__.py": [[29, "q2-dwq2-q2-dwq2-init-py"]], "q2-dwq2/q2_dwq2/_methods.py": [[29, "q2-dwq2-q2-dwq2-methods-py"]], "q2-dwq2/q2_dwq2/_version.py": [[29, "q2-dwq2-q2-dwq2-version-py"]], "q2-dwq2/q2_dwq2/citations.bib": [[29, "q2-dwq2-q2-dwq2-citations-bib"]], "q2-dwq2/q2_dwq2/plugin_setup.py": [[29, "q2-dwq2-q2-dwq2-plugin-setup-py"]], "q2-dwq2/q2_dwq2/setup.cfg": [[29, "q2-dwq2-q2-dwq2-setup-cfg"]], "q2-dwq2/q2_dwq2/setup.py": [[29, "q2-dwq2-q2-dwq2-setup-py"]], "q2-dwq2/q2_dwq2/tests": [[29, "q2-dwq2-q2-dwq2-tests"]], "q2-dwq2/q2_dwq2/tests/__init__.py": [[29, "q2-dwq2-q2-dwq2-tests-init-py"]], "q2-dwq2/q2_dwq2/tests/data": [[29, "q2-dwq2-q2-dwq2-tests-data"]], "q2-dwq2/q2_dwq2/tests/test_methods.py": [[29, "q2-dwq2-q2-dwq2-tests-test-methods-py"]], "q2-dwq2/q2_dwq2/versioneer.py": [[29, "q2-dwq2-q2-dwq2-versioneer-py"]], "save": [[32, "save"]], "site_config_dir": [[18, null]], "split-apply-combine flowchart for search and summarize": [[69, "split-apply-combine-flowchart"]], "tl;dr": [[65, null], [66, "add-alignment-visualizer-commit"], [67, "add-artifact-class-commit"], [68, "add-nw-align-method-commit"], [69, "add-parallel-pipeline-commits"], [70, "add-pipeline-commit"], [71, "add-usage-example-commit"], [74, "integrate-metadata-commits"]], "user_config_dir": [[18, null]]}, "docnames": ["back-matter/bibliography", "back-matter/genindex", "back-matter/glossary", "back-matter/intro", "ci/intro", "docs/developer-documentation", "docs/intro", "docs/user-documentation", "framework/explanations/architecture", "framework/explanations/archives", "framework/explanations/data-storage", "framework/explanations/formats", "framework/explanations/garbage-collection", "framework/explanations/intro", "framework/explanations/metaprogramming", "framework/explanations/provenance", "framework/explanations/types", "framework/how-to-guides/intro", "framework/how-to-guides/parallel-configuration", "framework/how-to-guides/pipeline-resumption", "framework/intro", "framework/references/archive-versions", "framework/references/intro", "interfaces/intro", "interfaces/references/api", "interfaces/references/intro", "intro", "plugins/explanations/actions", "plugins/explanations/intro", "plugins/explanations/package-structure", "plugins/explanations/transformers", "plugins/explanations/types-of-types", "plugins/how-to-guides/artifact-collections-as-io", "plugins/how-to-guides/automate-testing", "plugins/how-to-guides/create-register-method", "plugins/how-to-guides/create-register-pipeline", "plugins/how-to-guides/create-register-transformer", "plugins/how-to-guides/create-register-visualizer", "plugins/how-to-guides/distribute-on-gh", "plugins/how-to-guides/facilitate-installation", "plugins/how-to-guides/format-validation-levels", "plugins/how-to-guides/handle-exceptions-in-parallel-pipelines", "plugins/how-to-guides/intro", "plugins/how-to-guides/maximize-compatibility", "plugins/how-to-guides/play-nicely-with-others", "plugins/how-to-guides/publicize", "plugins/how-to-guides/register-a-plugin", "plugins/how-to-guides/set-up-development-environment", "plugins/how-to-guides/support-your-users", "plugins/how-to-guides/test-plugins", "plugins/how-to-guides/usage-examples", "plugins/how-to-guides/use-metadata", "plugins/intro", "plugins/references/antipatterns", "plugins/references/api/citations", "plugins/references/api/context", "plugins/references/api/formats", "plugins/references/api/intro", "plugins/references/api/plugin", "plugins/references/api/testing", "plugins/references/api/types", "plugins/references/api/usage", "plugins/references/api/utils", "plugins/references/intro", "plugins/references/metadata-api", "plugins/tutorials/add-2nd-transformer", "plugins/tutorials/add-alignment-visualizer", "plugins/tutorials/add-artifact-class", "plugins/tutorials/add-nw-align-method", "plugins/tutorials/add-parallel-pipeline", "plugins/tutorials/add-pipeline", "plugins/tutorials/add-usage-examples", "plugins/tutorials/conclusion", "plugins/tutorials/create-from-template", "plugins/tutorials/integrate-metadata", "plugins/tutorials/intro"], "envversion": {"sphinx": 62, "sphinx.domains.c": 3, "sphinx.domains.changeset": 1, "sphinx.domains.citation": 1, "sphinx.domains.cpp": 9, "sphinx.domains.index": 1, "sphinx.domains.javascript": 3, "sphinx.domains.math": 2, "sphinx.domains.python": 4, "sphinx.domains.rst": 2, "sphinx.domains.std": 2, "sphinx.ext.intersphinx": 1, "sphinxcontrib.bibtex": 9}, "filenames": ["back-matter/bibliography.md", "back-matter/genindex.md", "back-matter/glossary.md", "back-matter/intro.md", "ci/intro.md", "docs/developer-documentation.md", "docs/intro.md", "docs/user-documentation.md", "framework/explanations/architecture.md", "framework/explanations/archives.md", "framework/explanations/data-storage.md", "framework/explanations/formats.md", "framework/explanations/garbage-collection.md", "framework/explanations/intro.md", "framework/explanations/metaprogramming.md", "framework/explanations/provenance.md", "framework/explanations/types.md", "framework/how-to-guides/intro.md", "framework/how-to-guides/parallel-configuration.md", "framework/how-to-guides/pipeline-resumption.md", "framework/intro.md", "framework/references/archive-versions.md", "framework/references/intro.md", "interfaces/intro.md", "interfaces/references/api.md", "interfaces/references/intro.md", "intro.md", "plugins/explanations/actions.md", "plugins/explanations/intro.md", "plugins/explanations/package-structure.md", "plugins/explanations/transformers.md", "plugins/explanations/types-of-types.md", "plugins/how-to-guides/artifact-collections-as-io.md", "plugins/how-to-guides/automate-testing.md", "plugins/how-to-guides/create-register-method.md", "plugins/how-to-guides/create-register-pipeline.md", "plugins/how-to-guides/create-register-transformer.md", "plugins/how-to-guides/create-register-visualizer.md", "plugins/how-to-guides/distribute-on-gh.md", "plugins/how-to-guides/facilitate-installation.md", "plugins/how-to-guides/format-validation-levels.md", "plugins/how-to-guides/handle-exceptions-in-parallel-pipelines.md", "plugins/how-to-guides/intro.md", "plugins/how-to-guides/maximize-compatibility.md", "plugins/how-to-guides/play-nicely-with-others.md", "plugins/how-to-guides/publicize.md", "plugins/how-to-guides/register-a-plugin.md", "plugins/how-to-guides/set-up-development-environment.md", "plugins/how-to-guides/support-your-users.md", "plugins/how-to-guides/test-plugins.md", "plugins/how-to-guides/usage-examples.md", "plugins/how-to-guides/use-metadata.md", "plugins/intro.md", "plugins/references/antipatterns.md", "plugins/references/api/citations.md", "plugins/references/api/context.md", "plugins/references/api/formats.md", "plugins/references/api/intro.md", "plugins/references/api/plugin.md", "plugins/references/api/testing.md", "plugins/references/api/types.md", "plugins/references/api/usage.md", "plugins/references/api/utils.md", "plugins/references/intro.md", "plugins/references/metadata-api.md", "plugins/tutorials/add-2nd-transformer.md", "plugins/tutorials/add-alignment-visualizer.md", "plugins/tutorials/add-artifact-class.md", "plugins/tutorials/add-nw-align-method.md", "plugins/tutorials/add-parallel-pipeline.md", "plugins/tutorials/add-pipeline.md", "plugins/tutorials/add-usage-examples.md", "plugins/tutorials/conclusion.md", "plugins/tutorials/create-from-template.md", "plugins/tutorials/integrate-metadata.md", "plugins/tutorials/intro.md"], "indexentries": {"__iter__() (qiime2.plugin.citations method)": [[54, "qiime2.plugin.Citations.__iter__", false]], "action": [[2, "term-Action", true]], "action() (in module qiime2.sdk)": [[24, "qiime2.sdk.Action", false]], "action() (qiime2.sdk.usage.usage method)": [[61, "qiime2.sdk.usage.Usage.action", false]], "archive": [[2, "term-Archive", true]], "artifact": [[2, "term-Artifact", true]], "artifact api": [[2, "term-Artifact-API", true]], "artifact class": [[2, "term-Artifact-class", true]], "artifact() (in module qiime2.sdk)": [[24, "qiime2.sdk.Artifact", false]], "assert_has_line_matching() (qiime2.sdk.usage.usagevariable method)": [[61, "qiime2.sdk.usage.UsageVariable.assert_has_line_matching", false]], "assert_no_nans_in_tables() (in module qiime2.plugin.testing)": [[59, "qiime2.plugin.testing.assert_no_nans_in_tables", false]], "assert_output_type() (qiime2.sdk.usage.usagevariable method)": [[61, "qiime2.sdk.usage.UsageVariable.assert_output_type", false]], "assertregisteredsemantictype() (qiime2.plugin.testing.testpluginbase method)": [[59, "qiime2.plugin.testing.TestPluginBase.assertRegisteredSemanticType", false]], "assertsemantictyperegisteredtoformat() (qiime2.plugin.testing.testpluginbase method)": [[59, "qiime2.plugin.testing.TestPluginBase.assertSemanticTypeRegisteredToFormat", false]], "binaryfileformat (class in qiime2.plugin)": [[56, "qiime2.plugin.BinaryFileFormat", false]], "bool (in module qiime2.plugin)": [[60, "qiime2.plugin.Bool", false]], "categorical (in module qiime2.plugin)": [[60, "qiime2.plugin.Categorical", false]], "categoricalmetadatacolumn (class in qiime2)": [[64, "qiime2.CategoricalMetadataColumn", false]], "choices (class in qiime2.plugin)": [[60, "qiime2.plugin.Choices", false]], "citationrecord (class in qiime2.plugin)": [[54, "qiime2.plugin.CitationRecord", false]], "citations (class in qiime2.plugin)": [[54, "qiime2.plugin.Citations", false]], "collection (in module qiime2.plugin)": [[60, "qiime2.plugin.Collection", false]], "column_count (qiime2.metadata property)": [[64, "qiime2.Metadata.column_count", false]], "columns (qiime2.metadata property)": [[64, "qiime2.Metadata.columns", false]], "comment() (qiime2.sdk.usage.usage method)": [[61, "qiime2.sdk.usage.Usage.comment", false]], "conda metapackage": [[2, "term-Conda-metapackage", true]], "construct_artifact_collection() (qiime2.sdk.usage.usage method)": [[61, "qiime2.sdk.usage.Usage.construct_artifact_collection", false]], "deployment": [[2, "term-Deployment", true]], "directory format": [[2, "term-Directory-Format", true]], "directoryformat (class in qiime2.plugin)": [[56, "qiime2.plugin.DirectoryFormat", false]], "distribution": [[2, "term-Distribution", true]], "dr": [[2, "term-tl-dr", true]], "drop_missing_values() (qiime2.metadatacolumn method)": [[64, "qiime2.MetadataColumn.drop_missing_values", false]], "dry": [[2, "term-DRY", true]], "duplicate() (in module qiime2.util)": [[62, "qiime2.util.duplicate", false]], "end() (in module qiime2.plugin)": [[60, "qiime2.plugin.End", false]], "execute_examples() (qiime2.plugin.testing.testpluginbase method)": [[59, "qiime2.plugin.testing.TestPluginBase.execute_examples", false]], "file format": [[2, "term-File-Format", true]], "filter_columns() (qiime2.metadata method)": [[64, "qiime2.Metadata.filter_columns", false]], "filter_ids() (qiime2.metadata method)": [[64, "qiime2.Metadata.filter_ids", false]], "filter_ids() (qiime2.metadatacolumn method)": [[64, "qiime2.MetadataColumn.filter_ids", false]], "float (in module qiime2.plugin)": [[60, "qiime2.plugin.Float", false]], "format": [[2, "term-Format", true]], "framework": [[2, "term-Framework", true]], "galaxy": [[2, "term-Galaxy", true]], "get_action() (qiime2.sdk.context method)": [[55, "qiime2.sdk.Context.get_action", false]], "get_artifact_collection_member() (qiime2.sdk.usage.usage method)": [[61, "qiime2.sdk.usage.Usage.get_artifact_collection_member", false]], "get_available_cores() (in module qiime2.plugin.util)": [[62, "qiime2.plugin.util.get_available_cores", false]], "get_column() (qiime2.metadata method)": [[64, "qiime2.Metadata.get_column", false]], "get_data_path() (qiime2.plugin.testing.testpluginbase method)": [[59, "qiime2.plugin.testing.TestPluginBase.get_data_path", false]], "get_ids() (qiime2.metadata method)": [[64, "qiime2.Metadata.get_ids", false]], "get_ids() (qiime2.metadatacolumn method)": [[64, "qiime2.MetadataColumn.get_ids", false]], "get_metadata_column() (qiime2.sdk.usage.usage method)": [[61, "qiime2.sdk.usage.Usage.get_metadata_column", false]], "get_missing() (qiime2.metadatacolumn method)": [[64, "qiime2.MetadataColumn.get_missing", false]], "get_transformer() (qiime2.plugin.testing.testpluginbase method)": [[59, "qiime2.plugin.testing.TestPluginBase.get_transformer", false]], "get_value() (qiime2.metadatacolumn method)": [[64, "qiime2.MetadataColumn.get_value", false]], "has_missing_values() (qiime2.metadatacolumn method)": [[64, "qiime2.MetadataColumn.has_missing_values", false]], "help() (qiime2.sdk.usage.usage method)": [[61, "qiime2.sdk.usage.Usage.help", false]], "identifier": [[2, "term-Identifier", true]], "identity": [[2, "term-Identity", true]], "implementationerror() (in module qiime2.sdk)": [[24, "qiime2.sdk.ImplementationError", false]], "import_from_format() (qiime2.sdk.usage.usage method)": [[61, "qiime2.sdk.usage.Usage.import_from_format", false]], "init_artifact() (qiime2.sdk.usage.usage method)": [[61, "qiime2.sdk.usage.Usage.init_artifact", false]], "init_artifact_collection() (qiime2.sdk.usage.usage method)": [[61, "qiime2.sdk.usage.Usage.init_artifact_collection", false]], "init_artifact_from_url() (qiime2.sdk.usage.usage method)": [[61, "qiime2.sdk.usage.Usage.init_artifact_from_url", false]], "init_format() (qiime2.sdk.usage.usage method)": [[61, "qiime2.sdk.usage.Usage.init_format", false]], "init_metadata() (qiime2.sdk.usage.usage method)": [[61, "qiime2.sdk.usage.Usage.init_metadata", false]], "init_metadata_from_url() (qiime2.sdk.usage.usage method)": [[61, "qiime2.sdk.usage.Usage.init_metadata_from_url", false]], "input": [[2, "term-Input", true]], "int (in module qiime2.plugin)": [[60, "qiime2.plugin.Int", false]], "interface": [[2, "term-Interface", true]], "jobs (in module qiime2.plugin)": [[60, "qiime2.plugin.Jobs", false]], "list (in module qiime2.plugin)": [[60, "qiime2.plugin.List", false]], "load() (qiime2.metadata class method)": [[64, "qiime2.Metadata.load", false]], "load() (qiime2.plugin.citations class method)": [[54, "qiime2.plugin.Citations.load", false]], "make_artifact() (qiime2.sdk.context method)": [[55, "qiime2.sdk.Context.make_artifact", false]], "merge() (qiime2.metadata method)": [[64, "qiime2.Metadata.merge", false]], "merge_metadata() (qiime2.sdk.usage.usage method)": [[61, "qiime2.sdk.usage.Usage.merge_metadata", false]], "metadata": [[2, "term-Metadata", true]], "metadata (class in qiime2)": [[64, "qiime2.Metadata", false]], "metadata (in module qiime2.plugin)": [[60, "qiime2.plugin.Metadata", false]], "metadatacolumn (class in qiime2)": [[64, "qiime2.MetadataColumn", false]], "metadatacolumn (in module qiime2.plugin)": [[60, "qiime2.plugin.MetadataColumn", false]], "metadatafileerror (class in qiime2.metadata)": [[64, "qiime2.metadata.MetadataFileError", false]], "method": [[2, "term-Method", true]], "method() (in module qiime2.sdk)": [[24, "qiime2.sdk.Method", false]], "missing_scheme (qiime2.metadatacolumn property)": [[64, "qiime2.MetadataColumn.missing_scheme", false]], "name (qiime2.metadatacolumn property)": [[64, "qiime2.MetadataColumn.name", false]], "numeric (in module qiime2.plugin)": [[60, "qiime2.plugin.Numeric", false]], "numericmetadatacolumn (class in qiime2)": [[64, "qiime2.NumericMetadataColumn", false]], "output": [[2, "term-Output", true]], "package (qiime2.plugin.testing.testpluginbase attribute)": [[59, "qiime2.plugin.testing.TestPluginBase.package", false]], "pairwise sequence alignment": [[2, "term-Pairwise-sequence-alignment", true]], "parameter": [[2, "term-Parameter", true]], "parse_format() (in module qiime2.sdk)": [[24, "qiime2.sdk.parse_format", false]], "parse_type() (in module qiime2.sdk)": [[24, "qiime2.sdk.parse_type", false]], "payload": [[2, "term-Payload", true]], "peek() (qiime2.sdk.usage.usage method)": [[61, "qiime2.sdk.usage.Usage.peek", false]], "pipeline": [[2, "term-Pipeline", true]], "pipeline() (in module qiime2.sdk)": [[24, "qiime2.sdk.Pipeline", false]], "plugin": [[2, "term-Plugin", true]], "plugin (class in qiime2.plugin)": [[58, "qiime2.plugin.Plugin", false]], "plugin manager": [[2, "term-Plugin-Manager", true]], "pluginmanager() (in module qiime2.sdk)": [[24, "qiime2.sdk.PluginManager", false]], "pluginmethods (class in qiime2.plugin.plugin)": [[58, "qiime2.plugin.plugin.PluginMethods", false]], "pluginpipelines (class in qiime2.plugin.plugin)": [[58, "qiime2.plugin.plugin.PluginPipelines", false]], "pluginvisualizers (class in qiime2.plugin.plugin)": [[58, "qiime2.plugin.plugin.PluginVisualizers", false]], "primitive type": [[2, "term-Primitive-Type", true]], "properties (class in qiime2.plugin)": [[60, "qiime2.plugin.Properties", false]], "provenance": [[2, "term-Provenance", true]], "provenance replay": [[2, "term-Provenance-Replay", true]], "python 3 api": [[2, "term-Python-3-API", true]], "q2cli": [[2, "term-q2cli", true]], "range (class in qiime2.plugin)": [[60, "qiime2.plugin.Range", false]], "redirected_stdio() (in module qiime2.util)": [[62, "qiime2.util.redirected_stdio", false]], "register_artifact_class() (qiime2.plugin.plugin method)": [[58, "qiime2.plugin.Plugin.register_artifact_class", false]], "register_formats() (qiime2.plugin.plugin method)": [[58, "qiime2.plugin.Plugin.register_formats", false]], "register_function() (qiime2.plugin.plugin.pluginmethods method)": [[58, "qiime2.plugin.plugin.PluginMethods.register_function", false]], "register_function() (qiime2.plugin.plugin.pluginpipelines method)": [[58, "qiime2.plugin.plugin.PluginPipelines.register_function", false]], "register_function() (qiime2.plugin.plugin.pluginvisualizers method)": [[58, "qiime2.plugin.plugin.PluginVisualizers.register_function", false]], "register_semantic_type_to_format() (qiime2.plugin.plugin method)": [[58, "qiime2.plugin.Plugin.register_semantic_type_to_format", false]], "register_semantic_types() (qiime2.plugin.plugin method)": [[58, "qiime2.plugin.Plugin.register_semantic_types", false]], "register_transformer() (qiime2.plugin.plugin method)": [[58, "qiime2.plugin.Plugin.register_transformer", false]], "register_validator() (qiime2.plugin.plugin method)": [[58, "qiime2.plugin.Plugin.register_validator", false]], "register_views() (qiime2.plugin.plugin method)": [[58, "qiime2.plugin.Plugin.register_views", false]], "result": [[2, "term-Result", true]], "result() (in module qiime2.sdk)": [[24, "qiime2.sdk.Result", false]], "resultcollection() (in module qiime2.sdk)": [[24, "qiime2.sdk.ResultCollection", false]], "results() (in module qiime2.sdk)": [[24, "qiime2.sdk.Results", false]], "save() (qiime2.plugin.citations method)": [[54, "qiime2.plugin.Citations.save", false]], "semantic type": [[2, "term-Semantic-Type", true]], "semantictype() (in module qiime2.plugin)": [[60, "qiime2.plugin.SemanticType", false]], "set (in module qiime2.plugin)": [[60, "qiime2.plugin.Set", false]], "setup() (qiime2.plugin.testing.testpluginbase method)": [[59, "qiime2.plugin.testing.TestPluginBase.setUp", false]], "singlefiledirectoryformat() (in module qiime2.plugin)": [[56, "qiime2.plugin.SingleFileDirectoryFormat", false]], "start() (in module qiime2.plugin)": [[60, "qiime2.plugin.Start", false]], "str (in module qiime2.plugin)": [[60, "qiime2.plugin.Str", false]], "teardown() (qiime2.plugin.testing.testpluginbase method)": [[59, "qiime2.plugin.testing.TestPluginBase.tearDown", false]], "test_dir_prefix (qiime2.plugin.testing.testpluginbase attribute)": [[59, "qiime2.plugin.testing.TestPluginBase.test_dir_prefix", false]], "testpluginbase (class in qiime2.plugin.testing)": [[59, "qiime2.plugin.testing.TestPluginBase", false]], "textfileformat (class in qiime2.plugin)": [[56, "qiime2.plugin.TextFileFormat", false]], "threads (in module qiime2.plugin)": [[60, "qiime2.plugin.Threads", false]], "tl": [[2, "term-tl-dr", true]], "to_dataframe() (qiime2.metadata method)": [[64, "qiime2.Metadata.to_dataframe", false]], "to_dataframe() (qiime2.metadatacolumn method)": [[64, "qiime2.MetadataColumn.to_dataframe", false]], "to_series() (qiime2.metadatacolumn method)": [[64, "qiime2.MetadataColumn.to_series", false]], "transform() (in module qiime2.plugin.util)": [[62, "qiime2.plugin.util.transform", false]], "transform_format() (qiime2.plugin.testing.testpluginbase method)": [[59, "qiime2.plugin.testing.TestPluginBase.transform_format", false]], "transformer": [[2, "term-Transformer", true]], "type": [[2, "term-Type", true]], "type_from_ast() (in module qiime2.sdk)": [[24, "qiime2.sdk.type_from_ast", false]], "typemap (class in qiime2.plugin)": [[60, "qiime2.plugin.TypeMap", false]], "typematch (class in qiime2.plugin)": [[60, "qiime2.plugin.TypeMatch", false]], "uninitializedpluginmanagererror() (in module qiime2.sdk)": [[24, "qiime2.sdk.UninitializedPluginManagerError", false]], "usageaction (class in qiime2.sdk.usage)": [[61, "qiime2.sdk.usage.UsageAction", false]], "usageaction (qiime2.sdk.usage.usage attribute)": [[61, "qiime2.sdk.usage.Usage.UsageAction", false]], "usageinputs (class in qiime2.sdk.usage)": [[61, "qiime2.sdk.usage.UsageInputs", false]], "usageinputs (qiime2.sdk.usage.usage attribute)": [[61, "qiime2.sdk.usage.Usage.UsageInputs", false]], "usageoutputnames (class in qiime2.sdk.usage)": [[61, "qiime2.sdk.usage.UsageOutputNames", false]], "usageoutputnames (qiime2.sdk.usage.usage attribute)": [[61, "qiime2.sdk.usage.Usage.UsageOutputNames", false]], "usageoutputs (class in qiime2.sdk.usage)": [[61, "qiime2.sdk.usage.UsageOutputs", false]], "usagevariable (class in qiime2.sdk.usage)": [[61, "qiime2.sdk.usage.UsageVariable", false]], "uuid": [[2, "term-UUID", true]], "validationerror (class in qiime2.plugin)": [[56, "qiime2.plugin.ValidationError", false]], "validationerror() (in module qiime2.sdk)": [[24, "qiime2.sdk.ValidationError", false]], "view": [[2, "term-View", true]], "view_as_metadata() (qiime2.sdk.usage.usage method)": [[61, "qiime2.sdk.usage.Usage.view_as_metadata", false]], "visualization": [[2, "term-Visualization", true]], "visualization (in module qiime2.plugin)": [[60, "qiime2.plugin.Visualization", false]], "visualization (type)": [[2, "term-Visualization-Type", true]], "visualization() (in module qiime2.sdk)": [[24, "qiime2.sdk.Visualization", false]], "visualizer": [[2, "term-Visualizer", true]], "visualizer() (in module qiime2.sdk)": [[24, "qiime2.sdk.Visualizer", false]]}, "objects": {"qiime2": [[64, 0, 1, "", "CategoricalMetadataColumn"], [64, 0, 1, "", "Metadata"], [64, 0, 1, "", "MetadataColumn"], [64, 0, 1, "", "NumericMetadataColumn"]], "qiime2.Metadata": [[64, 1, 1, "", "column_count"], [64, 1, 1, "", "columns"], [64, 2, 1, "", "filter_columns"], [64, 2, 1, "", "filter_ids"], [64, 2, 1, "", "get_column"], [64, 2, 1, "", "get_ids"], [64, 2, 1, "", "load"], [64, 2, 1, "", "merge"], [64, 2, 1, "", "to_dataframe"]], "qiime2.MetadataColumn": [[64, 2, 1, "", "drop_missing_values"], [64, 2, 1, "", "filter_ids"], [64, 2, 1, "", "get_ids"], [64, 2, 1, "", "get_missing"], [64, 2, 1, "", "get_value"], [64, 2, 1, "", "has_missing_values"], [64, 1, 1, "", "missing_scheme"], [64, 1, 1, "", "name"], [64, 2, 1, "", "to_dataframe"], [64, 2, 1, "", "to_series"]], "qiime2.metadata": [[64, 0, 1, "", "MetadataFileError"]], "qiime2.plugin": [[56, 0, 1, "", "BinaryFileFormat"], [60, 3, 1, "", "Bool"], [60, 3, 1, "", "Categorical"], [60, 0, 1, "", "Choices"], [54, 0, 1, "", "CitationRecord"], [54, 0, 1, "", "Citations"], [60, 3, 1, "", "Collection"], [56, 0, 1, "", "DirectoryFormat"], [60, 4, 1, "", "End"], [60, 3, 1, "", "Float"], [60, 3, 1, "", "Int"], [60, 3, 1, "", "Jobs"], [60, 3, 1, "", "List"], [60, 3, 1, "", "Metadata"], [60, 3, 1, "", "MetadataColumn"], [60, 3, 1, "", "Numeric"], [58, 0, 1, "", "Plugin"], [60, 0, 1, "", "Properties"], [60, 0, 1, "", "Range"], [60, 4, 1, "", "SemanticType"], [60, 3, 1, "", "Set"], [56, 4, 1, "", "SingleFileDirectoryFormat"], [60, 4, 1, "", "Start"], [60, 3, 1, "", "Str"], [56, 0, 1, "", "TextFileFormat"], [60, 3, 1, "", "Threads"], [60, 0, 1, "", "TypeMap"], [60, 0, 1, "", "TypeMatch"], [56, 0, 1, "", "ValidationError"], [60, 3, 1, "", "Visualization"]], "qiime2.plugin.Citations": [[54, 2, 1, "", "__iter__"], [54, 2, 1, "", "load"], [54, 2, 1, "", "save"]], "qiime2.plugin.Plugin": [[58, 2, 1, "", "register_artifact_class"], [58, 2, 1, "", "register_formats"], [58, 2, 1, "", "register_semantic_type_to_format"], [58, 2, 1, "", "register_semantic_types"], [58, 2, 1, "", "register_transformer"], [58, 2, 1, "", "register_validator"], [58, 2, 1, "", "register_views"]], "qiime2.plugin.plugin": [[58, 0, 1, "", "PluginMethods"], [58, 0, 1, "", "PluginPipelines"], [58, 0, 1, "", "PluginVisualizers"]], "qiime2.plugin.plugin.PluginMethods": [[58, 2, 1, "", "register_function"]], "qiime2.plugin.plugin.PluginPipelines": [[58, 2, 1, "", "register_function"]], "qiime2.plugin.plugin.PluginVisualizers": [[58, 2, 1, "", "register_function"]], "qiime2.plugin.testing": [[59, 0, 1, "", "TestPluginBase"], [59, 4, 1, "", "assert_no_nans_in_tables"]], "qiime2.plugin.testing.TestPluginBase": [[59, 2, 1, "", "assertRegisteredSemanticType"], [59, 2, 1, "", "assertSemanticTypeRegisteredToFormat"], [59, 2, 1, "", "execute_examples"], [59, 2, 1, "", "get_data_path"], [59, 2, 1, "", "get_transformer"], [59, 5, 1, "", "package"], [59, 2, 1, "", "setUp"], [59, 2, 1, "", "tearDown"], [59, 5, 1, "", "test_dir_prefix"], [59, 2, 1, "", "transform_format"]], "qiime2.plugin.util": [[62, 4, 1, "", "get_available_cores"], [62, 4, 1, "", "transform"]], "qiime2.sdk": [[24, 4, 1, "", "Action"], [24, 4, 1, "", "Artifact"], [24, 4, 1, "", "ImplementationError"], [24, 4, 1, "", "Method"], [24, 4, 1, "", "Pipeline"], [24, 4, 1, "", "PluginManager"], [24, 4, 1, "", "Result"], [24, 4, 1, "", "ResultCollection"], [24, 4, 1, "", "Results"], [24, 4, 1, "", "UninitializedPluginManagerError"], [24, 4, 1, "", "ValidationError"], [24, 4, 1, "", "Visualization"], [24, 4, 1, "", "Visualizer"], [24, 4, 1, "", "parse_format"], [24, 4, 1, "", "parse_type"], [24, 4, 1, "", "type_from_ast"]], "qiime2.sdk.Context": [[55, 2, 1, "", "get_action"], [55, 2, 1, "", "make_artifact"]], "qiime2.sdk.usage": [[61, 0, 1, "", "UsageAction"], [61, 0, 1, "", "UsageInputs"], [61, 0, 1, "", "UsageOutputNames"], [61, 0, 1, "", "UsageOutputs"], [61, 0, 1, "", "UsageVariable"]], "qiime2.sdk.usage.Usage": [[61, 5, 1, "", "UsageAction"], [61, 5, 1, "", "UsageInputs"], [61, 5, 1, "", "UsageOutputNames"], [61, 2, 1, "", "action"], [61, 2, 1, "", "comment"], [61, 2, 1, "", "construct_artifact_collection"], [61, 2, 1, "", "get_artifact_collection_member"], [61, 2, 1, "", "get_metadata_column"], [61, 2, 1, "", "help"], [61, 2, 1, "", "import_from_format"], [61, 2, 1, "", "init_artifact"], [61, 2, 1, "", "init_artifact_collection"], [61, 2, 1, "", "init_artifact_from_url"], [61, 2, 1, "", "init_format"], [61, 2, 1, "", "init_metadata"], [61, 2, 1, "", "init_metadata_from_url"], [61, 2, 1, "", "merge_metadata"], [61, 2, 1, "", "peek"], [61, 2, 1, "", "view_as_metadata"]], "qiime2.sdk.usage.UsageVariable": [[61, 2, 1, "", "assert_has_line_matching"], [61, 2, 1, "", "assert_output_type"]], "qiime2.util": [[62, 4, 1, "", "duplicate"], [62, 4, 1, "", "redirected_stdio"]]}, "objnames": {"0": ["py", "class", "Python class"], "1": ["py", "property", "Python property"], "2": ["py", "method", "Python method"], "3": ["py", "data", "Python data"], "4": ["py", "function", "Python function"], "5": ["py", "attribute", "Python attribute"]}, "objtypes": {"0": "py:class", "1": "py:property", "2": "py:method", "3": "py:data", "4": "py:function", "5": "py:attribute"}, "terms": {"": [0, 2, 5, 8, 9, 10, 11, 15, 16, 18, 19, 21, 26, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 42, 44, 45, 46, 48, 50, 51, 52, 53, 54, 58, 59, 60, 61, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75], "0": [9, 11, 15, 16, 26, 32, 33, 35, 47, 50, 60, 61, 62, 66, 67, 68, 70, 73, 74], "00": 15, "001": 68, "00a294c": 21, "01": [26, 68], "03d_r": 11, "04": 15, "06": 71, "07": 15, "080381": 15, "1": [0, 11, 15, 16, 18, 26, 29, 32, 34, 35, 39, 50, 60, 61, 65, 66, 67, 68, 70, 71], "10": [11, 15, 21, 26, 33, 39, 60, 61, 62, 68], "100": [46, 60, 61, 69], "100014989": 26, "11": [0, 15, 21, 47, 53, 61], "1103": 15, "12": [7, 11, 15, 21, 47, 60], "13039": 26, "14": 67, "147": 0, "15": [43, 47, 69, 71], "16": [15, 33, 48, 69], "17": 68, "171": 67, "18": [47, 70], "184": 16, "19": 0, "195": 0, "197": 0, "1970": [0, 68], "1976": 29, "1981": 0, "1990": 0, "1u24ca248454": 26, "2": [0, 2, 4, 5, 7, 9, 11, 12, 13, 15, 16, 17, 20, 24, 28, 30, 31, 32, 33, 34, 35, 37, 38, 40, 41, 42, 44, 48, 50, 51, 52, 53, 54, 57, 58, 59, 60, 61, 62, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74], "20": [10, 15, 31, 60, 69], "2016": 21, "2017": 21, "2018": 21, "2019": [0, 21], "2021": [0, 15], "2022": 61, "2023": [0, 7, 47, 53], "2024": [2, 4, 11, 33, 38, 39, 43, 45, 48, 53, 67, 68, 72, 73], "2025": 33, "207342": 26, "20px": 66, "20th": [0, 68], "21": 15, "215": 0, "21t14": 15, "22": 72, "23": [4, 45, 67, 68], "24": [21, 38], "25": [66, 69, 71], "27a5": 15, "29": 70, "2adb9": 15, "2adb9f00": 15, "2c00": 21, "2nd": 0, "3": [0, 2, 11, 15, 16, 26, 34, 46, 47, 50, 60, 61, 64, 69, 74, 75], "30": 69, "333fd63a2b4a102e58e364f37cd98b74": 21, "34b07e56": 15, "35": 69, "3611a0c1": 15, "37921": 26, "38": 15, "3rd": 44, "4": [0, 2, 9, 15, 18, 26, 33, 60, 61, 67, 68, 70], "40": 69, "403": 0, "41": 68, "410": 0, "411d": 15, "414": 21, "42": [15, 61], "42b5": 15, "4308": 15, "4322": 15, "4373b96f26689f78889caeb1fbb94090": 21, "4389a0b": 21, "44": 73, "443": [0, 68], "453": [0, 68], "45c12936": 9, "469998": 15, "48": [0, 68], "484d": 9, "4886": 21, "4b60": 9, "4e2f": 15, "4f03": 15, "5": [0, 11, 15, 16, 39, 53, 60, 61, 67, 68, 69, 70], "50": 67, "5000": 11, "51": 67, "587": 15, "5a7118c14fd1bacc957ddf01e61491b7": 21, "6": [0, 15, 61, 68, 69], "610383": 15, "62c7": 15, "64": [47, 60], "66": 70, "68": 16, "684b8b7": 21, "6dada99d0c81": 21, "7": [0, 2, 15, 18], "7a40cff7855daffa28d4082194bdf60": 21, "7zip": 10, "8": [11, 15, 21, 47, 62, 66, 68], "80": 66, "8000": 7, "81b130d538c3": 15, "85": 69, "8601": 15, "862772dbrrej": 26, "87058ae3": 15, "8dd3": 15, "9": [11, 15, 21], "90": 69, "93224813": 15, "95": 69, "98ff96bad145": 9, "999": 60, "A": [0, 2, 9, 10, 11, 15, 16, 18, 21, 24, 26, 27, 29, 32, 34, 35, 37, 43, 46, 47, 50, 52, 54, 58, 59, 60, 61, 62, 64, 65, 67, 69, 70, 72], "And": [16, 51, 67, 69, 71, 75], "As": [4, 7, 9, 11, 15, 16, 21, 29, 32, 34, 35, 38, 39, 45, 50, 53, 58, 60, 65, 66, 67, 68, 69, 70, 71, 72], "At": [5, 8, 47, 51, 58, 65, 67, 68, 69, 74], "BY": 26, "Be": 38, "But": [53, 60, 67, 68, 74], "By": [15, 19, 29, 34, 39, 50, 51, 68, 74], "For": [2, 5, 10, 11, 12, 15, 16, 18, 21, 26, 27, 29, 30, 31, 32, 33, 34, 38, 44, 45, 46, 47, 50, 51, 53, 62, 64, 66, 67, 68, 69, 70, 71, 73, 74], "If": [5, 9, 10, 12, 15, 16, 18, 19, 26, 29, 31, 32, 33, 34, 37, 38, 39, 41, 42, 43, 44, 45, 46, 47, 48, 50, 51, 53, 58, 59, 60, 61, 64, 65, 66, 67, 68, 69, 70, 71, 73, 74, 75], "In": [2, 5, 8, 10, 11, 15, 16, 19, 21, 27, 29, 32, 33, 34, 37, 39, 41, 46, 50, 51, 53, 58, 60, 64, 65, 66, 67, 68, 69, 70, 71, 73, 74], "It": [8, 9, 11, 12, 15, 16, 19, 21, 24, 26, 27, 31, 32, 33, 35, 38, 45, 46, 50, 53, 58, 60, 65, 66, 67, 68, 70, 71, 75], "NOT": 32, "No": [60, 67], "Not": [8, 16, 60], "Of": [16, 61], "On": [18, 32, 67, 74], "One": [11, 16, 31, 61, 64, 67, 68, 69, 70, 75], "Or": [18, 60, 68, 73], "That": [15, 16, 18, 31, 45, 53, 66, 67, 68, 69, 70, 71, 72, 74], "Thats": 16, "The": [0, 2, 7, 8, 10, 11, 12, 14, 16, 19, 21, 26, 28, 30, 31, 33, 34, 35, 36, 37, 38, 39, 41, 43, 44, 45, 46, 47, 50, 51, 52, 53, 54, 55, 58, 59, 60, 61, 62, 65, 66, 67, 68, 69, 70, 71, 72, 73, 75], "Then": [7, 8, 9, 29, 66, 67, 68, 69, 71, 74], "There": [2, 9, 10, 15, 16, 18, 29, 31, 33, 41, 44, 46, 50, 53, 60, 61, 67, 68, 69], "These": [2, 7, 8, 9, 10, 11, 15, 16, 18, 21, 27, 30, 32, 33, 34, 36, 46, 50, 53, 57, 60, 61, 64, 68, 69, 70, 71], "To": [7, 8, 10, 11, 16, 18, 20, 26, 29, 31, 33, 38, 43, 47, 50, 52, 53, 59, 64, 66, 67, 68, 69, 70, 71, 73, 74, 75], "Will": [24, 60], "With": [15, 21, 33, 39, 43, 65, 67], "_": [11, 18, 19, 29, 34, 46, 58, 67, 68, 70], "_0": 58, "_001": 11, "_1": [36, 51, 58, 67], "_2": [36, 65, 67], "_3": 67, "_4": 67, "__all__": 67, "__getitem__": 16, "__init__": [5, 21, 67], "__iter__": 54, "__release__": 61, "__repr__": 66, "__super__": 59, "__version__": [46, 58, 68], "_action": 70, "_align_and_summarize_output": 70, "_align_and_summarize_output_descript": 70, "_archiv": [9, 21], "_batch": 69, "_confirm_acgt_onli": 67, "_confirm_single_record": 67, "_create_seq_artifact": [65, 71], "_exampl": [65, 71], "_exit": 12, "_fn": 58, "_html_templat": [66, 74], "_l": 11, "_method": [67, 68, 69, 70], "_nw_align_default": 70, "_nw_align_input": 70, "_nw_align_input_descript": 70, "_nw_align_paramet": 70, "_nw_align_parameter_descript": 70, "_pipelin": [69, 74], "_r": 11, "_result": [18, 41], "_split_seqs_default": 69, "_tabulate_las_default": 74, "_tabulate_las_paramet": 74, "_tabulate_las_parameter_descript": 74, "_test_simple1_help": 69, "_transform": [21, 65, 67], "_transform_singlerecorddnafastaformat_to_dna": 67, "_types_and_format": 67, "_validate_": [11, 40, 53, 67], "_validate_field_": 16, "_validate_n_int": 11, "_visual": [66, 74], "_ziparch": 9, "a10d5d44": 15, "a416": 15, "a692": 15, "a6d07fc80a01": 15, "a983": 15, "a_boo": 61, "a_div_vector": 50, "aaa": 68, "aaaa": 68, "aaaaaaaagg": [66, 68], "aaaaaaaaggggcctttttttt": 68, "aaaaaaaaggtggcctttttttt": [66, 68], "aaaag": 68, "aaaaggttt": 68, "aaaattt": 68, "aaccgctggcgaa": [65, 71], "aaccggttaacacccac": [66, 68], "aaccggttggccaa": [65, 71], "abbrevi": [15, 69], "abil": [40, 67], "abl": [9, 10, 11, 15, 16, 21, 29, 38, 44, 47, 48, 61, 66, 67, 68, 70, 71, 75], "about": [2, 7, 8, 10, 11, 15, 16, 18, 29, 31, 38, 45, 46, 49, 50, 51, 53, 58, 60, 64, 65, 68, 69, 71, 73, 74, 75], "abov": [7, 8, 15, 16, 18, 21, 29, 33, 34, 39, 43, 46, 47, 50, 60, 66, 67, 68, 69, 70, 71], "absenc": 60, "abstract": [10, 15, 16, 24, 64, 71], "abstractli": 71, "ac92": 15, "acactcaccacccaattgct": 69, "acactctccacccatttgct": 69, "acactctccagccatttgct": 69, "accept": [2, 5, 16, 27, 34, 35, 37, 45, 50, 58, 68, 69], "access": [2, 9, 15, 24, 26, 34, 43, 46, 53, 58, 59, 60, 61, 64, 65, 66, 67, 68, 69, 70, 75], "accggt": [66, 68], "accggtaaccggttaacacccac": [65, 67, 68], "accggtggaaccgg": [66, 68], "accggtggaaccggtaacacccac": [65, 67, 68], "accident": [10, 15, 31, 60], "accomplish": [10, 26, 35], "accord": [16, 38, 50], "accordingli": 68, "account": 39, "accur": [11, 15], "accuraci": 34, "acgt": 67, "achiev": [10, 14, 31, 42, 53, 68, 69, 70, 75], "acid": [0, 68], "acknowledg": 5, "acronym": 2, "across": [15, 18, 21, 29, 34, 53, 64, 68, 69, 70], "act": [24, 71], "actinomycetota": 74, "action": [2, 7, 8, 9, 10, 11, 14, 16, 18, 19, 21, 28, 29, 30, 31, 35, 42, 44, 46, 50, 51, 52, 53, 55, 60, 64, 67, 69, 71, 73, 75], "action_executor_map": 18, "action_id": [50, 61, 71], "activ": [4, 8, 15, 26, 31, 33, 45, 48, 68], "actor": 8, "actual": [15, 16, 18, 31, 32, 41, 50, 51, 61, 66, 67, 68, 69, 71, 74], "ad": [9, 11, 16, 21, 29, 31, 34, 35, 37, 44, 50, 60, 65, 66, 67, 68, 69, 70, 71, 72, 74], "adapt": [8, 26, 65, 67, 69, 70, 71], "add": [7, 16, 18, 21, 38, 41, 43, 52, 58, 60, 73, 75], "add_plugin": 24, "addion": 71, "addison": 0, "addit": [2, 9, 10, 12, 15, 16, 18, 29, 33, 37, 38, 39, 45, 47, 50, 51, 58, 60, 64, 66, 67, 69, 71, 74, 75], "addition": [10, 12, 16, 31, 51, 71], "additon": 9, "address": [10, 31, 33, 43, 66, 67, 68, 70], "adequ": 10, "adher": [34, 70], "adhoc": 18, "adjust": [33, 68], "administr": [18, 19], "adopt": [16, 29, 53, 67, 68], "advanc": [10, 18, 19, 32, 33, 45], "advantag": 10, "advis": 26, "ae0d0e26da5b84a6c0722148789c51e0": 21, "ae57": 15, "afb": 15, "afford": 60, "after": [18, 29, 31, 33, 38, 41, 47, 64, 67, 68, 69, 70, 71, 73, 74, 75], "ag": [45, 51, 61], "again": [8, 29, 32, 33, 39, 44, 64, 65, 66, 68, 69, 70, 74], "against": [33, 38, 61, 67, 69], "agnost": [4, 15], "ahead": [8, 50], "aid": 26, "aim": [11, 15], "airplan": 60, "alabast": 15, "alert": 33, "alfr": 26, "algorithm": [15, 31, 34, 68, 69, 75], "alia": [15, 21, 60], "alias": 15, "align": [0, 2, 15, 21, 66, 70, 74], "align_and_summar": 70, "aligned_sequ": [68, 71], "aligned_sequence1": [66, 68], "aligned_sequence2": [66, 68], "alignedproteinsequ": 67, "alignedrnasequ": 67, "alignedsequ": [66, 68, 70], "all": [2, 7, 8, 9, 10, 11, 15, 16, 18, 19, 21, 24, 26, 29, 30, 31, 32, 33, 34, 38, 39, 45, 46, 49, 50, 51, 53, 58, 59, 60, 61, 64, 66, 67, 68, 69, 70, 71, 73, 74, 75], "alloc": 12, "allot": 69, "allow": [2, 8, 9, 10, 11, 15, 16, 18, 21, 24, 26, 29, 31, 33, 43, 46, 50, 51, 53, 58, 60, 64, 67, 68, 69, 70, 71, 74], "almost": [2, 16, 38, 74], "alon": 21, "along": [2, 29, 30, 32, 43, 69, 73, 74], "alongsid": [10, 21], "alpha": [21, 27, 35, 37, 46, 50], "alpha_divers": 37, "alpha_group_signific": 37, "alphadivers": [35, 37, 50], "alreadi": [15, 16, 19, 31, 38, 42, 43, 48, 50, 53, 67, 68, 69, 73, 74, 75], "also": [4, 8, 9, 11, 15, 16, 18, 21, 24, 26, 31, 32, 33, 38, 39, 45, 48, 50, 51, 53, 58, 59, 60, 64, 65, 66, 67, 68, 69, 70, 71, 73, 74, 75], "alter": 2, "altern": [10, 18, 43, 62, 68, 69, 70], "although": [11, 51], "altschul": 0, "alwai": [8, 9, 11, 12, 15, 16, 33, 51, 60, 61, 64, 65, 66, 67, 68, 69, 70], "am": [29, 71], "ambigu": [2, 60, 67], "amino": [0, 68], "among": [15, 67], "amongst": 51, "amount": [8, 14, 69], "ampl": 33, "amplicon": [2, 7, 33, 38, 39, 43, 51], "an": [0, 2, 4, 8, 10, 11, 12, 13, 15, 18, 19, 20, 21, 24, 26, 29, 30, 31, 33, 34, 35, 36, 37, 38, 42, 43, 44, 49, 50, 51, 53, 54, 55, 58, 59, 60, 61, 64, 65, 69, 71, 73], "an_input_filepath": 53, "an_output_filepath": 53, "anaconda": 46, "analys": [15, 71], "analysi": [2, 10, 15, 27, 34, 37, 54, 68], "analyt": [37, 67], "analyz": [45, 69], "anatomi": [10, 13, 15, 20], "ancestor": [9, 21], "ancestor_uuid": 21, "ancestr": [2, 9, 68], "andrew": 0, "angl": 8, "angri": 68, "ani": [2, 7, 8, 9, 10, 11, 12, 15, 16, 18, 19, 26, 27, 29, 30, 32, 33, 34, 38, 43, 46, 47, 50, 51, 58, 59, 60, 64, 65, 66, 67, 68, 69, 70, 71, 73, 74], "anniversari": [0, 68], "annot": [2, 16, 30, 32, 34, 35, 36, 37, 50, 51, 58, 68, 69], "announc": 45, "anoth": [2, 9, 10, 11, 12, 16, 18, 27, 29, 36, 45, 48, 51, 60, 66, 67, 69, 70, 71, 74], "answer": [12, 38, 43, 48, 73], "anti": [11, 52, 63, 67], "antipattern": 68, "anyon": [4, 16, 67], "anyth": [10, 12, 16, 19, 26, 29, 31, 32, 33, 34, 37, 41, 50, 60, 61, 66, 67, 68, 69, 71, 74], "anytim": 33, "anywai": 16, "anywher": [16, 46, 51, 70], "api": [2, 5, 8, 14, 15, 16, 23, 25, 26, 33, 34, 35, 46, 50, 52, 53, 55, 59, 61, 63, 65, 66, 67, 70, 75], "app": 53, "appar": 69, "appdir": 18, "appear": [15, 16, 53, 68, 69], "append": [35, 69], "appl": [16, 47, 60], "appli": [0, 2, 29, 31, 34, 35, 53, 58, 64, 65, 68, 70, 74, 75], "applic": [0, 18, 34, 47, 64, 68, 70, 71, 74, 75], "approach": [4, 7, 10, 15, 26, 39, 43, 44, 45, 53, 67, 69, 75], "appropri": [9, 12, 21, 30, 31, 35, 46, 50, 55, 68], "approv": 4, "april": [4, 33, 38, 45, 67], "apt": 29, "aptli": 9, "ar": [2, 4, 5, 7, 8, 9, 10, 11, 12, 14, 15, 16, 18, 19, 21, 24, 26, 27, 29, 31, 32, 33, 34, 35, 36, 37, 38, 39, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 53, 57, 58, 60, 61, 62, 64, 65, 66, 67, 68, 69, 70, 71, 73, 74, 75], "arbitrari": [15, 53, 58, 60, 67, 69, 74], "arbitrarili": 2, "arbitrary_kei": 60, "architectur": [4, 13, 20], "archiv": [2, 8, 10, 11, 13, 15, 20, 22, 26, 31], "archiveformat": 21, "area": 4, "aren": [11, 16, 21, 53, 68], "arg": [16, 18, 41, 67, 68], "argument": [8, 16, 21, 32, 50, 53, 55, 58, 60, 61, 67, 70], "argumentless": 58, "aris": [16, 31, 33, 67], "aritfact": 65, "around": [10, 29, 32, 33, 48, 61, 68, 69], "arrai": [10, 50], "arrow": [8, 21], "art": 10, "articl": [29, 31, 45, 54, 67, 68, 71], "artifact": [2, 8, 9, 10, 11, 12, 14, 15, 16, 21, 24, 27, 28, 29, 30, 34, 35, 36, 37, 42, 43, 44, 50, 52, 53, 55, 58, 60, 61, 64, 65, 66, 68, 69, 70, 71, 73, 74, 75], "artifact_collect": 61, "artifact_for_md": 61, "artifact_format": 58, "artifactapiusag": [50, 71], "artifactclass": 67, "arvum": 74, "arxiv": 45, "ask": [16, 38, 43, 45], "aspect": [10, 14, 15, 20, 49, 67, 68], "assembl": 68, "assert": [16, 50, 59], "assert_frame_equ": 69, "assert_has_line_match": [50, 61], "assert_no_nans_in_t": 59, "assert_output_typ": [50, 61], "assertequ": [65, 67, 68], "assertin": [66, 69], "assertionerror": 61, "assertnotequ": 68, "assertraisesregex": 67, "assertregisteredsemantictyp": [59, 67], "assertsemantictyperegisteredtoformat": 59, "assess": 71, "asset": [9, 46, 47, 59], "assign": [15, 16, 21, 31, 50, 51, 60, 68, 70, 71], "assist": [29, 39, 43, 47], "associ": [2, 7, 15, 16, 21, 29, 30, 31, 39, 46, 53, 58, 60, 61, 64, 65, 67, 68, 69, 70, 71, 73, 74], "assum": [10, 18, 33, 38, 39, 53, 64, 68], "assur": 60, "ast": 24, "astut": 11, "asynchron": 8, "attach": 16, "attempt": [18, 19, 50, 51, 67, 68], "attent": 38, "attribut": [24, 32, 59, 69], "attt": 68, "audienc": 8, "august": [33, 43, 48, 72], "auth": 38, "authent": 38, "author": [5, 26, 45, 61, 68, 70], "authorit": 70, "auto": 60, "autodoc": 5, "autom": [7, 29, 42, 48, 50, 52, 67, 75], "automat": [12, 15, 16, 34, 35, 37, 54, 55, 58, 67, 70, 71], "avail": [2, 8, 9, 11, 18, 26, 31, 39, 43, 44, 50, 51, 55, 57, 61, 62, 67, 68, 69, 70, 71, 74], "avoid": [7, 16, 19, 31, 43, 44, 46, 50, 53, 67, 68, 71, 75], "awai": [16, 53, 58, 67], "awar": [16, 31, 39, 48, 53, 55, 67, 69, 74], "ax": 60, "b": [0, 16, 60, 61, 68], "b733": 21, "bacillota": 74, "bacillus_a": 74, "back": [10, 15, 16, 33, 53, 62, 64, 65, 66, 67, 68, 70, 71, 72, 73, 75], "backfir": 45, "background": [67, 68], "backward": [9, 32, 44, 75], "bacteri": 31, "bacteria": 74, "bad": [53, 67], "baerheim1994effect": 58, "bag": 16, "bail": 11, "banana": [16, 60], "bar": [32, 58, 60, 61], "bar1": 61, "bar2": 61, "bar3": 61, "bar4": 61, "bar5": 61, "bar6": 61, "bar7": 61, "barcod": [11, 51], "barcode_id": 11, "base": [2, 4, 10, 11, 14, 18, 19, 24, 29, 30, 31, 33, 42, 43, 48, 51, 52, 53, 58, 60, 64, 66, 67, 68, 69, 71], "basetyp": 58, "basi": [18, 31, 33, 68], "basic": [0, 11, 15, 16, 18, 32, 33, 39, 50, 67, 68], "baz": 60, "bbe1": 9, "bdc8a": 21, "beauti": 4, "becaus": [2, 8, 9, 10, 11, 12, 15, 16, 21, 29, 31, 33, 39, 41, 50, 53, 64, 65, 66, 67, 68, 69, 70, 71, 74], "becom": [8, 11, 12, 16, 30, 33, 58, 60, 67, 69, 71], "been": [9, 16, 21, 26, 29, 30, 32, 38, 43, 53, 64, 67, 68, 69, 70, 73, 75], "befor": [7, 8, 16, 19, 31, 33, 41, 42, 43, 44, 46, 50, 51, 65, 66, 67, 68, 69, 70, 71, 74, 75], "begin": [30, 45, 48, 64, 67, 68, 70, 75], "behav": 74, "behavior": [2, 8, 35, 50, 51, 58, 60, 68, 69, 70], "behind": [15, 16, 65, 70], "being": [5, 10, 12, 15, 16, 21, 31, 34, 39, 41, 44, 51, 53, 64, 67, 68], "believ": 10, "belong": [16, 18], "below": [8, 9, 15, 18, 21, 32, 33, 39, 46, 61, 64, 67], "benchmark": 48, "beneath": 18, "benefici": 33, "benefit": [15, 53, 67, 69, 71], "best": [16, 53, 60, 67, 68, 69], "beta": [30, 34, 35, 46], "beta_phylogenet": [30, 34], "beta_result": 35, "better": [8, 10, 12, 15, 16, 31, 47, 58, 65, 67], "between": [2, 4, 7, 8, 9, 10, 11, 15, 16, 21, 24, 30, 31, 33, 34, 35, 42, 52, 53, 60, 65, 67, 69, 74], "beyond": 50, "bib": [15, 21, 34, 46, 68], "bibtex": [15, 29, 34, 46, 54, 68], "bibtext": 68, "big": [53, 69, 71], "bigger": [46, 66], "binaryfileformat": [2, 11, 56, 58], "bio": [66, 67, 68], "bioconda": [33, 39], "bioinformat": [0, 2, 67, 68, 69, 74, 75], "biol": 0, "biolog": [2, 11], "biologi": [45, 68], "biom": [11, 29, 30, 31, 50, 68], "biomv210dirfmt": 9, "biopython": 67, "birthdai": 16, "bit": [11, 16, 18, 33, 46, 60, 66, 67, 68, 69, 70], "blame": 53, "blank": [16, 60, 64], "blast": [68, 69], "blith": 16, "blob": 47, "block": [41, 50, 67, 69, 70, 74], "blue": [15, 21], "blur": 7, "bodi": [51, 66, 67], "bolyen": [0, 5, 26], "book": [26, 29, 35, 68, 71], "bool": [16, 32, 58, 59, 60, 64], "bool_dict": 32, "bool_list": 32, "boolean": [16, 60, 61, 68], "bore": 67, "both": [8, 11, 15, 16, 31, 44, 46, 50, 60, 67, 68, 69, 70, 71], "bother": 71, "bottleneck": 4, "bottom": [8, 15, 67, 68, 71], "bound": [16, 60], "boundari": 68, "bowtie2index": 67, "box": [8, 15, 21, 53, 70], "brackendb": 67, "bracket": [8, 33, 39], "brai": 35, "branch": [7, 33, 39, 60], "bray_curtis_distance_matrix": 35, "bray_curtis_emperor": 35, "bray_curtis_pcoa_result": 35, "braycurti": 35, "break": [9, 11, 16, 18, 29, 71], "breviti": 8, "brief": [45, 46, 67, 68, 74], "briefli": [18, 49, 67, 68, 69], "bring": [15, 16, 68], "broad": [16, 60], "broadli": [53, 57, 71], "broken": [15, 26, 71], "browser": [2, 7, 38, 53], "bsd": [26, 68], "bug": [15, 53, 70], "buggi": 53, "bui": 45, "build": [4, 7, 16, 26, 29, 33, 42, 43, 52, 53, 57, 67, 68, 69, 70, 73], "built": [7, 8, 10, 16, 26, 29, 42, 45, 53, 64, 66, 67, 68, 70, 74], "bunch": [43, 66, 68], "bundl": 16, "burn": 53, "busi": [11, 45, 53], "bytesio": 62, "c": [0, 16, 18, 53, 60, 61, 68], "c1": 60, "c9811bcaa3e6": 15, "cach": [7, 19, 50, 66, 67, 68, 70, 74], "cache_path": 19, "cake": 16, "calcul": [19, 27, 46], "call": [8, 9, 10, 11, 12, 16, 18, 24, 29, 30, 31, 32, 34, 35, 36, 37, 41, 46, 50, 51, 53, 58, 59, 61, 62, 66, 67, 69, 70, 71, 73, 74], "callabl": [55, 58, 61], "came": 50, "can": [2, 4, 5, 7, 8, 9, 10, 11, 12, 15, 16, 18, 19, 21, 26, 27, 29, 30, 31, 32, 33, 34, 35, 37, 38, 39, 40, 43, 45, 46, 47, 48, 49, 53, 54, 58, 59, 60, 61, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75], "cancer": [7, 26], "cannot": [2, 8, 16, 27, 37, 62, 64], "canon": [26, 61], "capabl": [2, 11], "capit": 16, "caporaso": [0, 5, 26, 39, 43, 65, 66, 67, 68, 69, 70, 71, 73, 74], "captur": [9, 21, 43, 50, 75], "care": [8, 15, 30, 31, 50, 69], "carri": [10, 16, 31, 58], "casava": 11, "casavaoneeightsinglelanepersampledirfmt": 11, "case": [5, 8, 9, 11, 12, 15, 16, 29, 31, 32, 34, 39, 43, 47, 50, 51, 53, 60, 61, 64, 66, 67, 68, 69, 70, 71, 73, 74], "cast": [51, 64, 71], "cat": [60, 68], "cat1": 21, "catch": 33, "categor": [16, 60, 64], "categori": [16, 45, 48], "categorical_md_col": 51, "categoricalmetadatacolumn": [51, 64], "caught": 41, "caus": [8, 60], "caveat": [43, 75], "cc": 26, "cd": [7, 47], "cd4015db31da": 15, "cell": 51, "central": [2, 15, 48, 51, 65], "certain": [5, 10, 64, 70], "certainli": [2, 38], "chain": [15, 65, 67, 70], "chalk": 16, "challeng": [10, 67], "chan": 26, "chang": [2, 4, 7, 8, 19, 21, 26, 29, 32, 33, 38, 44, 45, 47, 50, 53, 58, 61, 66, 67, 68, 69, 70, 71, 73, 75], "changelog": 21, "channel": [33, 39], "chapter": [2, 26, 32, 42, 68, 69, 70, 74], "charact": [46, 60, 64, 66, 67, 68], "characterist": [15, 21], "charset": 66, "chart": 69, "check": [8, 9, 11, 18, 21, 31, 45, 47, 50, 51, 59, 61, 65, 66, 67, 68, 69, 71, 73], "checkbox": [16, 68], "checksum": 21, "chef": 16, "child": 12, "chloe": 0, "choic": [30, 31, 34, 38, 45, 60, 70], "choos": [10, 12, 15, 31, 44, 48, 51, 69], "chose": [15, 68, 74], "christian": 68, "christoph": 0, "ci": 47, "circl": [15, 16, 65], "circular": 44, "circumst": 53, "circumv": 53, "citabl": 45, "citat": [10, 15, 21, 34, 35, 37, 46, 52, 53, 57, 58, 63, 66, 70, 71, 73], "citation_text": 58, "citationrecord": [54, 58], "citatonrecord": 58, "cite": [2, 3, 9, 15, 21, 45, 68], "clang": 15, "clarifi": [10, 16], "class": [2, 10, 11, 15, 16, 18, 21, 24, 28, 30, 32, 34, 36, 43, 44, 49, 50, 51, 52, 53, 54, 56, 58, 59, 60, 61, 65, 66, 68, 69, 70, 71, 74, 75], "classmethod": [54, 64], "claus": [26, 64], "clean": [12, 29, 55], "cleaner": 50, "cleanup": [12, 55], "clear": [45, 68], "cleric": 15, "clever": [50, 58], "cli": 15, "click": [15, 68], "client": [15, 29], "clinic": [53, 68], "clone": [7, 47], "close": [9, 10, 16, 43, 64, 67], "closest": 74, "clunki": [50, 66, 67, 68], "cluster": [18, 31, 69], "co": 45, "code": [2, 5, 7, 8, 9, 11, 15, 21, 24, 29, 30, 33, 41, 43, 46, 50, 51, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75], "coerc": [30, 60], "cogniz": 43, "cohes": 2, "colin": 0, "colleagu": 15, "collect": [2, 13, 15, 16, 20, 21, 24, 35, 42, 50, 52, 54, 58, 64, 67, 68, 69], "collection_1": 61, "collection_2": 61, "collector": 12, "collis": 44, "color": 66, "column": [8, 16, 60, 61, 69, 74], "column_a": 61, "column_count": 64, "column_missing_schem": 64, "column_nam": 61, "column_ord": 74, "column_typ": [51, 64], "columnar": 2, "columnproperti": [60, 64], "com": [7, 15, 21, 33, 39, 46, 47], "combin": [2, 10, 11, 15, 16, 27, 34, 35, 37, 41, 50, 59], "combinator": 16, "combine_act": 69, "combine_las_report": 69, "come": [16, 27, 30, 31, 48, 53, 60, 65, 67, 68, 71, 72, 73, 74, 75], "comfort": [42, 47, 69, 73, 75], "comma": 70, "command": [2, 7, 15, 16, 27, 29, 31, 34, 38, 39, 43, 46, 47, 50, 53, 67, 68, 70, 73, 74, 75], "comment": [61, 64], "commentari": 61, "commerci": 26, "commit": [21, 29, 33, 38, 44, 67, 69, 71, 73], "common": [0, 2, 9, 10, 11, 15, 16, 21, 24, 30, 50, 53, 58, 67, 68, 70, 74], "commonli": [31, 51, 57, 68], "commun": [2, 8, 26, 33, 46, 48, 61, 70, 71], "compabl": 44, "compar": [8, 37, 58, 66, 67, 68, 70], "comparison": 37, "compat": [8, 9, 10, 24, 33, 39, 42, 46, 52, 53, 60], "complet": [7, 8, 10, 15, 16, 26, 31, 36, 38, 41, 43, 46, 58, 66, 67, 68, 69, 70, 71, 73, 75], "complex": [9, 15, 16, 46, 50, 66, 69], "complic": 74, "compon": [11, 21, 26, 29], "compos": [10, 11, 43, 60, 64, 70], "composit": [10, 15, 16, 39, 60], "compound": 16, "comprehens": 16, "compromis": [15, 16], "comput": [0, 2, 7, 10, 15, 16, 18, 31, 34, 35, 38, 41, 50, 51, 52, 53, 67, 70, 71, 73, 75], "computation": 70, "concat": 69, "concaten": 69, "concept": [31, 68], "conceptu": [60, 67], "concern": [8, 15, 26, 31, 34, 67, 68], "concis": 16, "conclud": 31, "conclus": [52, 75], "concret": [16, 51, 58, 62, 64], "concurr": 44, "conda": [2, 15, 18, 33, 38, 39, 43, 50], "conda_prefix": 18, "conda_subdir": 47, "condit": [59, 68], "confid": 53, "config": 47, "configur": [9, 11, 17, 20, 29, 48, 69, 70], "confirm": [7, 38, 45, 50, 65, 67, 68, 69, 71, 74], "conflict": [10, 33, 43], "confound": 12, "confus": [10, 31, 33], "congratul": 73, "connect": [46, 58], "consensu": 16, "consequ": [16, 60], "consid": [2, 10, 11, 15, 16, 21, 29, 43, 53, 60, 64, 67, 68, 69, 70], "consider": [16, 44, 64, 69], "consist": [9, 21, 51, 60, 64], "constrain": [16, 60], "constraint": [8, 10, 38], "construct": [8, 11, 14, 16, 18, 24, 43, 60, 64], "construct_artifact_collect": 61, "constructor": 61, "consum": [51, 53], "consumm": [15, 68], "consumpt": [2, 68], "contain": [2, 8, 9, 10, 11, 15, 16, 18, 26, 29, 31, 32, 34, 35, 37, 46, 51, 53, 54, 58, 61, 64, 67, 68, 71, 73, 74, 75], "content": [2, 4, 7, 9, 15, 31, 32, 39, 50, 64, 66, 67, 68, 72], "context": [2, 12, 15, 16, 18, 19, 29, 39, 46, 47, 52, 57, 58, 62, 63, 67, 69, 70, 71], "contigu": 60, "continu": [29, 38, 53, 67, 69, 73], "contract": 34, "contraint": 10, "contrast": [2, 9, 15, 27], "contribut": [5, 15], "contributor": 5, "control": [29, 67, 69, 70, 73], "convei": 68, "conveni": [9, 10, 16, 21, 29, 51, 53, 58, 59, 65, 66, 67], "convent": [29, 36, 46, 50, 60, 67, 68, 70, 71, 74], "convers": 30, "converst": 65, "convert": [2, 8, 10, 24, 30, 36, 58, 61, 62, 64, 65, 67, 74], "convinc": [68, 71], "cook": 16, "cookiecutt": [26, 29, 72], "cool": [29, 38, 45, 51, 53, 58, 65, 68, 69], "cool_project": 51, "coordin": [2, 8, 34], "copi": [65, 68, 73], "copyfil": 62, "copyright": 68, "core": [9, 12, 14, 15, 16, 19, 21, 35, 51, 60, 61, 62, 68, 69], "core_metr": 35, "core_metrics_phylogenet": 15, "correct": [15, 50, 53], "correctli": [53, 66], "correspond": [32, 34, 39, 60, 64, 67, 68, 74], "corrupt": 11, "cost": [16, 53], "costli": 53, "could": [10, 15, 16, 27, 31, 32, 34, 39, 45, 46, 50, 53, 58, 60, 66, 67, 68, 69, 71, 74], "couldn": [15, 53], "count": [31, 34, 66], "counter": 68, "counterpart": 16, "counterproduct": 53, "coupl": [8, 33, 53, 65, 67, 68], "courier": 66, "cours": [16, 33, 48, 68, 70], "cover": [7, 26, 46, 50], "cpu": 60, "cpu_count": 18, "crash": [41, 53], "creat": [4, 7, 9, 11, 12, 15, 16, 18, 19, 26, 29, 31, 32, 33, 38, 39, 42, 43, 44, 45, 46, 47, 50, 51, 52, 53, 55, 58, 59, 60, 61, 64, 65, 66, 67, 68, 71, 72, 74, 75], "create_pool": 19, "creation": [10, 15, 69], "creator": 67, "credit": 71, "criteria": [48, 64], "critic": [2, 70], "cron": 33, "cross": [7, 15, 53], "crude": 66, "cryptosporangium": 74, "csvdirformat": 58, "csvformat": 58, "ctx": [35, 55, 57, 58, 69, 70], "curiou": 50, "current": [4, 9, 11, 12, 15, 16, 21, 26, 32, 33, 38, 39, 43, 45, 47, 50, 62, 64], "curti": 35, "custom": [4, 15, 18, 21, 33, 73], "custom_ax": 15, "cut": 16, "cutadapt": [44, 51], "cutleri": 16, "cycl": 39, "czi": 26, "d": [0, 5, 26, 29, 33, 34, 43, 46, 66, 67, 68, 70, 71, 73], "d_001": 11, "dada2": [15, 44], "daf": 26, "daf2019": 26, "dag": 15, "dai": 26, "daniel": [0, 75], "darn": 38, "dash": [8, 46], "data": [2, 7, 8, 11, 12, 13, 16, 20, 21, 28, 30, 34, 36, 45, 51, 52, 53, 58, 59, 60, 61, 62, 64, 66, 67, 68, 69, 73, 75], "databas": 69, "datafram": [31, 51, 53, 58, 60, 61, 64, 69, 70, 74], "dataset": [7, 34], "date": [26, 33], "datetim": 15, "david": 0, "de": 32, "deal": [7, 16, 65], "debug": 33, "decemb": 53, "decentr": [10, 13, 20, 21], "decid": [8, 53, 60, 68, 70], "decis": [10, 16, 31, 69], "declar": [11, 31], "decor": [14, 16, 36, 58, 67], "decoupl": 8, "decreas": 69, "dedic": 50, "deep": [12, 15, 16], "def": [11, 30, 32, 34, 35, 36, 37, 50, 51, 53, 58, 61, 65, 66, 67, 68, 69, 70, 71, 74], "default": [15, 18, 19, 29, 33, 34, 38, 39, 51, 54, 58, 59, 61, 64, 67, 68, 69, 70, 71, 73], "default_missing_schem": 64, "defer": [8, 61], "defin": [2, 5, 8, 10, 11, 15, 18, 21, 24, 27, 29, 30, 31, 32, 33, 34, 35, 36, 37, 39, 42, 43, 47, 51, 52, 53, 58, 59, 60, 61, 64, 66, 70, 74, 75], "definit": [11, 16, 27, 32, 37, 50, 59, 67, 68, 69, 71], "defunct": 58, "degre": 34, "delai": 31, "delet": [65, 68, 73], "deliber": 59, "deliv": 10, "demonstr": [10, 58, 61, 68, 73], "demultiplex": [11, 31], "demultiplexed_seq": 21, "demutiplex": 67, "demux": 51, "denot": [2, 8], "depend": [2, 8, 9, 15, 18, 19, 21, 31, 33, 38, 39, 43, 46, 47, 50, 51, 67, 69, 70], "deploi": [44, 71], "deploy": [2, 31, 43, 44, 65, 70, 73], "deprec": [26, 58, 60], "depth": 27, "deriv": [2, 26, 68], "descend": 69, "describ": [2, 4, 8, 9, 10, 11, 15, 16, 18, 21, 29, 31, 33, 34, 35, 37, 46, 47, 50, 53, 61, 64, 65, 66, 67, 68, 69, 70, 71], "descript": [8, 9, 10, 15, 32, 34, 35, 37, 46, 53, 58, 64, 65, 66, 67, 68, 70, 74], "descriptor": [14, 16, 44, 62], "design": [9, 10, 30, 33, 64, 65, 69, 70], "desir": 61, "destin": [10, 30, 32, 62], "destroi": 12, "destruct": 12, "destructor": 12, "detail": [2, 4, 9, 10, 15, 16, 18, 21, 32, 34, 36, 40, 46, 50, 51, 57, 64, 67, 68, 69], "detect": [31, 67], "determin": [9, 10, 15, 16, 29, 30, 34, 51, 64, 66, 68, 69], "dev": [26, 29, 33, 47, 50, 66, 67, 68, 70, 74], "dev0": 47, "develop": [2, 7, 8, 10, 11, 15, 21, 25, 29, 31, 33, 36, 38, 39, 40, 41, 42, 43, 44, 45, 46, 48, 50, 51, 58, 59, 63, 64, 65, 66, 68, 69, 70, 71, 72, 73, 74, 75], "devic": 66, "df": [51, 61, 67], "diagram": 21, "dialog": [16, 53], "diataxi": [0, 71], "dict": [24, 32, 54, 58, 60, 61, 64, 68, 69, 70], "dict_of_int": 61, "dictat": [60, 61], "dictionari": [18, 24, 32, 34, 46, 50, 58, 60, 69, 70, 71, 74], "did": [65, 67, 68, 69, 70, 74], "didn": [2, 16, 41, 66, 68], "diff": 67, "differ": [2, 7, 9, 10, 11, 15, 16, 18, 19, 21, 24, 26, 31, 33, 34, 37, 39, 42, 46, 47, 52, 53, 61, 64, 65, 66, 67, 68, 69, 70, 71, 73], "differec": 53, "differenti": [11, 16, 21, 69, 74], "difficult": [10, 12, 31, 39], "digress": 67, "dillon": 0, "dimens": 34, "dine": 16, "dir": [59, 68, 73], "direct": [8, 15, 16, 33, 48, 75], "directli": [8, 10, 12, 15, 18, 21, 24, 29, 30, 31, 32, 34, 36, 50, 51, 60, 65, 67, 68, 70, 74], "directori": [2, 9, 10, 12, 13, 15, 18, 20, 21, 29, 31, 32, 33, 38, 39, 47, 50, 58, 61, 66, 68, 70, 71, 73], "directory_format": [14, 58], "directoryformat": [2, 11, 56, 58, 67], "disabl": 67, "disambigu": 31, "disassoci": 15, "discontinu": 60, "discourag": 9, "discours": 48, "discov": [15, 31, 33, 38, 45, 68, 71], "discoveri": [31, 53], "discret": 2, "discuss": [4, 7, 10, 15, 16, 26, 29, 31, 33, 40, 43, 53, 67, 68, 71, 72], "disk": [2, 10, 11, 31, 32, 61, 64, 67], "dispatch": [9, 16, 18, 21], "displai": [15, 29, 46, 50, 61, 66, 68, 73], "disregard": 50, "dissemin": 71, "distanc": [34, 35, 51, 67], "distance_matrix": [30, 34, 35], "distancematrix": [30, 34, 35, 36, 67], "distinct": [15, 16, 35, 58, 60, 68, 74], "distinguish": [2, 10, 16, 60], "distribut": [2, 7, 15, 18, 26, 33, 42, 46, 51, 52, 53, 68, 69, 73], "dive": [15, 16], "divers": [15, 27, 34, 35, 37, 44, 46, 50, 70], "diversity_lib": 50, "divid": 69, "di\u00e1taxi": [0, 26, 75], "dm": 35, "dna": [2, 11, 66, 67, 68, 69, 70, 71], "dnafastaformat": [11, 68], "dnaiter": [21, 67, 68, 69], "dnasequencesdirectoryformat": [11, 21], "do": [7, 10, 15, 16, 18, 19, 21, 26, 29, 30, 32, 34, 35, 36, 37, 38, 41, 43, 46, 48, 50, 51, 53, 58, 60, 61, 65, 66, 67, 68, 69, 70, 71, 72, 74, 75], "doc": [7, 26, 61, 64, 71], "docstr": [64, 68], "doctyp": 66, "document": [0, 6, 8, 10, 15, 16, 18, 19, 20, 21, 26, 29, 31, 32, 38, 42, 43, 46, 48, 49, 50, 53, 58, 61, 62, 64, 68, 71, 73, 75], "documentat": 71, "docx": 10, "doe": [2, 8, 9, 10, 12, 15, 16, 19, 26, 27, 29, 32, 34, 37, 45, 50, 58, 59, 60, 62, 64, 67, 68, 69, 70, 71], "doen": 9, "doesn": [11, 15, 16, 29, 31, 34, 43, 45, 47, 49, 64, 66, 67, 68, 69, 70, 71], "doi": [26, 45], "domain": [8, 16, 44, 58, 60], "don": [2, 4, 7, 10, 16, 19, 29, 33, 36, 38, 39, 45, 50, 53, 65, 66, 67, 68, 70, 71, 72, 73, 74], "done": [7, 8, 15, 18, 31, 33, 34, 38, 43, 46, 54, 61, 67, 68, 69, 70, 71, 74], "dot": 8, "doubl": 60, "doubt": 45, "down": [15, 16, 18, 67], "download": [15, 47, 53, 61, 73], "downstream": [33, 53, 74], "dozen": 16, "dr": 2, "draft": 43, "drill": 15, "driven": [2, 68], "driver": [7, 50, 58, 61, 71], "drop": 64, "drop_all_miss": 64, "drop_all_uniqu": 64, "drop_missing_valu": [51, 64], "drop_zero_vari": 64, "dropdown": 16, "dry": [2, 70, 74], "dst": 62, "dtype": 64, "due": [10, 32, 33, 69], "dull": 16, "dull_par": 16, "dummi": 53, "dummy_output": 53, "dummy_plugin": [32, 61], "dump": 16, "duplic": [9, 15, 19, 62, 71, 73, 74], "duplicate_t": [31, 68], "durat": 15, "dure": [7, 15, 19, 38, 46, 50, 53, 58, 61, 67, 68, 70], "dwq2": [4, 26, 31, 39, 46, 65, 66, 67, 68, 69, 70, 71, 73, 74], "dwq2_action": 71, "dynam": [8, 12], "e": [0, 2, 7, 9, 10, 11, 12, 15, 19, 21, 24, 26, 29, 31, 32, 33, 34, 35, 37, 38, 39, 43, 44, 45, 46, 50, 51, 53, 54, 58, 60, 61, 62, 64, 66, 67, 68, 69, 70, 71, 73, 75], "e072706": 21, "e1011676": 0, "e168": 15, "e5c5": 15, "each": [8, 9, 10, 15, 16, 21, 26, 29, 31, 33, 34, 35, 39, 43, 50, 51, 58, 60, 61, 64, 66, 67, 68, 70, 71, 75], "earli": [4, 75], "earlier": [16, 32, 67, 68, 70], "eas": [10, 15], "easi": [9, 16, 50, 67, 68, 70], "easier": [15, 16, 21, 38, 39, 43, 65, 67, 68], "easiest": [39, 50, 72, 73], "easili": [15, 18, 29, 31, 71], "eat": 16, "ebb5968ebafb": 15, "ecosystem": [33, 48, 67], "ed": 60, "ed5d": 15, "edg": 68, "edit": [0, 7, 29, 41, 53, 67, 68], "editor": 29, "effect": [8, 15, 60, 69], "effici": [31, 67], "effort": [8, 15, 53], "eigendecomposit": 34, "eigenvalu": 34, "eigenvector": 34, "eigh": 34, "either": [2, 8, 16, 19, 31, 33, 38, 43, 53, 60, 64, 67, 68, 69, 70, 73], "element": [15, 16, 18, 46, 51, 60, 61], "elev": 51, "elig": [48, 51], "elizabeth": 0, "els": [10, 29, 31, 32, 50, 67, 70], "elsevi": 68, "elsewher": [18, 53, 70], "email": [15, 48], "emp": 51, "emperor": [15, 35, 46], "emperor_plot": 35, "emploi": [44, 66], "emppairedenddirfmt": 11, "empti": [29, 32, 53, 58, 60], "en": 66, "enabl": [2, 9, 10, 15, 19, 29, 38, 41, 45, 50, 51, 65, 66, 67, 68, 69, 70, 71, 74], "enclos": 39, "encod": [9, 10, 64], "encode_miss": 64, "encount": [43, 67, 69], "encourag": [48, 58, 74], "end": [8, 15, 32, 45, 46, 60, 66, 67, 68, 70, 72, 73, 75], "endnot": 68, "energi": 69, "enforc": [16, 60, 64], "engin": [2, 53, 68, 70], "enough": [9, 16, 50, 69], "ensur": [9, 11, 12, 18, 33, 47, 50, 51, 53, 59, 66, 67, 68, 69, 71], "entir": [8, 9, 11, 12, 16, 39, 51, 58, 66, 70], "entireti": [67, 69], "entiti": [5, 10, 67], "entri": [2, 8, 29, 53, 54, 58, 60], "entry_point": [29, 46], "enumer": [8, 11, 32, 60, 69], "env": [33, 39, 47, 68], "environ": [2, 7, 10, 18, 21, 33, 38, 39, 42, 43, 50, 52, 67, 68, 71, 73, 74], "environment": 68, "epeat": 70, "epoch": [33, 39, 61], "epub": 10, "equal": [11, 16, 69], "equenc": 68, "equival": [7, 24, 60, 70], "erron": 70, "error": [10, 11, 31, 53, 61, 64, 67, 68, 74], "especi": [31, 73], "essenti": [16, 32, 46, 53, 58, 60, 67], "establish": 44, "etc": [11, 15, 16, 18, 21, 34, 46, 51], "euclidean": 51, "eval": 14, "evalu": [16, 18, 61], "evan": [0, 5, 16, 26], "evelop": 26, "even": [10, 15, 16, 29, 31, 35, 43, 50, 53, 66, 67, 68, 69], "evenness_vector": 35, "event": [15, 33, 60, 61, 68], "eventu": 41, "ever": [15, 16, 29, 37, 60, 65, 74], "everi": [9, 10, 11, 15, 37, 58, 60, 64, 68, 70, 71, 75], "everyon": [16, 45, 53], "everyth": [31, 47, 50, 53, 57, 65, 66, 67, 68, 69, 73], "everywher": 14, "evid": 69, "evil": 11, "evolut": 68, "evolv": [9, 21], "exact": 34, "exactli": [2, 10, 15, 27, 37, 50, 64, 65, 67, 68, 74], "examin": 30, "exampl": [2, 4, 7, 8, 9, 11, 12, 16, 21, 26, 27, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 41, 42, 44, 45, 46, 47, 51, 52, 53, 57, 58, 59, 60, 62, 63, 64, 65, 66, 67, 68, 69, 70, 72, 73, 75], "example1": 58, "example2": 58, "example_funct": 32, "example_function_variant1": 58, "example_function_variant2": 58, "excacerb": 12, "except": [11, 12, 15, 16, 35, 37, 42, 45, 52, 60, 66, 67, 68, 70], "excit": [51, 71], "exclud": [16, 29, 46, 60], "exclus": [44, 50, 59, 60, 70], "execut": [2, 8, 18, 19, 34, 50, 58, 59, 61, 68, 69, 70, 71, 73, 75], "execute_exampl": [50, 59, 71], "executionusag": 50, "executionusagevari": 61, "executor": 18, "executor_map": 18, "exemplifi": 31, "exercis": 69, "exist": [2, 4, 10, 11, 15, 16, 18, 19, 29, 31, 32, 34, 38, 41, 42, 44, 48, 51, 52, 53, 58, 60, 61, 62, 67, 68, 69, 73], "exit": [12, 24, 31, 41, 68, 73], "exp": 50, "exp_format": 59, "expand": [4, 7, 15, 18, 58, 66, 75], "expect": [7, 10, 11, 16, 18, 24, 26, 31, 32, 34, 37, 43, 45, 47, 50, 53, 59, 65, 66, 67, 68, 69, 71, 73], "expected_hit": 69, "expens": 70, "experi": [15, 45, 47, 69, 71], "experienc": [29, 43], "expert": 48, "expertis": [53, 71], "explain": 16, "explan": [20, 26, 29, 31, 40, 52, 67], "explanatori": 67, "explicit": 74, "explicitli": [16, 29, 32, 41, 53, 60], "explor": [26, 37, 46, 66, 70, 71], "export": [7, 51, 66, 68, 71], "expos": [11, 50, 51, 70], "express": [15, 16, 24, 50, 58, 60, 61, 71], "ext": 61, "extend": [2, 10, 32, 59, 68], "extens": [5, 33, 37, 40, 61, 67], "extension": 16, "extent": 45, "extern": [53, 58, 70], "extol": 16, "extra": [11, 16, 53, 59, 68, 74], "extract": [9, 10, 15], "extrem": 67, "f": [0, 11, 39, 50, 54, 61, 67, 74], "f1000": 45, "f6105891": 21, "f95f324": 21, "face": [50, 67, 71], "facet": 10, "facilit": [0, 7, 10, 33, 42, 43, 52, 68, 73, 74], "fact": [32, 43, 68], "facto": 32, "factori": [11, 16, 24, 60, 61, 65, 71], "factory1": 61, "factory2": 61, "fail": [8, 19, 31, 33, 53, 59, 66, 67], "failur": [31, 33, 53, 67, 68], "fair": [10, 68], "fairli": [39, 69], "faith_pd": 21, "fall": 68, "fallen": 33, "fals": [15, 36, 58, 59, 60, 64, 67, 68, 69], "familar": 74, "famili": 66, "familiar": [31, 39, 46, 50, 51, 67], "fanci": 16, "far": [16, 34, 74], "fast": 34, "fasta": [10, 11, 31, 67, 68], "faster": [7, 8, 18], "fastq": [10, 11, 31, 67], "fastqgzformat": 11, "favorit": 68, "featur": [2, 10, 27, 31, 35, 39, 50, 51, 53, 58, 60, 64, 67, 69, 71, 73, 74], "feature_data": [21, 68], "feature_t": [35, 50, 53], "feature_table1": 50, "feature_table2": 50, "feature_table3": 50, "feature_table_merge_exampl": 50, "feature_table_merge_three_tables_exampl": 50, "featuredata": [53, 66, 67, 68, 69, 70, 74], "featuret": [9, 30, 31, 34, 35, 50, 53, 73], "feb": 15, "feedback": [4, 5, 29, 72], "feel": [15, 33, 43, 45, 53, 67, 69, 71, 73], "few": [15, 16, 30, 31, 33, 35, 37, 44, 48, 49, 59, 66, 67, 70, 74, 75], "fewer": 69, "ff": [36, 58, 61, 65, 67, 71], "ff427b50aaa1": 15, "fh": [11, 36, 58, 59, 66, 67, 69, 74], "field": [15, 16, 24, 53, 54, 60, 61, 67, 68], "field_memb": [16, 60], "field_nam": [16, 60], "fifteen": 15, "fig": [9, 15, 21], "figur": [8, 37, 53, 66, 67, 69], "file": [2, 8, 10, 13, 16, 20, 21, 27, 28, 29, 32, 33, 34, 36, 37, 38, 39, 46, 47, 50, 52, 53, 54, 58, 59, 61, 62, 64, 65, 66, 68, 69, 70, 71, 73, 74], "file1": 61, "file2": 61, "filecollect": 11, "fileformat": 11, "filehandl": 54, "filenam": [10, 11, 15, 21, 29, 33, 59, 67], "filepath": [18, 29, 54, 59, 60, 64, 67], "filesystem": [12, 60], "fill": 39, "fillet": 16, "filter": [7, 64, 69, 74], "filter_column": [51, 64], "filter_id": 64, "final": [8, 15, 16, 18, 37, 43, 46, 50, 51, 60, 67, 68, 69, 70, 71, 74, 75], "find": [15, 16, 18, 26, 29, 31, 35, 37, 39, 42, 45, 46, 53, 58, 60, 62, 65, 68, 69, 70, 71, 73, 74, 75], "fine": [15, 38, 43, 47, 53], "finish": 8, "first": [7, 8, 11, 16, 18, 19, 26, 29, 30, 33, 35, 37, 38, 39, 42, 43, 50, 52, 53, 55, 58, 60, 65, 67, 69, 71, 72, 73, 74], "first_memb": 61, "fish": 16, "fit": 60, "five": 15, "fix": [10, 16, 33, 53, 60, 67], "flag": [18, 19], "flake8": 47, "flavor": 27, "flexibl": [43, 66, 67, 71, 74], "flexilib": 50, "float": [16, 60, 64, 67, 68, 70], "flow": 69, "flower": 16, "fly": 11, "fn": 67, "focu": [11, 15, 26, 43, 47, 50, 67], "focus": [48, 64, 68], "fold": 74, "folk": 71, "follow": [2, 9, 10, 16, 18, 19, 21, 29, 32, 33, 34, 35, 37, 38, 39, 41, 43, 46, 47, 50, 58, 64, 65, 66, 67, 68, 69, 70, 71, 73, 74], "font": 66, "foo": [32, 58, 60, 61], "forg": [15, 33, 39], "forget": [15, 16, 68, 72], "fork": [7, 16], "form": [2, 8, 15, 16, 32, 53, 67, 68], "formal": [16, 69, 70], "format": [2, 8, 9, 10, 13, 15, 16, 20, 28, 29, 30, 33, 34, 36, 42, 43, 44, 46, 49, 50, 51, 52, 57, 58, 59, 61, 63, 64, 65, 66, 68, 69, 71, 74, 75], "format_inst": 11, "format_str": 24, "former": 43, "formerli": 2, "fortun": [12, 32], "forum": [32, 43, 46, 48, 53, 58, 67, 68, 71, 72], "forward": [11, 33, 38, 68, 70, 71, 75], "found": [5, 8, 15, 18, 21, 33, 59, 60, 65, 66, 67, 68, 69, 73, 74], "foundat": [26, 43], "four": [8, 68], "fp": 67, "fr": 0, "fraction": 69, "fragil": 66, "fragment": [21, 58, 60, 69], "framework": [0, 2, 8, 9, 11, 14, 15, 16, 21, 26, 30, 40, 44, 46, 47, 50, 51, 53, 59, 61, 68, 71], "free": [2, 15, 29, 45, 46, 48, 53, 67, 68, 69, 73], "freedom": [16, 67], "frequenc": [9, 30, 31, 33, 34, 35, 50, 53, 73], "frequent": [31, 71], "fridai": 31, "friendli": [16, 46, 68, 69], "from": [2, 4, 5, 7, 8, 9, 10, 11, 12, 15, 16, 18, 19, 21, 24, 26, 29, 30, 31, 32, 33, 34, 35, 36, 38, 39, 41, 43, 44, 45, 46, 47, 48, 50, 52, 53, 54, 55, 58, 59, 60, 61, 64, 66, 67, 68, 69, 70, 71, 72, 74, 75], "from_typ": [59, 62, 68], "front": 29, "frost": 16, "fruit": 16, "frustrat": [31, 53, 69], "fsvd": 34, "ft": 50, "ft1_factori": 50, "ft2_factori": 50, "full": [15, 18, 21, 26, 49, 66, 68, 69, 70, 71], "fulli": [7, 15, 18, 53, 70], "fun": 71, "function": [2, 4, 8, 9, 11, 15, 16, 29, 30, 31, 32, 33, 36, 40, 43, 46, 47, 50, 51, 53, 55, 58, 59, 61, 65, 67, 69, 70, 71, 74, 75], "fundament": [16, 68, 75], "funder": 26, "further": [8, 12, 15, 16, 18, 60, 64], "futur": [7, 10, 11, 18, 19, 26, 32, 41, 53, 60, 70, 71], "fuzzi": 16, "g": [9, 10, 11, 12, 15, 21, 24, 26, 29, 31, 33, 35, 37, 38, 39, 43, 44, 45, 46, 50, 51, 53, 54, 61, 64, 67, 69, 70, 71, 73, 75], "g1827eab": 47, "g7cf7a7a": 47, "g8ac7e3": 47, "gain": 64, "galaxi": [2, 53, 68, 71, 75], "game": 68, "gap": [66, 68], "gap_extend_penalti": [67, 68, 69, 70], "gap_open_penalti": [67, 68, 69, 70], "garbag": [13, 20, 53], "gatekeep": 4, "gave": 32, "gehret": 0, "gene": 69, "gener": [0, 2, 4, 7, 8, 9, 10, 11, 15, 16, 18, 19, 24, 26, 27, 29, 30, 31, 33, 34, 37, 38, 39, 44, 45, 48, 50, 53, 58, 60, 61, 65, 66, 67, 68, 69, 70, 71, 72, 74, 75], "genera": 31, "genom": 68, "genu": 74, "get": [8, 10, 15, 16, 18, 29, 32, 36, 38, 45, 46, 47, 50, 53, 59, 66, 67, 68, 69, 70, 71, 73, 74, 75], "get_act": [35, 55, 69, 70], "get_artifact_collection_memb": 61, "get_available_cor": 62, "get_column": [60, 64], "get_config_from_fil": 18, "get_data_path": [59, 67, 68], "get_id": [51, 64], "get_index_path": 69, "get_metadata_column": 61, "get_miss": 64, "get_sequence_id": 67, "get_transform": [59, 65], "get_valu": 64, "ggcctttttttt": [66, 68], "gh": [38, 73], "gish": 0, "git": [7, 33, 38, 39, 47, 68], "github": [4, 5, 7, 15, 21, 26, 39, 42, 43, 46, 47, 48, 52, 67, 71, 73], "githubusercont": [39, 47], "give": [8, 15, 16, 46, 50, 67, 70, 71], "given": [2, 10, 15, 16, 24, 31, 50, 55, 58, 60, 61, 66, 67, 68, 69], "glanc": [8, 10], "global": [15, 44, 58, 68, 70], "global_pairwise_align_nucleotid": [67, 68, 70], "glossari": 3, "go": [7, 16, 29, 33, 38, 45, 50, 53, 66, 67, 68, 69, 70, 71, 72, 73], "goal": [8, 16, 26, 31, 42, 45, 53, 65, 66, 68, 69, 70, 71, 74], "goe": [11, 15], "golden": [68, 73], "gone": 53, "good": [16, 29, 33, 46, 51, 61, 66, 67, 68, 69, 71, 72, 73], "googl": 68, "gotcha": 11, "grab": 47, "grai": 8, "grain": 15, "grammar": 16, "grant": 26, "granular": 16, "grape": 16, "graph": 15, "graphic": [2, 10, 16, 37, 53, 68], "grasp": 16, "great": [16, 50, 67, 71], "greater": [21, 60, 68], "greg": [5, 26, 45, 68], "gregcaporaso": 47, "gregori": 0, "gross": 16, "ground": 18, "groundwork": 5, "group": [2, 8, 16, 37, 69, 71], "grow": 29, "grumpi": 38, "gttt": 68, "guarante": [19, 53], "guid": [20, 26, 29, 33, 39, 40, 47, 50, 52, 71], "guidanc": [43, 75], "guidelin": [39, 71], "gz": 11, "gzip": 11, "ha": [8, 9, 10, 11, 15, 16, 21, 26, 29, 31, 33, 35, 38, 41, 43, 46, 50, 51, 53, 60, 64, 66, 67, 68, 69, 70, 73, 74, 75], "habit": 46, "hack": [47, 50], "had": [9, 16, 31, 45, 58, 66, 67, 70], "hadn": 9, "halfwai": 8, "halko2011": 34, "hand": [8, 15, 16, 31, 51, 53, 67, 74], "handl": [12, 15, 30, 32, 42, 51, 52, 53, 64, 65, 69], "happen": [15, 16, 29, 31, 34, 61, 67, 69], "happi": [16, 71, 72], "har": [49, 59], "hard": [15, 16, 31, 44, 67], "harder": 16, "hardwar": 15, "has_missing_valu": [51, 64], "hash": 16, "hassl": 33, "have": [2, 5, 8, 9, 10, 11, 12, 15, 16, 18, 21, 26, 30, 31, 32, 33, 34, 35, 38, 39, 41, 43, 44, 45, 47, 48, 50, 51, 53, 59, 60, 61, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75], "haven": [10, 16, 33, 53, 67, 68, 69], "head": [16, 59, 66], "header": 64, "hear": [5, 12, 31], "hello": [60, 61], "help": [4, 7, 10, 15, 16, 29, 31, 33, 37, 38, 39, 43, 46, 47, 48, 50, 53, 58, 61, 67, 68, 70, 71, 72, 73, 74], "helper": [59, 65, 67, 69, 71], "here": [2, 4, 7, 8, 11, 15, 16, 19, 21, 26, 29, 30, 31, 33, 34, 35, 36, 37, 38, 39, 45, 46, 47, 49, 50, 51, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74], "herman": 0, "heurist": 34, "hide": 15, "hierarchi": 16, "high": [8, 15, 46, 67, 68, 69, 70], "highest": [8, 69], "highli": [11, 53, 68, 71], "highlight": 10, "highthroughputexecutor": 18, "hint": [66, 67, 68, 71], "histor": [9, 21, 29], "histori": [2, 10, 15, 21], "hit": [69, 74], "hoc": [11, 60], "hold": [15, 16], "home": [16, 18], "homebrew": 29, "homologi": [69, 74], "honor": 71, "hood": [65, 69, 71], "hook": [14, 59, 66], "hope": [31, 45, 69], "hopefulli": [33, 67], "host": [2, 7, 15, 26, 39, 73], "hour": 31, "hous": [15, 39, 74], "how": [2, 4, 7, 8, 9, 11, 13, 15, 16, 18, 20, 26, 29, 31, 33, 34, 36, 38, 40, 43, 46, 47, 50, 52, 53, 60, 61, 64, 66, 67, 68, 69, 70, 71, 73, 74, 75], "howev": [2, 5, 8, 10, 16, 19, 39, 43, 51, 53, 67, 74], "htex": 18, "html": [7, 9, 37, 66, 69, 74], "http": [0, 7, 15, 21, 26, 33, 39, 46, 47, 61, 64, 68], "huge": [9, 31, 68], "human": [21, 34, 58, 60, 66, 67, 68, 69], "hunt": [0, 2], "hurt": 45, "hyphen": 58, "hypothes": 68, "hypothesi": [2, 68], "i": [2, 4, 5, 7, 8, 9, 11, 12, 13, 14, 16, 18, 19, 20, 21, 24, 26, 27, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 43, 44, 45, 46, 47, 49, 50, 51, 53, 54, 55, 57, 58, 59, 60, 61, 62, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75], "i_tabl": 50, "icon": [15, 21], "id": [2, 50, 51, 58, 60, 61, 64, 65, 67, 69, 71, 74], "id_count": 64, "id_head": 64, "idea": [2, 4, 7, 8, 9, 10, 16, 29, 31, 33, 45, 67, 68, 71, 74], "ideal": [7, 16, 43, 45, 58, 67, 68, 71], "ident": [2, 9, 21, 67, 68, 70], "identfii": 67, "identif": 0, "identifi": [2, 8, 15, 30, 33, 50, 51, 53, 58, 60, 61, 64, 67, 68, 69, 74], "identity_with_metadata_column_get_mdc": 50, "ids_to_keep": 64, "idx": 11, "ignor": [9, 10, 29, 53, 58, 60, 64, 68], "ignore_missing_sampl": 15, "ignore_pcoa_featur": 15, "iim": 26, "illumina": 11, "illustr": [8, 9, 16, 21, 30, 38, 43, 68, 70], "imagin": [16, 32, 50], "immedi": [45, 75], "immutablemetadata": 51, "impact": [10, 15, 31, 34, 60, 68, 69], "imped": 16, "implement": [9, 16, 32, 33, 39, 50, 53, 61, 64, 67, 68, 69, 70, 74, 75], "implementationerror": 24, "impli": [9, 18, 67, 68, 70], "implic": 68, "implicit": 60, "import": [7, 8, 10, 14, 15, 16, 18, 19, 21, 29, 31, 33, 34, 36, 44, 45, 46, 50, 53, 58, 60, 65, 66, 68, 69, 70, 71, 74], "import_data": [35, 50, 61, 65, 69, 71], "import_from_format": 61, "import_modul": 67, "importantli": [8, 15, 68, 71, 74], "importlib": 67, "imposs": [15, 31], "improv": [4, 45], "in_": 65, "inaccur": [15, 26], "inact": 8, "inadvertantli": 15, "inappropri": 31, "incident": 71, "includ": [2, 7, 9, 10, 11, 15, 16, 26, 29, 33, 34, 35, 37, 39, 45, 46, 50, 51, 53, 58, 60, 61, 64, 67, 68, 69, 70, 71, 73, 74, 75], "include_suffix": 64, "inclus": 60, "inclusive_end": [16, 60, 68], "inclusive_start": [60, 68], "incompat": [32, 75], "incomplet": [15, 53, 70], "incomprehens": 15, "inconveni": 10, "incorpor": 27, "incorrect": 31, "increas": [68, 69], "incredibli": 10, "increment": [45, 60], "incur": 68, "indent": 16, "independ": [31, 60, 67], "index": [3, 9, 37, 60, 61, 64, 66, 69, 74], "index_fp": 69, "indic": [5, 8, 15, 18, 31, 32, 34, 38, 43, 46, 47, 50, 59, 60, 64, 66, 67, 68, 69, 70, 74], "indistinct": 16, "individu": [2, 15, 29, 46, 50, 54, 64, 68, 69], "ineffect": 53, "inequ": 16, "inf": 53, "infer": [50, 51, 64, 68, 74], "infin": 60, "influenc": 34, "info": 47, "inforamt": 29, "inform": [2, 8, 9, 10, 11, 12, 14, 15, 16, 18, 21, 26, 29, 31, 33, 34, 36, 43, 45, 46, 48, 51, 58, 66, 67, 68, 69, 73, 74], "informat": 26, "infrastructur": 69, "infrequ": 65, "inher": 67, "inherit": [21, 68], "ini": 9, "init_artifact": [50, 61, 71], "init_artifact_collect": 61, "init_artifact_from_url": 61, "init_format": 61, "init_metadata": 61, "init_metadata_from_url": 61, "initi": [11, 19, 26, 29, 31, 33, 38, 50, 66, 67, 68, 75], "inject": 50, "inner": [15, 64, 74], "inplac": [69, 74], "input": [2, 8, 9, 11, 12, 15, 16, 19, 21, 27, 30, 31, 34, 35, 36, 37, 42, 50, 51, 52, 58, 59, 60, 61, 66, 67, 68, 70, 73], "input_descript": [34, 35, 37, 53, 58, 66, 68, 70], "inputtypea": 60, "inputtypeb": 60, "insdc": 64, "insert": [21, 66, 68], "insid": [10, 16, 18, 21, 34, 50, 67, 69, 74], "insight": 45, "inspect": 16, "inspir": 61, "instal": [2, 7, 10, 29, 33, 42, 43, 44, 45, 46, 50, 52, 65, 67, 71, 74], "instanc": [2, 16, 32, 34, 46, 50, 51, 58, 59, 67, 68, 70], "instanti": [18, 24, 29, 32, 34, 51, 58, 61, 67, 68, 71], "instead": [8, 12, 16, 24, 31, 35, 46, 53, 54, 58, 60, 64, 66, 68, 69, 70], "institut": 26, "instruct": [7, 10, 18, 26, 29, 33, 34, 39, 42, 43, 47, 71, 73, 75], "int": [11, 16, 32, 34, 35, 58, 60, 61, 62, 64, 69], "int_collect": 61, "int_collection6": 61, "int_collection7": 61, "int_dict": 32, "int_list": 32, "int_seq_collect": 61, "integ": [9, 11, 16, 32, 58, 60, 64], "integr": [15, 29, 41, 43, 50, 52, 69, 75], "intellig": 16, "intend": [2, 8, 24, 26, 31, 38, 47, 50, 51, 67, 68, 69, 71, 75], "intent": [2, 8, 31, 60], "intention": [9, 66], "inter": [8, 16, 68], "interact": [2, 8, 9, 16, 24, 32, 46, 51, 53, 68, 70], "interest": [11, 15, 16, 26, 29, 39, 45, 51, 58, 60, 69, 72], "interestingdataformat": 51, "interfac": [2, 4, 7, 8, 10, 11, 15, 21, 25, 26, 27, 29, 34, 38, 46, 47, 50, 51, 53, 58, 60, 61, 67, 68, 75], "intermedi": [15, 19, 27, 67], "intern": [10, 18, 31, 32, 51, 58, 61, 67, 70, 71], "interoper": 43, "interpret": [2, 9, 15, 21, 27, 45, 53, 60, 64, 69, 71], "interrupt": 69, "intersect": 60, "intervent": 7, "intial": 61, "introduc": [4, 21, 31, 38], "introduct": [0, 2, 50, 68, 69, 74], "introspect": 8, "intsequence1": [58, 61], "intsequence2": 58, "intsequenceformat": [11, 61], "intuit": [16, 68], "invalid": [11, 31, 53, 64, 67, 68], "invent": 10, "invers": 60, "invert": 16, "invest": 45, "investig": 15, "invoc": 16, "invok": [8, 12, 50, 55, 59, 61], "involv": [10, 16], "io": [54, 67], "ipython": [68, 71], "iq": 31, "is_semantic_typ": 60, "isn": [7, 11, 16, 29, 45, 59, 61, 67, 68, 69, 71, 74], "iso": 15, "issu": [12, 15, 31, 33, 43, 46, 48, 50, 67, 72], "itcr": 33, "item": [32, 68], "iter": [7, 32, 45, 54, 60, 61, 64, 68, 69], "ith": 26, "its": [2, 7, 8, 10, 11, 15, 16, 19, 21, 29, 30, 31, 32, 34, 37, 40, 46, 50, 51, 55, 58, 61, 64, 66, 67, 68, 69, 70, 71, 73, 74], "itself": [8, 9, 10, 15, 18, 32, 60, 67, 68], "iupac": 67, "j": 0, "jaccard": 35, "jaccard_distance_matrix": 35, "jaccard_emperor": 35, "jaccard_pcoa_result": 35, "januari": [7, 53], "jargon": 67, "jewel": 0, "job": [18, 31, 33, 60, 69], "join": [64, 66, 69, 72, 74], "journal": [45, 68], "journei": [0, 68], "json": [16, 24], "jsonp": 21, "juggl": 12, "jupyt": [2, 26, 71], "just": [8, 14, 15, 16, 18, 26, 29, 31, 32, 43, 45, 47, 50, 51, 53, 60, 65, 66, 67, 68, 69, 71, 73, 74], "k": 58, "keef": 0, "keep": [11, 15, 16, 29, 33, 35, 44, 66, 69], "kei": [8, 15, 21, 32, 34, 46, 50, 53, 54, 58, 60, 61, 68, 71], "kept": 74, "key1": 60, "key2": 60, "keyerror": 74, "keyword": 50, "kind": [2, 8, 11, 16, 31, 51, 67], "kishitanii": 74, "kit": 8, "kitchen": 16, "knife": 16, "knive": 16, "know": [9, 11, 16, 26, 29, 31, 38, 45, 50, 53, 66, 67, 68, 69, 71, 73, 74], "knowledg": [8, 48, 68, 70], "known": [10, 12, 16, 31, 34, 60], "kruskal1952us": 37, "kwarg": 61, "la": [69, 74], "lab": [26, 39, 43, 65, 66, 67, 68, 69, 70, 71, 73, 74], "label": [8, 16, 18, 50], "lack": 16, "lai": 5, "lane_numb": 11, "lang": 66, "languag": [10, 14, 15, 16, 31], "laptop": [69, 71], "larg": [9, 15, 31, 34, 45, 58, 67, 68, 75], "larger": [8, 60, 69], "las_act": 69, "las_result": 69, "last": [14, 16, 38, 53, 66, 67, 69, 73], "latebindingattribut": 14, "later": [8, 10, 67, 68, 73], "latest": [33, 50, 73], "latter": 43, "launch": 7, "layer": 8, "layout": [2, 10], "lead": [29, 31, 41, 53, 67], "learn": [10, 26, 29, 30, 45, 49, 68, 70, 71, 73, 75], "least": [2, 11, 18, 31, 32, 37, 53, 64, 67], "leav": [16, 29, 31, 33, 39, 66], "left": [31, 64, 74], "left_on": 74, "legal": 60, "legendrelegendr": 34, "len": [67, 74], "length": [69, 74], "lengthi": 16, "less": [8, 26, 31, 62, 67], "lesson": [66, 68], "let": [15, 16, 18, 26, 29, 35, 38, 50, 53, 60, 65, 66, 67, 68, 69, 70, 71, 73, 74, 75], "level": [8, 11, 15, 18, 29, 33, 38, 39, 42, 46, 51, 52, 53, 58, 64, 66, 67, 68, 70, 71, 73], "lib": [33, 68], "librari": [18, 33, 34, 43, 46, 50, 67, 68], "licens": 68, "life": 30, "lifetim": 12, "lift": 10, "lightli": 29, "lignment": 68, "like": [2, 7, 8, 9, 10, 11, 15, 16, 18, 19, 21, 26, 29, 31, 32, 33, 34, 35, 37, 38, 39, 41, 42, 43, 44, 46, 47, 48, 50, 51, 53, 58, 60, 61, 62, 65, 66, 67, 68, 69, 70, 71, 73, 74], "limit": [11, 15, 16, 39, 43, 44, 60], "line": [2, 7, 11, 15, 16, 21, 30, 31, 34, 38, 46, 47, 53, 58, 61, 66, 67, 68, 74], "linear": 9, "link": [5, 15, 37, 50, 62, 64, 67, 68, 69, 70], "linkcod": 5, "linux": [18, 38, 47], "lipman": 0, "list": [3, 7, 11, 14, 15, 16, 18, 21, 31, 32, 34, 35, 37, 39, 43, 46, 47, 50, 54, 58, 59, 60, 61, 67, 68, 69, 70, 72, 74], "liter": [18, 50, 58, 61], "littl": [7, 16, 46, 66, 67, 68, 73], "live": [15, 29, 43, 46, 67], "ll": [15, 16, 26, 29, 31, 33, 38, 39, 42, 47, 50, 53, 65, 66, 67, 68, 69, 70, 71, 73, 74, 75], "llm": 15, "load": [8, 11, 18, 21, 29, 31, 34, 46, 50, 51, 53, 54, 58, 59, 64, 66, 67, 68, 71, 73], "local": [0, 7, 38, 47, 50, 59, 68, 70, 73, 74], "local_alignment_search": 69, "local_pairwise_align_nucleotid": [68, 70], "localalignmentsearchresult": [69, 74], "localalignmentsearchresultsformat": 74, "localhost": 7, "localprovid": 18, "locat": [8, 12, 18, 39, 53], "log": [15, 35, 38], "logic": [9, 11, 60, 62], "login": 38, "long": [2, 8, 10, 11, 30, 31, 34, 39, 43, 58, 60, 66, 67, 68, 69], "longer": [58, 66, 67, 68, 69], "longitudin": 51, "look": [8, 9, 11, 16, 18, 21, 29, 31, 32, 33, 35, 37, 39, 41, 42, 46, 50, 51, 59, 60, 65, 66, 67, 68, 69, 70, 71, 73, 74, 75], "lookup": [61, 68], "loop": 69, "loss": 34, "lot": [16, 29, 31, 33, 45, 46, 48, 50, 53, 65, 66, 67, 69, 71, 74], "loudli": 31, "love": [5, 12, 43, 45], "lower": 64, "lsmat": 36, "lsmatformat": 36, "luck": 45, "luckili": 66, "m": [0, 7, 29, 50, 66, 67, 68, 69, 70, 71, 73], "m3": 69, "macbook": 69, "machin": [15, 16, 53, 67], "machineri": [38, 59, 67], "maco": [18, 47], "macosx": 15, "made": [10, 18, 21, 26, 31, 41, 50, 51, 61, 67, 68, 73], "magic": [29, 69], "magnitud": 34, "mai": [2, 4, 7, 8, 10, 15, 16, 18, 19, 21, 26, 29, 31, 32, 33, 34, 42, 43, 50, 51, 53, 55, 58, 60, 61, 64, 67, 68, 69, 70, 71, 73, 75], "mail": 46, "main": [16, 33, 39, 41, 64, 66, 67], "maintain": [10, 29, 33, 39, 43, 48, 50, 70, 74], "mainten": [15, 33], "major": [53, 66, 67], "make": [4, 7, 9, 10, 11, 15, 16, 18, 21, 29, 31, 32, 33, 34, 37, 38, 39, 43, 44, 45, 47, 50, 53, 58, 60, 64, 65, 66, 68, 69, 70, 71, 73, 74, 75], "make_artifact": [35, 55, 70], "makefil": 38, "manag": [2, 9, 12, 15, 18, 19, 29, 47, 53, 55, 59, 61, 62, 67, 68, 69, 70, 73], "mani": [5, 9, 10, 11, 15, 16, 21, 29, 31, 34, 37, 44, 45, 50, 51, 67, 68, 69, 70, 74], "manipul": [8, 9, 10, 60, 61, 64], "manner": [34, 51], "manual": [15, 32, 33, 50, 67], "manuscript": [15, 45], "map": [18, 24, 34, 60, 61, 64, 68, 69, 71], "mapping_1": 61, "mapping_2": 61, "mappingproxytyp": 64, "march": [0, 2, 11], "mari": 0, "markdown": 26, "market": 45, "massiv": 15, "masteri": [0, 68], "match": [16, 21, 44, 46, 47, 55, 58, 60, 61, 64, 66, 68, 69, 74], "match_scor": [67, 68, 69, 70], "materi": [7, 51, 59, 61, 71], "matric": 34, "matrix": [34, 35, 67], "matter": [16, 34, 60], "matthew": 0, "max": [11, 18, 58, 67], "max_thread": 18, "max_work": 18, "maxim": [42, 52, 67], "mayb": [66, 70], "md": [21, 38, 43, 51, 60, 61, 73], "md1": 61, "md2": 61, "md3": 61, "md5": 21, "md5sum": 21, "md_for_column": 61, "me": [16, 29, 53, 66, 67, 68, 70, 71, 73], "mean": [5, 8, 9, 10, 12, 15, 16, 18, 26, 31, 39, 44, 46, 60, 67, 68, 69, 73], "meaning": [50, 53], "meaningless": 53, "meant": [2, 60], "meantim": 67, "mechan": [16, 38, 43, 53, 58], "medic": 68, "meet": [50, 64, 71], "member": [11, 16, 24, 60, 61], "memori": [2, 10, 12, 31, 64, 69], "mention": [38, 66, 67, 68, 70, 71], "menu": 16, "merg": [9, 50, 61, 64, 74], "merge_metadata": 61, "merged_t": 50, "messag": [31, 53, 58, 64, 68, 73, 74], "meta": [29, 47, 66], "metaclass": 14, "metadata": [2, 15, 16, 21, 27, 29, 35, 37, 42, 46, 50, 52, 57, 63, 65, 66, 67, 69, 71, 75], "metadata_column": 74, "metadata_index": 74, "metadatacolumn": [16, 51, 60, 64], "metadatafileerror": 64, "metagenom": [2, 33, 39, 43], "metapackag": [2, 33, 43], "metaprogram": [13, 20], "method": [0, 2, 11, 14, 15, 16, 21, 24, 27, 29, 30, 32, 35, 37, 39, 42, 44, 50, 51, 52, 53, 55, 58, 59, 61, 64, 66, 67, 70, 71, 72, 73, 74, 75], "methodnam": 59, "metric": [15, 30, 34, 35, 46], "mi": 15, "microbiom": [2, 7], "microsecond": 15, "mid": 69, "middl": 18, "might": [10, 11, 16, 31, 32, 39, 46, 47, 50, 51, 59, 61, 67, 68, 69], "migrat": 58, "miller": 0, "min": [11, 58, 67], "mind": [15, 16, 43, 44, 67, 71], "mine": [16, 67, 69, 71], "mini": 48, "miniconda": 47, "miniconda3": [47, 68], "minim": [11, 40, 41, 47, 53, 67], "minimum": 66, "minor": [41, 68], "minut": [14, 31, 65, 66, 67, 68, 69], "mirror": 15, "miscellan": [68, 73], "misdiagnos": 53, "misialq": 26, "misinform": 53, "misinterpret": 31, "mismatch": [16, 66, 68], "mismatch_scor": [67, 68, 69, 70], "miss": [31, 43, 51, 53, 64, 69, 74], "missing_id": 74, "missing_schem": [60, 64], "mission": 16, "mistak": 67, "misus": 10, "mix": [16, 75], "mode": [7, 8, 11, 47, 56, 67], "model": [11, 14, 15, 16, 53, 67], "moder": 48, "modestli": 71, "modif": [41, 67], "modifi": [21, 68, 69], "modul": [2, 5, 16, 29, 57, 58, 60, 66, 67, 68, 70, 71], "modulo": 16, "mol": 0, "molecular": [0, 68], "moment": [5, 7, 18, 49, 68], "mondai": 31, "monitor": [46, 48, 69], "monospac": 66, "month": 48, "more": [2, 4, 8, 9, 10, 11, 12, 15, 16, 18, 19, 21, 26, 27, 29, 31, 33, 34, 35, 38, 39, 40, 42, 43, 45, 46, 48, 49, 50, 51, 53, 58, 60, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75], "morn": 31, "most": [7, 8, 10, 15, 16, 26, 31, 33, 41, 44, 45, 51, 53, 58, 60, 66, 67, 68, 69, 70, 71, 75], "mostli": 67, "motiv": [10, 31], "mouth": [16, 45], "move": [7, 8, 9, 10, 18, 19, 32, 33, 47, 61, 65, 67, 68, 69, 70, 75], "mroe": 29, "msa": [66, 67, 68, 70, 71], "msa_summari": 70, "much": [8, 10, 11, 16, 31, 32, 47, 50, 61, 67, 68], "multi": [7, 69, 70], "multiindex": 74, "multipl": [7, 8, 10, 11, 15, 16, 18, 21, 24, 26, 31, 32, 39, 53, 58, 59, 60, 61, 66, 67, 68, 69, 75], "multiprocess": 12, "must": [2, 8, 11, 15, 16, 18, 21, 30, 32, 34, 35, 37, 41, 46, 50, 58, 59, 60, 61, 62, 64, 67, 68, 69, 70], "mutual": 59, "mv": 2, "my": [29, 31, 45, 50, 53, 58, 65, 66, 67, 68, 69, 70, 71, 73, 74, 75], "my_act": [53, 61], "my_artifact": 61, "my_column": 61, "my_int": 61, "my_metadata": 61, "my_method": 58, "my_pipelin": 58, "my_plugin": 61, "my_visu": 58, "my_viz": 51, "myer": 0, "mynewformat": 53, "mypi": 34, "myself": 71, "myst": 26, "n": [11, 39, 47, 69], "n_char": 67, "n_job": 35, "n_jobs_or_thread": 15, "n_less": 62, "name": [2, 8, 9, 10, 11, 15, 16, 18, 19, 21, 24, 29, 32, 33, 34, 35, 36, 37, 39, 44, 46, 47, 50, 53, 56, 58, 59, 60, 61, 64, 66, 67, 68, 69, 70, 71, 74], "namedtupl": [24, 54], "namespac": [24, 44], "nan": [59, 64], "narrow": [8, 60], "nation": 26, "nativ": 2, "natur": [60, 64, 71, 75], "navig": [38, 60], "nc": 26, "nd": 26, "nearli": 68, "neat": 29, "necessari": [10, 11, 16, 51, 57, 69], "necessarili": [8, 16, 19, 31, 48, 58], "necessit": [33, 75], "need": [4, 7, 8, 9, 10, 11, 16, 18, 24, 26, 29, 31, 32, 33, 35, 38, 39, 43, 45, 46, 47, 50, 51, 53, 58, 60, 61, 62, 65, 66, 67, 68, 69, 70, 71, 72, 74], "needleman": [0, 68, 70], "needleman1970": [68, 71], "needleman1970gener": 68, "neg": [53, 60, 68], "neither": [15, 16], "nest": [2, 8, 15, 16, 29], "network": 33, "never": [8, 16, 33, 36, 42, 53, 67, 68, 70], "new": [2, 4, 7, 9, 10, 11, 12, 15, 16, 18, 19, 21, 26, 31, 32, 33, 34, 38, 39, 40, 43, 44, 45, 46, 47, 52, 53, 55, 60, 62, 64, 66, 69, 70, 71, 72, 74, 75], "newick": [10, 31, 67], "next": [15, 18, 33, 37, 38, 45, 46, 48, 53, 67, 68, 69, 70, 71, 72, 73, 74, 75], "nexu": 67, "nice": [16, 42, 52, 71], "nicer": 66, "nih": 26, "node": [15, 67, 69], "nois": 58, "nomenclatur": 16, "non": [8, 10, 15, 18, 24, 34, 35, 50, 51, 60, 61, 67, 68], "non_definite_chars_count": 67, "none": [8, 11, 18, 24, 34, 35, 37, 50, 51, 54, 55, 56, 58, 59, 60, 61, 62, 64, 66, 67, 68, 74], "nonetheless": 16, "nonsens": 60, "nor": 15, "normal": [12, 15, 16, 35, 60, 64, 67, 68], "notabl": [10, 15], "note": [8, 15, 18, 32, 33, 38, 39, 49, 50, 58, 60, 62, 64, 65, 67, 68, 69], "notebook": [2, 15], "noth": [15, 29, 58, 60, 61, 62, 64], "notic": [11, 18, 31, 34, 48, 67, 69, 70], "notif": [31, 48, 75], "notion": 15, "noun": 2, "novemb": 0, "now": [8, 10, 11, 16, 18, 21, 26, 33, 38, 41, 43, 45, 47, 50, 60, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74], "np": [50, 64], "nucleotid": [66, 68], "null": [9, 15], "num": 60, "num1": 58, "num2": 58, "num_split": 69, "number": [8, 11, 15, 16, 18, 29, 30, 34, 46, 47, 51, 58, 60, 61, 62, 64, 68, 73, 74], "number_of_dimens": 34, "numer": [16, 60, 64], "numeric_md_col": 51, "numericmetadatacolumn": [51, 64], "numpi": 50, "nw": [66, 68, 70], "nw_align": [66, 67, 68, 71], "nw_align_act": 70, "nw_align_example_1": 71, "nwaligntest": 68, "o": [15, 32, 50, 54, 60, 62, 66, 68, 71, 73, 74], "o1": 50, "o2": 50, "ob": 59, "object": [2, 8, 12, 14, 15, 16, 18, 29, 30, 34, 35, 36, 37, 51, 52, 54, 58, 59, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 74], "obs_feat_vector": 50, "obscur": [53, 65, 67], "observ": [8, 11, 16, 35, 43, 53, 65, 66, 67, 68, 69], "observed_featur": 50, "observed_features_exampl": 50, "observed_hit": 69, "observed_index": 69, "observed_otu": 35, "observed_otus_vector": 35, "observed_viz": 69, "obtain": [51, 61, 64, 69], "obviou": 16, "obvious": [16, 45], "occur": [8, 11, 12, 15, 50, 68], "occurr": 33, "octob": [0, 21, 33], "odd": 68, "off": [12, 16, 33, 39, 45, 53, 67, 70], "offend": 44, "offens": 67, "offer": [12, 21, 48, 51], "offici": [33, 39], "often": [10, 15, 16, 29, 31, 36, 39, 53, 66, 68, 69, 71, 75], "ok": [31, 53, 66, 67], "okai": 47, "old": [7, 16, 26], "older": [9, 15, 31, 58, 73], "omiss": 60, "omit": 64, "onc": [8, 10, 11, 16, 18, 33, 34, 45, 50, 60, 65, 67, 69], "one": [2, 8, 9, 10, 11, 15, 16, 18, 21, 27, 29, 31, 32, 33, 34, 35, 36, 37, 38, 39, 41, 43, 44, 46, 49, 50, 51, 53, 58, 60, 64, 66, 67, 68, 69, 70, 71, 73, 74], "oner": 8, "ones": [43, 67, 68], "onion": 8, "onli": [2, 5, 8, 9, 11, 15, 16, 18, 21, 26, 27, 31, 34, 35, 37, 38, 43, 45, 46, 47, 51, 53, 58, 60, 61, 62, 64, 65, 66, 67, 68, 69, 70, 73, 74, 75], "onlin": [33, 45], "opaqu": 67, "open": [4, 7, 10, 11, 15, 36, 47, 51, 53, 58, 66, 67, 68, 69, 71, 74], "oper": [2, 10, 15, 16, 27, 29, 31, 51, 53, 58, 69, 74], "opinion": 11, "opportun": [51, 53, 69, 70], "oppos": [47, 67, 69], "opposit": [60, 69], "opt": [69, 73], "option": [11, 15, 18, 19, 24, 33, 38, 39, 45, 46, 48, 50, 59, 60, 64, 69], "optional1": 58, "optional2": 58, "orang": 60, "orchestr": 2, "order": [10, 11, 15, 16, 18, 32, 33, 50, 58, 60, 61, 64, 68, 69, 74], "ordereddict": 54, "ordinationresult": 34, "org": [0, 7, 15, 21, 26, 33, 39, 47, 61, 64, 68], "organ": [16, 26, 39, 43, 47, 67], "orient": 58, "origin": [2, 9, 10, 21, 32, 34, 35, 37, 59, 64, 69, 74], "osx": 47, "other": [2, 4, 5, 8, 9, 10, 11, 15, 16, 26, 27, 29, 31, 32, 34, 37, 38, 39, 42, 43, 46, 52, 53, 55, 58, 59, 61, 64, 66, 67, 68, 69, 70, 71, 73, 74, 75], "other_plugin": 16, "otherwis": [11, 18, 32, 51, 58, 59, 60, 64, 73, 74], "otu": 35, "our": [4, 7, 10, 15, 16, 18, 26, 31, 39, 43, 45, 50, 53, 65, 66, 67, 70, 71, 72, 73, 74], "ourself": 70, "ourselv": [16, 68], "out": [9, 11, 14, 16, 29, 31, 33, 43, 45, 51, 53, 58, 61, 64, 66, 67, 68, 69, 70, 71, 73, 74], "outcom": [15, 31, 50, 51, 53, 68], "outdat": [15, 26, 31], "outer": 15, "outf": 53, "outlin": [33, 39, 61], "output": [2, 11, 15, 16, 21, 27, 30, 31, 34, 35, 36, 37, 42, 50, 52, 58, 60, 61, 66, 67, 68, 69, 70, 71, 73, 74], "output_descript": [34, 35, 37, 53, 58, 68, 70], "output_dir": [37, 51, 58, 66, 74], "outsid": [29, 41, 60, 68], "outweigh": 69, "over": [7, 8, 9, 11, 15, 16, 21, 31, 35, 45, 46, 54, 61, 67, 68, 69, 70], "overal": [8, 21], "overhead": 69, "overlap": [50, 60, 64], "overlap_method": 50, "overload": 31, "overrid": [18, 59, 61, 64], "overridden": 59, "overriden": 61, "oversel": 45, "oversight": 67, "overview": [13, 20], "overwrit": 62, "own": [2, 4, 7, 11, 15, 16, 18, 30, 33, 42, 43, 48, 50, 53, 55, 65, 68, 71, 72, 73, 74, 75], "owner": [33, 39], "p": [26, 50, 66, 68], "pacakg": 29, "packag": [2, 8, 14, 15, 28, 33, 34, 39, 46, 47, 52, 54, 58, 59, 66, 67, 68, 69, 71, 73], "pad": 66, "page": [5, 7, 12, 29, 38, 45, 46, 53, 61, 66, 68], "pai": [38, 53], "pain": 68, "pair": [2, 10, 30, 35, 51, 54, 60, 68], "pairedendsequenceswithqu": 11, "pairwis": [2, 51, 66, 69, 70], "panda": [31, 37, 51, 60, 61, 64, 69, 70], "paper": [16, 45, 68], "paperpil": 68, "paragraph": 15, "parallel": [7, 8, 17, 20, 29, 42, 52, 70, 75], "parallel_config": [18, 69], "parallelconfig": [18, 69], "paramet": [2, 8, 10, 15, 16, 18, 19, 24, 27, 30, 32, 34, 35, 37, 46, 47, 50, 51, 54, 58, 59, 60, 62, 64, 66, 67, 68, 69, 70, 71, 73, 74], "parameter_descript": [34, 35, 37, 51, 53, 58, 66, 68, 70], "params_only_method": 61, "paranthraci": 74, "pare": 16, "parent": 15, "parenthesi": 8, "pars": [9, 21, 31], "parse_format": 24, "parse_typ": [14, 24], "parsel": 18, "parser": [9, 21], "parsl": [18, 69], "part": [4, 11, 12, 18, 20, 26, 32, 33, 39, 40, 43, 49, 53, 57, 60, 61, 66, 67, 68, 71, 72, 74], "parti": 44, "particular": [2, 8, 9, 10, 18, 39, 51, 60, 61], "particularli": 12, "partit": 51, "pass": [2, 10, 11, 15, 19, 21, 31, 32, 33, 38, 39, 46, 47, 50, 51, 53, 60, 66, 67, 68, 69, 70, 71, 74], "passag": 8, "passthrough": 15, "past": [19, 39, 65, 68], "pastri": 16, "pastrybag": 16, "path": [5, 12, 18, 31, 32, 37, 46, 50, 53, 54, 56, 59, 60, 61, 64, 65, 66, 68, 71, 73, 74], "path_to_config": 18, "pathlib": 59, "pathlik": 54, "pathspec": 56, "pattern": [11, 29, 39, 52, 63, 67], "payload": [2, 9, 10, 11], "pcoa": [15, 34, 35], "pcoa_result": 35, "pcoaresult": [34, 35], "pd": [31, 37, 51, 53, 58, 60, 61, 64, 69, 74], "pdt": 69, "pear": 16, "peek": [61, 68, 71], "peer": 45, "pen": 16, "penalti": 68, "pencil": 16, "pend": [21, 49, 67], "peopl": [16, 29, 45, 70], "per": [10, 11, 15, 18, 31, 60, 66, 69], "percent": [69, 74], "perciev": 67, "perfect": 16, "perform": [2, 8, 9, 10, 11, 15, 16, 31, 33, 38, 40, 51, 53, 54, 61, 64, 65, 66, 67, 68, 69, 70], "permit": [10, 16, 58], "persist": [10, 11, 15], "person": [10, 16, 39, 71], "perspect": 45, "ph": 51, "phone": 53, "photobacterium": 74, "phrase": 31, "phylogenet": [15, 31, 34, 35, 67, 68], "phylogenetic_metr": 30, "phylogeni": [15, 30, 31, 34, 67], "phylum": 74, "pictur": [7, 8, 61], "piec": [2, 9, 10, 16, 70], "pielou": 35, "pielou_": 35, "pip": [7, 33, 38, 39, 43, 50], "pipelin": [2, 17, 18, 20, 21, 24, 27, 30, 42, 52, 57, 58, 63, 74, 75], "pipx": 73, "pivot": 51, "pkg_resourc": 15, "place": [10, 11, 29, 32, 48, 49, 60, 64, 67, 68, 69, 70, 74], "placehold": 49, "plai": [33, 42, 52], "plain": [10, 16], "plan": [15, 21, 31, 33, 48, 50, 53, 67, 72, 73], "platform": [15, 48], "pleas": [15, 26, 43, 45, 48, 50, 53, 67, 68], "plo": 0, "plot": [15, 35, 37], "plu": 11, "plugin": [2, 4, 5, 7, 8, 10, 11, 14, 15, 16, 19, 21, 26, 27, 28, 31, 32, 34, 35, 36, 37, 41, 42, 48, 50, 51, 54, 55, 56, 59, 60, 61, 63, 64, 65, 67, 69, 70, 71, 72, 74], "plugin_act": 19, "plugin_id": [50, 61, 71], "plugin_setup": [36, 46, 50, 66, 67, 69, 70, 71], "pluginmanag": [2, 7, 29, 61], "pluginmethod": 58, "pluginpipelin": 58, "pluginvisu": 58, "png": [15, 37], "point": [8, 9, 15, 19, 29, 37, 38, 43, 58, 60, 64, 65, 67, 68, 69, 70, 74], "poke": [29, 73], "poll": 19, "pool": 19, "popular": [45, 71], "port": [15, 26], "posit": [2, 60, 66, 67, 68], "possess": [16, 60, 61], "possibl": [9, 10, 15, 16, 19, 21, 31, 39, 50, 53, 59, 60, 62, 65, 66, 67, 68, 69, 70, 71], "possibli": [9, 15], "post": 68, "potenti": 31, "pound": 64, "power": [16, 29, 50, 67, 68, 69, 71], "pr": 33, "practic": [16, 53, 61, 66, 67, 73], "pragmat": [0, 68, 70], "pre": [29, 66], "predecessor": 21, "predefin": [2, 74], "predetermin": 16, "predic": 16, "predict": 33, "prefer": [15, 16, 29, 31, 33, 46, 50, 61, 67], "prefix": [50, 59], "prepar": [45, 61, 70, 74], "presenc": [11, 59], "present": [4, 7, 9, 11, 15, 21, 32, 34, 37, 39, 50, 59, 64, 66, 67, 68, 69, 71, 74], "preserv": [61, 64], "presum": [45, 67], "pretend": 50, "pretti": [29, 38, 69], "prevent": [10, 11, 15, 44, 67, 70], "preview": 7, "previou": [11, 15, 39, 46, 65, 66, 67, 68], "previous": [9, 21, 26, 33, 43, 67, 70], "previous_v": 11, "primari": [2, 15], "primarili": [2, 15, 26, 41], "primit": [2, 10, 13, 20, 24, 32, 34, 50, 58, 61, 68, 70], "princip": 34, "principl": [2, 10, 70, 74], "print": [16, 18, 50, 61, 71], "prior": [10, 15, 19, 21, 32, 35, 39, 51], "prioriti": [18, 45, 53], "privat": [29, 60, 67, 68], "privileg": 8, "pro": 69, "probabl": [16, 31, 45, 50, 53, 67, 69], "problem": [9, 10, 31, 33, 53, 67], "problemat": [15, 53, 69], "proce": [39, 69, 74], "proceed": 41, "process": [2, 7, 8, 12, 16, 18, 33, 38, 41, 45, 46, 50, 53, 62, 67, 68, 69, 73], "processor": 69, "procida": [0, 75], "produc": [2, 12, 15, 16, 21, 24, 27, 30, 34, 35, 37, 50, 53, 58, 60, 68, 69, 70, 71], "profession": 0, "program": 31, "programat": 15, "programm": [0, 31, 68, 70], "programmat": 16, "progress": [45, 75], "project": [5, 10, 26, 29, 34, 45, 46, 47, 53], "project_nam": 58, "prolifer": 74, "promis": 53, "promot": [4, 45], "prompt": [68, 73], "prone": 67, "proof": 10, "propag": 29, "properli": 50, "properti": [14, 51, 60, 64, 66, 67], "proport": [16, 60], "prospect": [15, 38], "protein": [0, 2, 67, 68], "protocol": 14, "prototyp": [53, 68], "proud": 45, "proven": [0, 2, 7, 8, 13, 20, 21, 35, 53, 64, 66, 69, 73, 75], "provid": [2, 4, 5, 8, 9, 10, 11, 12, 15, 16, 18, 19, 24, 26, 27, 29, 30, 31, 32, 33, 34, 35, 36, 37, 39, 40, 42, 43, 46, 47, 49, 51, 52, 54, 60, 61, 62, 64, 65, 66, 67, 68, 69, 70, 71, 73, 74, 75], "proxi": [50, 69], "pseudomonadota": 74, "psutil": 18, "public": [4, 9, 11, 24, 42, 43, 50, 52, 53, 57, 67], "publish": [31, 45, 68, 75], "pull": [7, 9, 21, 29, 33], "pull_request": 33, "punctuat": 46, "purpos": [8, 10, 16, 18, 19, 26, 51, 58, 61, 66, 68, 71, 73], "push": [12, 33, 38], "put": [29, 33, 39, 67, 68, 69, 70, 74], "py": [5, 16, 21, 46, 50, 65, 66, 67, 69, 71], "pypi": 46, "pytest": [47, 50], "python": [2, 7, 8, 12, 14, 15, 16, 29, 34, 36, 41, 46, 47, 50, 53, 54, 58, 64, 67, 69, 70, 75], "python3": 68, "q": [26, 69], "q1": 69, "q2": [15, 21, 27, 30, 31, 36, 39, 44, 46, 47, 49, 50, 51, 58, 65, 66, 67, 68, 69, 70, 71, 73, 74], "q2_divers": [30, 34, 35, 37, 46], "q2_dwq2": [66, 67, 68, 69, 70, 71], "q2_feature_t": 50, "q2_type": [21, 34, 68], "q2cli": [2, 15, 47, 50, 67, 71, 75], "q2dev": 47, "q2galaxi": 71, "q2view": 15, "qiim": [0, 2, 4, 5, 7, 9, 11, 12, 13, 15, 16, 17, 20, 21, 24, 28, 30, 31, 32, 33, 34, 35, 37, 38, 40, 41, 42, 44, 48, 50, 51, 52, 53, 54, 57, 58, 59, 60, 61, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74], "qiime2": [2, 5, 7, 9, 11, 12, 14, 15, 16, 18, 19, 21, 24, 26, 29, 33, 34, 37, 39, 46, 47, 49, 50, 51, 53, 54, 56, 57, 58, 59, 60, 61, 62, 64, 65, 66, 67, 68, 69, 70, 71, 73, 74], "qiime2_config": 18, "qual": 31, "qualiti": [31, 68], "quantit": 45, "queri": [51, 64, 69, 74], "query_seq": 69, "query_sequ": 69, "query_sequences_art": 69, "query_split": 69, "question": [8, 9, 11, 38, 43, 46, 48, 50, 51, 67, 73], "quick": [2, 11, 66, 67], "quickli": [11, 31, 45, 67, 71], "quiet": [31, 68, 73], "quietli": 31, "quit": 46, "quot": 75, "qza": [10, 15, 31, 32, 50, 67, 68, 71], "qzv": [7, 10, 15], "r": [0, 7, 11, 16, 34, 53, 61, 66, 67, 69, 70], "r1": 69, "r2": 69, "r3": 69, "race": 45, "raii": 12, "rais": [11, 16, 24, 41, 58, 59, 61, 64, 67, 74], "ram": [31, 69], "ran": [15, 66, 69, 71], "random": 9, "randomli": 2, "rang": [34, 35, 60, 67, 68, 69], "rank": 58, "rare": 60, "rarefi": [27, 35, 67], "rarefied_t": 35, "rather": [7, 15, 16, 18, 31, 33, 44, 45, 53, 66, 67, 68, 71], "raw": [39, 47, 67], "re": [2, 4, 5, 7, 10, 15, 16, 18, 26, 29, 33, 34, 38, 39, 42, 44, 45, 47, 50, 53, 65, 66, 67, 68, 69, 70, 71, 73, 74, 75], "reach": [32, 43, 45, 48, 50, 53, 67], "read": [2, 8, 9, 11, 16, 18, 26, 29, 32, 33, 36, 53, 64, 65, 66, 67, 68, 69, 71, 72, 75], "read_csv": 58, "read_numb": 11, "readabl": [34, 66, 69], "reader": [8, 26, 38, 68], "readi": [7, 8, 34, 38, 45, 65, 67, 68, 69, 71, 73, 74], "readiab": 0, "readm": [38, 43, 73], "real": [15, 16, 26, 50, 52, 61, 69, 73, 74, 75], "realiti": 53, "realiz": [31, 60], "realli": [7, 12, 14, 71, 74], "reason": [10, 15, 31, 41, 53, 67, 70, 73, 74], "reassign": 68, "recal": [65, 67, 74], "receiv": [8, 16, 35, 53, 58, 60, 67, 69, 74, 75], "recent": [7, 10, 16, 31, 33, 38, 67], "reciev": 67, "recip": [29, 47], "recogn": [16, 29, 60, 68], "recommend": [7, 11, 16, 33, 38, 45, 47, 51, 58, 67, 68, 69, 71, 73], "reconsid": 68, "record": [8, 10, 11, 15, 21, 67, 68, 73, 75], "record_map": 11, "recreat": 15, "recur": 53, "recycl": [7, 19, 69], "recycle_": 19, "redesign": 4, "redirect": 62, "redirected_stdio": 62, "reduc": [15, 34, 43, 53, 67, 69], "redund": 15, "ref": [15, 21, 74], "refactor": [65, 69], "refer": [2, 4, 7, 9, 15, 20, 23, 26, 29, 31, 32, 33, 34, 39, 40, 43, 45, 46, 49, 50, 51, 52, 65, 66, 67, 68, 69, 70, 71, 73, 74], "referenc": [18, 29, 32, 39, 68], "reference_metadata": 74, "reference_seq": [69, 74], "reference_sequ": 69, "reference_sequences_art": 69, "referenti": 9, "reflect": [15, 31, 39], "reformat": 9, "refresh": [50, 66, 67, 68, 70, 74], "refus": 16, "regard": [31, 34, 45], "regardless": [15, 31, 39, 45, 64], "regex": 61, "regist": [2, 8, 10, 11, 15, 16, 21, 27, 29, 30, 31, 42, 44, 51, 52, 53, 55, 58, 59, 65, 74], "register_artifact_class": [58, 67], "register_format": [58, 67], "register_funct": [30, 32, 34, 35, 37, 50, 51, 53, 58, 66, 67, 68, 69, 70, 71], "register_semantic_typ": [16, 58, 67], "register_semantic_type_to_format": 58, "register_transform": [36, 51, 58, 65, 67], "register_valid": 58, "register_view": 58, "registr": [11, 15, 30, 32, 46, 49, 50, 51, 52, 57, 60, 63, 68, 69, 70, 71, 74], "regroup": 51, "regular": [60, 61], "regularli": 33, "reimplement": 50, "reindex": 74, "reinstal": 50, "rel": [15, 29, 33, 53, 54, 61, 64, 67, 68, 69, 74], "relat": [2, 8, 9, 10, 15, 16, 18, 29, 38, 48, 67, 68, 75], "relationship": [16, 31], "releas": [7, 21, 32, 33, 39, 43, 47, 50, 73], "relev": [4, 8, 15, 21, 26, 29, 31, 33, 39, 43, 46, 47, 51, 67, 68, 71, 74], "reli": [33, 39], "reliabl": 15, "relianc": 15, "remain": [15, 16, 21, 26, 33, 38, 69], "rememb": [15, 16, 68, 74], "remind": [39, 71], "remot": [33, 53], "remov": [4, 11, 18, 19, 51, 64, 67, 68, 74], "renam": [2, 29], "render": [7, 50, 51, 61, 71], "reorgan": [29, 67], "repair": 15, "repeat": [2, 9, 16], "repercuss": 53, "repetit": 49, "replac": [43, 45, 58, 62, 66, 68, 71], "replai": [0, 2, 7, 15, 53, 75], "replay": 53, "repo": [33, 38], "report": [68, 69], "repositori": [7, 26, 29, 33, 38, 39, 47, 50, 68], "repr": 66, "repres": [2, 9, 10, 11, 15, 16, 21, 24, 31, 51, 58, 60, 61, 64, 67, 68, 69, 74], "represent": [2, 9, 11, 15, 16, 21, 31, 37, 51, 60, 66, 70], "reproduc": [0, 10, 15, 53], "reproduct": 15, "request": [7, 8, 10, 21, 29, 31, 33, 43, 45, 48, 51, 59, 62, 64, 67, 68, 69, 73], "requir": [7, 8, 11, 15, 16, 18, 29, 30, 32, 33, 35, 37, 38, 41, 46, 47, 49, 50, 53, 55, 60, 64, 66, 67, 68, 69, 70, 71, 73], "rerun": 19, "research": [15, 26], "reserv": 16, "reset": 59, "reset_index": 74, "resolut": 60, "resolv": [5, 41, 43], "resourc": [7, 12, 18, 29, 48, 60, 69, 70], "respect": [5, 15, 19, 21, 29, 31, 60, 64, 68, 70], "respons": [2, 8, 9, 12, 43, 45, 48, 53, 73], "rest": [9, 18], "restart": 69, "restrict": [8, 29, 45, 47, 51, 64, 74], "result": [2, 7, 8, 9, 15, 18, 19, 21, 24, 26, 31, 32, 34, 35, 37, 41, 45, 50, 51, 53, 58, 59, 60, 64, 65, 66, 67, 68, 69, 70, 71, 73, 74], "result1": 41, "result2": 41, "result_as_str": 59, "resultcollect": [24, 61], "resulttypea": 60, "resulttypeb": 60, "resumpt": [17, 20], "retain": [59, 64], "retract": [53, 68], "retriev": [61, 64, 70], "retrospect": [2, 10, 13, 20], "return": [2, 8, 11, 16, 21, 24, 31, 34, 35, 36, 37, 38, 41, 50, 51, 53, 54, 55, 58, 59, 60, 61, 62, 64, 65, 66, 67, 68, 69, 70, 71], "reus": [10, 19, 24, 43, 69, 74], "revers": [11, 69], "review": [10, 15, 16, 43, 45, 65, 66, 67, 68, 69, 74], "revis": [29, 68], "rewrit": 14, "rfc": 2, "rich": [8, 10, 16, 71], "right": [8, 16, 43, 50, 53, 64, 67, 68, 75], "right_on": 74, "rightli": 70, "risk": 53, "rm": 68, "rna": [2, 67, 68], "robust": [12, 16], "role": 65, "root": [2, 9, 15, 21, 30, 31, 34, 50, 67], "root_uuid": 21, "rough": 8, "roughli": [10, 29, 69], "round": [8, 65, 69], "roundtripp": 64, "row": [60, 64], "rrna": 67, "rstrip": 11, "rule": [10, 15, 16, 32, 60], "run": [2, 7, 11, 15, 18, 19, 21, 29, 31, 33, 38, 41, 43, 45, 47, 48, 50, 53, 59, 65, 66, 67, 68, 70, 71, 74, 75], "runner": 59, "runtest": 59, "runtim": [9, 14, 15, 67, 69], "s1": [50, 60, 68], "s2": [50, 68], "s3": 50, "s42": 61, "s_": 11, "s_l": 11, "sai": [16, 31, 70], "said": [45, 68], "sake": [47, 69], "same": [8, 10, 15, 16, 18, 21, 24, 31, 32, 33, 35, 37, 39, 44, 45, 46, 50, 53, 60, 64, 65, 66, 67, 69, 70, 71, 73, 74], "sampl": [2, 10, 11, 15, 21, 27, 31, 35, 37, 46, 60, 61, 64, 74], "sample_id": [11, 50], "sampledata": [11, 31, 35, 37, 50], "sampling_depth": [15, 35], "sapienn": 49, "satisfi": 16, "saul": 68, "save": [8, 9, 10, 11, 15, 19, 21, 51, 53, 54, 58, 64, 66, 68, 69, 71], "scale": [18, 66], "scene": 65, "schedul": 33, "schema": 9, "scheme": [9, 15, 19, 64], "scholar": 68, "scienc": [2, 26], "scientif": 53, "scientist": [10, 29, 33], "scikit": [66, 67, 68], "scipi": 34, "scope": [15, 24, 29, 50, 71], "score": [61, 68, 69, 74], "scratch": [26, 38], "script": 15, "sdk": [2, 7, 8, 12, 14, 18, 24, 50, 61, 68, 69, 70], "search": [0, 43, 48, 60, 64, 67, 68], "search_and_summarize_pipelin": 69, "searchabl": 51, "searchandsummarizetest": 69, "second": [15, 16, 18, 35, 39, 52, 58, 60, 66, 67, 69, 71, 75], "section": [10, 15, 16, 18, 21, 26, 53, 57, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74], "see": [2, 8, 9, 10, 11, 15, 16, 21, 26, 29, 30, 31, 34, 35, 37, 38, 43, 45, 46, 47, 48, 49, 50, 58, 60, 62, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74], "seek": [10, 12], "seem": [8, 16, 31, 45, 48, 68], "seen": [8, 9, 11, 61, 73], "select": [7, 15, 16, 38, 53], "self": [9, 10, 11, 15, 16, 53, 65, 66, 67, 68, 69, 71], "sell": 45, "semant": [2, 8, 10, 11, 13, 20, 21, 24, 28, 34, 36, 44, 49, 52, 58, 59, 61, 75], "semantic_express": 58, "semantic_typ": [58, 59, 61], "semantictyp": [16, 32, 60, 67], "semat": [11, 67], "send": [29, 69], "sens": [10, 16, 29, 31, 43, 66, 69, 70], "sentenc": 65, "separ": [15, 34, 46, 74], "seper": 16, "sept": 39, "septemb": 0, "seq": [65, 67, 68, 69, 71], "seq1": [65, 67, 68, 70, 71, 74], "seq1_factori": [65, 71], "seq2": [65, 67, 68, 70, 71, 74], "seq2_factori": [65, 71], "seq3": 74, "seq_num": 67, "sequenc": [0, 2, 8, 10, 11, 31, 65, 66, 67, 70, 71, 74], "sequence1": 68, "sequence2": 68, "sequences_path_mak": 11, "sequenceswithqu": 31, "seri": [26, 37, 38, 60, 64, 71], "serial": [9, 64, 67], "seriou": 68, "serv": [9, 12, 26, 50], "server": [7, 45, 53, 66], "session": 68, "set": [7, 8, 9, 11, 16, 18, 21, 29, 32, 33, 34, 42, 43, 45, 51, 52, 58, 59, 60, 61, 64, 66, 67, 68, 69, 70, 71, 73, 74], "set_index": [69, 74], "set_path_mak": 11, "setup": [18, 46, 59, 69], "setupi": 29, "setuptool": [29, 46], "sever": [2, 18, 37, 44, 46, 59, 60, 69, 74], "sha1": 19, "shannon": 35, "shannon_vector": 35, "shape": 68, "share": [4, 10, 15, 21, 24, 39, 43, 45, 64, 69, 70, 73, 75], "sharp": 16, "sharp_fillet": 16, "sharpen": 16, "shell": 71, "short": [36, 58, 66, 70], "short_descript": [46, 58], "shortcut": 70, "shorthand": 60, "shortli": [68, 75], "shotgun": 2, "should": [8, 10, 11, 12, 15, 16, 18, 19, 24, 26, 29, 31, 33, 34, 35, 37, 38, 39, 43, 45, 46, 47, 48, 50, 51, 53, 58, 60, 61, 64, 66, 67, 68, 70, 71, 73, 74, 75], "shouldn": [11, 29, 31, 67, 68, 74], "show": [14, 16, 21, 45, 50, 68, 73, 74, 75], "shown": [8, 15, 18, 21, 32, 46], "shred": 16, "shutil": 62, "side": [50, 59, 69], "signatur": [14, 24, 34, 37, 61, 67, 68, 69, 70, 74], "signific": [14, 21], "silenc": [68, 73], "silicon": [26, 47], "silli": [16, 67, 73], "silvers1997effect": 58, "similar": [0, 16, 24, 27, 33, 35, 37, 39, 60, 66, 68, 69, 70, 71, 74], "similarli": [26, 31, 67, 68], "simpl": [9, 15, 16, 32, 46, 50, 54, 60, 66, 67, 68, 69, 70, 73, 74], "simpler": [15, 16], "simplest": [11, 69], "simpli": [9, 15, 16, 18, 32, 51, 53, 68, 69], "simplifi": [9, 15, 45, 46, 49, 59, 65, 67, 70], "simultan": [16, 18, 60], "sinc": [16, 29, 31, 37, 44, 48, 53, 58, 65, 66, 67, 68, 69, 74, 75], "singl": [2, 7, 9, 10, 15, 16, 21, 27, 29, 31, 32, 35, 37, 39, 44, 46, 50, 51, 58, 59, 64, 66, 67, 68, 69, 70, 71, 74], "singlednasequ": [31, 65, 67, 70, 71], "singlednasequencetest": 67, "singlednasequencetransformertest": 67, "singlefiledirectoryformat": [11, 56, 58, 67], "singleint": [32, 61], "singlelanepersamplepairedendfastqdirfmt": 21, "singlerecorddnafastadirectoryformat": [65, 67], "singlerecorddnafastaformat": [67, 71], "singlerecorddnafastaformattest": 67, "singleton": [2, 58], "singular": 32, "site": [15, 51, 68, 73], "situat": [9, 11, 16, 19, 58, 61], "size": [15, 68], "skbio": [30, 34, 36, 66, 67, 68, 69, 70, 71], "skd": 14, "skip": [11, 50, 67], "sklearn_n_jobs_descript": 35, "slate": [18, 19, 26], "sleev": 16, "sloan": 26, "slow": [16, 31, 34, 67, 68, 69, 70], "small": [9, 11, 58, 60, 65, 68, 69, 71], "smaller": [16, 60, 69], "smith": [0, 68, 69, 70], "smoke": 50, "sneak": 67, "snif": 11, "so": [7, 10, 11, 15, 16, 21, 27, 29, 31, 32, 33, 34, 36, 37, 38, 44, 45, 46, 50, 51, 53, 58, 59, 60, 61, 65, 66, 67, 68, 69, 70, 71, 73, 74, 75], "softwar": [2, 8, 9, 10, 11, 15, 29, 31, 33, 34, 43, 45, 53, 62, 68, 70, 75], "software_entri": 21, "sole": 64, "solid": 8, "solut": [10, 70], "solv": [10, 31], "some": [2, 4, 8, 9, 10, 11, 14, 15, 16, 18, 19, 21, 26, 27, 29, 31, 34, 35, 37, 38, 39, 43, 44, 45, 46, 49, 50, 51, 53, 58, 61, 65, 66, 67, 68, 69, 70, 71, 73, 74, 75], "some_act": [18, 41], "some_artifact": 61, "some_plugin": 21, "somedai": 16, "someexcept": 41, "someon": [29, 45, 68, 70], "someth": [16, 18, 31, 39, 41, 45, 47, 51, 53, 58, 66, 67, 68, 69, 71, 73, 75], "sometim": [10, 33, 53, 68], "somewher": 53, "soon": 48, "sooner": 33, "sophist": 16, "sorri": 31, "sort": [8, 31, 66, 69, 74], "sort_kei": 16, "sortabl": 51, "soup": 16, "sourc": [2, 7, 15, 21, 24, 30, 34, 35, 37, 44, 47, 53, 54, 55, 56, 58, 59, 60, 61, 62, 64, 68, 75], "source_format": 59, "space": 46, "span": 39, "spars": 7, "spatula": 16, "speak": [53, 57], "spec": 64, "speci": 74, "special": [11, 15, 16, 29, 60, 68, 69], "specif": [2, 5, 7, 8, 10, 15, 16, 18, 19, 21, 26, 29, 33, 34, 38, 39, 42, 46, 47, 50, 51, 58, 64, 67, 68, 69, 71, 73, 74, 75], "specifi": [2, 15, 18, 19, 29, 32, 33, 34, 39, 51, 59, 64, 66, 67, 68, 69], "spend": [45, 66], "split": [26, 31, 41, 50], "split_act": 69, "split_int": 61, "split_siz": 69, "spoon": 16, "spork": 16, "sqlite": 64, "squar": 15, "src": 62, "stabl": 73, "stackoverflow": 46, "stage": [29, 47, 67, 68, 69], "stai": 33, "standalon": 46, "standard": [9, 10, 29, 68], "start": [8, 15, 16, 29, 31, 33, 37, 38, 39, 43, 45, 46, 47, 60, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75], "stat": 66, "state": [7, 8, 10, 12, 70], "statement": [19, 29, 50, 67, 68], "static": [9, 12], "statist": [37, 46], "stderr": [62, 68, 73], "stdin": 16, "stdio": 62, "stdout": [62, 68, 73], "steak": 16, "stem": 68, "step": [7, 8, 10, 15, 18, 26, 29, 38, 39, 41, 42, 46, 52, 59, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74], "still": [2, 5, 10, 16, 19, 26, 31, 32, 39, 48, 65, 66, 68, 69, 72, 73], "stitch": 35, "storag": [8, 67], "store": [9, 11, 13, 19, 20, 21, 29, 31, 33, 58, 59, 60, 61, 64, 66, 67, 68, 69, 70], "stori": 16, "str": [16, 24, 30, 35, 36, 37, 51, 53, 54, 58, 59, 60, 61, 64, 65, 66, 67, 70, 71, 74], "straight": [16, 38, 68, 70, 71], "straightforward": [39, 46], "strategi": [18, 44, 69], "strict": [16, 60], "strictli": [8, 60], "string": [9, 10, 16, 21, 24, 34, 46, 51, 53, 54, 58, 59, 60, 61, 64, 66, 67, 68, 71], "strip": 32, "structur": [2, 9, 10, 12, 15, 16, 21, 28, 31, 33, 34, 39, 52, 60, 71, 73], "struggl": 67, "stuck": [66, 67, 70], "studi": [11, 15, 51, 64], "stuff": [15, 29], "style": 66, "sub": [2, 8, 35, 48, 67], "subclass": [2, 21, 50, 54, 58, 59, 64, 67, 71], "subcommand": 44, "subdir": 47, "subdirectori": [9, 10, 15, 67], "subject": 51, "submit": [7, 29, 45, 60], "submodul": [24, 29, 68], "suboptim": 67, "subsequ": [0, 15, 27, 34, 51, 60, 68, 69, 70], "subset": [11, 60, 69], "substanti": 75, "substitut": 16, "substr": 66, "subsystem": 47, "subtyp": [2, 60], "succe": 19, "succeed": 67, "success": [8, 33, 38, 67, 68, 73], "successfulli": [31, 50, 71, 73], "suffer": 34, "suffic": [16, 66], "suffici": [60, 75], "suggest": [5, 16, 33, 39, 45, 58, 69, 73], "suit": [16, 49, 69, 71], "suitabl": 47, "sum": [50, 67], "summar": [66, 70, 71], "summari": [2, 37, 66, 67, 69, 70], "summarize_align": [66, 70], "summarize_alignment_act": 70, "summarizealignmenttest": 66, "sun": 33, "super": [58, 69], "supersed": 21, "supertyp": 16, "suppli": [18, 58, 64], "support": [2, 4, 7, 9, 10, 11, 15, 18, 21, 26, 33, 38, 41, 42, 43, 45, 46, 47, 50, 51, 52, 53, 58, 60, 62, 64, 67, 68, 70, 71, 75], "suppos": [16, 66, 68], "sure": [18, 31, 33, 38, 43, 47, 50, 65, 67, 73], "surround": 8, "sw": 68, "swap": [14, 16], "sweet": 66, "switch": [7, 18], "sy": [12, 15, 62], "symbol": [33, 39], "symmetr": 67, "sync": [33, 74], "synchron": 12, "synonym": [10, 16, 31], "syntax": [16, 24, 32, 34, 60, 68], "system": [2, 10, 15, 16, 18, 19, 21, 29, 31, 32, 34, 46, 47, 53, 60, 70], "t": [0, 2, 4, 7, 9, 10, 11, 15, 16, 19, 21, 29, 31, 33, 34, 36, 38, 39, 41, 43, 45, 47, 48, 49, 50, 53, 59, 60, 61, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74], "t_in": 60, "t_out": 60, "t_parama": 60, "t_paramb": 60, "taacacccac": [66, 68], "tab": [15, 33, 66, 73, 74], "tabl": [15, 27, 29, 30, 31, 34, 35, 37, 39, 50, 51, 53, 59, 60, 62, 64, 67, 68, 69, 73, 74], "tabul": [51, 69, 74], "tabular": [60, 64, 69], "tabularmsa": [66, 67, 68, 70], "tabulate_las_result": 69, "tabulate_las_results_act": 74, "tag": [15, 21, 46], "take": [18, 21, 30, 31, 33, 34, 35, 37, 43, 44, 45, 48, 58, 61, 64, 65, 66, 67, 68, 70, 71, 74], "taken": 61, "talk": [16, 29], "tar": 9, "target": [26, 33, 38, 39, 42, 43, 45, 59, 71, 73, 75], "task": [8, 16, 42, 66, 75], "taxa": 44, "taxonom": [69, 74], "taxonomi": [53, 68, 74], "team": [15, 26, 47], "tear": 16, "teardown": 59, "tech": 48, "technic": [4, 15, 42, 45, 46, 52, 66, 68, 70], "technologi": 26, "tediou": 67, "tell": [15, 18, 45, 46, 67, 68], "temp_dir": [11, 66], "tempfil": 71, "templat": [7, 26, 29, 43, 52, 61, 66, 72, 75], "temporari": [29, 59, 68], "temptat": 75, "ten": 15, "tend": [45, 58, 65, 69, 71], "term": [2, 10, 15, 27, 31, 33, 39, 64, 67, 68, 71], "termin": [15, 27, 37, 47, 60, 74], "test": [16, 26, 38, 42, 45, 46, 47, 48, 52, 53, 57, 60, 61, 63, 72, 75], "test_alt_gap_extend_penalti": 68, "test_alt_gap_open_penalti": 68, "test_alt_match_scor": 68, "test_alt_mismatch_scor": 68, "test_dir_prefix": 59, "test_dna_to_single_record_fasta_simple1": 65, "test_dna_to_single_record_fasta_simple2": 65, "test_exampl": 71, "test_invalid_default_valid": 67, "test_invalid_max_valid": 67, "test_invalid_min_valid": 67, "test_method": [67, 68, 69], "test_pipelin": 69, "test_semantic_type_registr": 67, "test_simple1": [66, 67, 68, 69], "test_simple1_parallel": 69, "test_simple1_seri": 69, "test_simple2": [67, 68], "test_single_record_fasta_to_dna_simple1": 67, "test_single_record_fasta_to_dna_simple2": 67, "test_transform": [65, 67], "test_types_and_format": 67, "test_visu": 66, "testcas": 59, "testpluginbas": [49, 50, 59, 66, 67, 68, 69, 71], "text": [8, 9, 10, 15, 29, 33, 35, 37, 46, 53, 60, 61, 64, 65, 66, 68, 70, 71, 73, 74], "textfileformat": [2, 11, 53, 56, 58, 67], "textual": 37, "than": [7, 8, 11, 15, 16, 31, 32, 33, 47, 50, 51, 53, 60, 62, 64, 65, 66, 67, 68, 69, 70, 71, 73], "thank": [26, 72], "thei": [2, 8, 10, 11, 15, 16, 18, 21, 29, 30, 31, 32, 36, 38, 39, 43, 45, 48, 51, 53, 58, 60, 61, 62, 65, 66, 67, 68, 69, 70, 71], "them": [7, 8, 10, 12, 15, 16, 18, 21, 26, 29, 32, 33, 34, 38, 39, 41, 43, 50, 53, 54, 65, 66, 67, 68, 69, 70, 71, 74, 75], "theme": 2, "themselv": [8, 15, 50, 68, 69], "theoret": 15, "theori": 69, "therefor": [2, 9, 15, 29, 39, 64, 67, 68, 69, 71], "therein": 33, "thereof": 61, "thermophili": 67, "thi": [2, 4, 5, 7, 8, 9, 10, 11, 12, 14, 15, 16, 18, 19, 20, 21, 24, 27, 29, 30, 31, 32, 33, 34, 35, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 53, 54, 55, 57, 58, 59, 60, 61, 62, 64, 65, 66, 67, 69, 70, 71, 72, 73, 74, 75], "thing": [7, 11, 15, 16, 29, 31, 33, 45, 50, 53, 58, 61, 66, 67, 68, 69, 70, 71, 74], "think": [12, 16, 31, 51, 65, 67, 68], "third": [31, 69], "thoma": [0, 2], "thorough": 26, "those": [11, 15, 26, 30, 37, 38, 39, 42, 43, 50, 51, 53, 60, 64, 65, 67, 68, 69, 70, 71, 73, 74], "though": [8, 10, 16, 21, 26, 31, 34, 41, 45, 47, 66, 67, 71, 73], "thought": 60, "thread": [18, 41, 60, 70], "threadpoolexecutor": 18, "three": [8, 11, 15, 27, 31, 50, 61, 67, 68], "three_tabl": 50, "through": [2, 11, 15, 26, 29, 31, 32, 33, 37, 38, 39, 43, 46, 47, 48, 50, 53, 66, 67, 68, 69, 70, 71, 73, 74, 75], "throughout": [26, 68], "throw": 74, "thu": [27, 37, 64], "ti": 48, "tie": 12, "time": [7, 8, 9, 10, 15, 18, 21, 29, 30, 31, 32, 33, 39, 43, 44, 45, 47, 51, 53, 58, 61, 65, 66, 67, 68, 70, 71, 75], "timestamp": 15, "tini": [43, 69], "tip": [38, 69], "titl": [15, 58, 66, 68, 74], "tl": 2, "to_ast": [16, 24], "to_datafram": [51, 64, 74], "to_html": 74, "to_import": 61, "to_list": 74, "to_seri": 64, "to_typ": [59, 61, 62, 68], "togeth": [2, 9, 11, 16, 21, 33, 35, 67, 69, 70], "toggl": 70, "toi": [33, 69], "told": 31, "toler": 44, "toml": 18, "tomlkit": 18, "too": [2, 11, 15, 51, 53, 67], "tool": [0, 2, 4, 10, 15, 21, 29, 31, 42, 43, 44, 48, 52, 67, 68, 69, 70, 71], "top": [8, 15, 18, 29, 33, 38, 66, 67, 68, 69, 70, 71, 73], "topic": [7, 26, 40, 45, 68], "total": [35, 43, 62], "touch": [15, 68], "toward": [67, 71], "traceback": 16, "track": [9, 10, 13, 20, 21, 53, 54, 55, 64], "tracker": [46, 48, 72], "trade": 67, "train": 33, "trait": 21, "tranch": 75, "tranform": 59, "transfer": 16, "transform": [2, 15, 21, 28, 42, 44, 49, 51, 52, 58, 59, 61, 62, 68, 69, 70, 75], "transform_format": [59, 67], "transit": [7, 31, 67], "translat": [8, 71], "transpar": 15, "travers": 15, "treat": [29, 31, 60, 64], "treatment": [64, 68], "tree": [9, 24, 29, 31, 67], "treenod": 30, "tri": [41, 53, 67], "trick": 16, "tricker": 66, "trigger": 33, "trip": 65, "trivial": [60, 65], "troubleshoot": [33, 39, 43], "true": [16, 19, 24, 59, 60, 61, 64, 68, 69, 74], "truli": 45, "trust": [10, 67, 68], "try": [11, 16, 19, 41, 45, 48, 60, 61, 65, 66, 67, 69, 70, 71, 73, 74], "tsv": [11, 15, 37, 50, 61, 64, 74], "tt": 68, "ttt": 68, "tupl": [24, 34, 35, 58, 60, 64, 70], "ture": 16, "turn": [8, 32, 68, 71], "tutori": [7, 26, 29, 38, 41, 42, 45, 47, 51, 52, 64, 67, 70, 72, 73], "twice": 9, "two": [0, 8, 11, 15, 16, 18, 31, 33, 36, 37, 39, 44, 50, 51, 53, 60, 61, 65, 67, 68, 69, 70, 71, 73, 74], "tx": 65, "txt": [7, 53, 61], "type": [2, 5, 8, 9, 13, 15, 20, 21, 24, 28, 30, 32, 34, 35, 36, 37, 43, 44, 47, 49, 50, 51, 52, 53, 54, 55, 57, 58, 59, 61, 62, 63, 64, 65, 66, 68, 69, 70, 71, 74, 75], "type_frag": 58, "type_from_ast": 24, "typeerror": [11, 16, 24, 61], "typeexpress": 24, "typemap": 60, "typematch": 60, "typevarexp": 60, "typic": [2, 11, 29, 30, 31, 33, 38, 44, 51, 60, 61, 67, 68, 69, 70], "u": [15, 16, 26, 29, 32, 39, 43, 45, 50, 53, 65, 66, 67, 68, 69, 70, 71], "ubiquit": [9, 69], "ubuntu": 47, "ui": [8, 16], "ultim": [16, 29, 43, 45, 48, 71, 73, 75], "ultipl": 68, "uml": 8, "unabl": [5, 16], "unadorn": 16, "unambigu": [53, 67, 70], "unbound": 60, "uncommon": [15, 53], "under": [18, 21, 26, 29, 33, 39, 45, 47, 48, 53, 61, 65, 68, 69, 71], "underli": [11, 16, 35, 36, 50, 62, 66, 68, 69, 70], "underscor": [29, 46, 50], "understand": [8, 10, 12, 15, 16, 26, 31, 33, 65, 68], "understood": 9, "unexpect": 70, "unfamilar": 16, "unfortun": [33, 45], "unicod": [16, 60], "unifi": 51, "unimport": 58, "uninitializedpluginmanagererror": [24, 61], "uninterest": 16, "union": [58, 60], "uniqu": [2, 9, 35, 44, 45, 50, 51, 60, 64, 67], "unit": [2, 29, 33, 45, 46, 50, 69, 70, 71, 72, 73], "unitl": 40, "unittest": [50, 59], "univers": [2, 31, 65], "unix": 2, "unkown": 12, "unless": [16, 18, 21, 35, 46, 47, 60, 73], "unlik": [11, 15, 16, 26, 46, 58, 62, 67, 70, 74], "unmap": 18, "unnecessari": [67, 69, 74], "unnecessarili": 50, "unpack": [50, 60, 61], "unrecognizedformaterror": 67, "unrel": 16, "unreli": 53, "unroot": [31, 67], "unshred": 16, "unspecifi": [68, 73], "until": [7, 16, 31, 66, 68, 69, 70, 71], "unus": 68, "unusu": 68, "unweighted_unifrac_emperor": 15, "unzip": [10, 15], "up": [9, 12, 16, 18, 21, 29, 32, 33, 42, 48, 50, 51, 52, 59, 65, 66, 67, 69, 70, 74], "upcom": 33, "upda": 50, "updat": [9, 10, 15, 16, 26, 33, 38, 45, 47, 71], "upfront": 53, "upload": 53, "upon": [8, 38], "uppercas": 46, "upstream": [33, 69, 74], "url": [0, 26, 39, 46, 58, 61], "us": [2, 4, 7, 8, 9, 10, 11, 12, 14, 15, 16, 19, 21, 24, 26, 27, 29, 31, 34, 35, 36, 37, 38, 42, 43, 44, 45, 46, 47, 49, 50, 52, 53, 55, 57, 58, 59, 60, 61, 62, 64, 65, 66, 68, 70, 71, 73, 74, 75], "usabl": [19, 33], "usag": [7, 17, 19, 20, 31, 42, 52, 57, 58, 59, 63, 65, 68, 69, 70, 72, 73, 75], "usage_vari": 61, "usageact": [50, 61, 71], "usagedriv": 71, "usageexampletest": 71, "usageinput": [50, 61, 71], "usageoutput": [50, 61], "usageoutputnam": [50, 61, 71], "usagevari": [50, 61], "user": [2, 4, 6, 8, 10, 12, 15, 16, 18, 19, 21, 24, 26, 29, 31, 33, 34, 36, 37, 38, 42, 43, 44, 45, 46, 47, 50, 51, 52, 53, 54, 57, 58, 60, 63, 65, 66, 67, 68, 69, 70, 71, 73, 74, 75], "user_support_text": [46, 58], "usual": [7, 8, 16, 18, 33, 39, 46, 53, 58, 60, 61], "utensil": 16, "utf": 66, "util": [10, 14, 15, 33, 39, 51, 52, 57, 59, 61, 63, 67, 68, 69], "utlit": 51, "uuid": [2, 9, 15, 21, 53, 73], "v": [0, 33, 58, 64], "v0": 21, "v1": [11, 21], "v2": 21, "v4": [15, 21], "v5": 21, "val": [11, 50], "valid": [2, 8, 15, 16, 32, 42, 51, 52, 58, 59, 60, 61, 64, 67, 68, 71], "validate_someth": 58, "validation_level_to_n_char": 67, "validation_seq": 67, "validation_seq_len": 67, "validationerror": [11, 24, 56, 58, 67], "vallei": 26, "valu": [2, 11, 15, 16, 18, 24, 32, 33, 34, 35, 37, 39, 41, 46, 47, 50, 51, 53, 54, 60, 61, 64, 66, 68, 69, 70, 71, 73], "valuabl": 15, "valueerror": [11, 59, 64, 67], "vaniti": 61, "var": 47, "var_typ": 61, "varfield": 16, "vari": [18, 34, 46, 53, 67], "variabl": [16, 18, 21, 24, 29, 58, 60, 61, 66, 68, 69, 70, 71], "variad": 21, "variadic_input_simpl": 50, "varianc": 64, "variant": [16, 31, 58, 60], "variant1": 58, "variant2": 58, "variant_of": [16, 60], "variantfield": 60, "variat": 68, "varieti": 9, "variou": [15, 16, 20, 26, 64], "varriabl": 68, "vastli": 7, "ve": [16, 33, 34, 38, 42, 45, 50, 67, 68, 69, 70, 73, 74], "vector": [35, 37, 50], "vendor": 18, "verb": [2, 44], "verbos": [68, 73], "veri": [8, 9, 11, 16, 18, 26, 31, 32, 33, 34, 35, 37, 45, 46, 58, 66, 67, 68, 69, 70, 71], "verif": 51, "verifi": [36, 66], "version": [2, 7, 8, 9, 10, 15, 20, 22, 33, 39, 45, 46, 50, 53, 58, 67, 68, 73, 74], "versu": 70, "vertic": 8, "via": [2, 5, 8, 34, 38, 46, 50, 51, 54, 58, 59, 65, 69], "video": 31, "view": [2, 7, 10, 12, 15, 29, 31, 32, 35, 51, 53, 55, 58, 59, 60, 61, 65, 66, 67, 68, 69, 71, 73], "view_as_metadata": 61, "view_typ": [35, 55, 61, 65, 69], "viewer": [15, 66, 74], "viewport": 66, "violat": 70, "virtu": 16, "virtual": 15, "visibl": [15, 45], "visit": [47, 58], "visual": [2, 9, 10, 13, 15, 20, 21, 24, 27, 34, 35, 42, 46, 52, 58, 67, 68, 69, 70, 71, 72, 74, 75], "viusal": 66, "vizual": 66, "vm": 15, "vocabulari": [16, 64], "volatil": 51, "volum": 68, "w": [0, 26, 53, 56, 66, 74], "wa": [2, 9, 10, 11, 15, 16, 19, 21, 26, 29, 31, 33, 34, 37, 38, 47, 50, 53, 58, 64, 65, 67, 68, 69, 70, 74], "wai": [4, 7, 10, 11, 12, 15, 16, 18, 24, 29, 31, 32, 33, 38, 39, 43, 45, 47, 50, 53, 60, 61, 64, 66, 67, 68, 69, 70, 71, 72, 73], "wait": [8, 41, 69], "walk": [38, 53, 61, 75], "want": [15, 16, 18, 19, 26, 29, 31, 32, 37, 38, 39, 41, 43, 44, 45, 47, 50, 51, 66, 67, 68, 69, 70, 71, 73, 74, 75], "warn": [12, 32, 67, 68, 70, 71], "wast": 31, "watch": 11, "waterman": [0, 68, 69, 70], "we": [4, 5, 7, 8, 9, 10, 11, 12, 15, 16, 18, 21, 26, 29, 30, 31, 32, 33, 34, 35, 38, 39, 41, 43, 44, 45, 47, 48, 50, 51, 53, 58, 65, 66, 67, 68, 69, 70, 71, 73, 74], "web": [2, 7, 15, 38, 53], "websit": [9, 15, 21, 45, 46, 58, 68], "wednesdai": 33, "weekend": 31, "weird": 53, "welcom": 5, "well": [2, 7, 9, 10, 11, 15, 16, 31, 33, 43, 44, 45, 51, 64, 65, 66, 67, 68, 75], "went": [31, 66], "were": [2, 9, 15, 16, 18, 19, 21, 41, 53, 58, 60, 66, 67, 69, 71, 73, 74], "weren": 67, "weslei": 0, "what": [2, 8, 9, 10, 16, 18, 19, 29, 31, 33, 34, 36, 38, 39, 45, 50, 53, 58, 60, 61, 65, 66, 67, 69, 70, 71, 73, 74], "whatev": [8, 15, 29, 32, 37, 66, 67, 73], "whatsoev": 67, "when": [2, 7, 8, 9, 10, 11, 12, 15, 16, 19, 21, 24, 29, 30, 31, 32, 33, 37, 41, 43, 44, 45, 46, 50, 51, 53, 58, 59, 60, 62, 64, 65, 66, 67, 68, 69, 70, 71, 73, 74, 75], "whenev": [15, 21, 43, 58, 60], "where": [2, 7, 8, 9, 10, 15, 16, 18, 26, 29, 32, 33, 34, 38, 45, 46, 48, 49, 53, 58, 60, 64, 65, 66, 67, 68, 69, 70, 71, 74], "where_values_miss": 64, "wherev": [5, 16], "whether": [16, 31, 58, 60, 64, 67, 68, 70, 73], "which": [2, 7, 8, 9, 10, 11, 12, 14, 15, 16, 18, 21, 26, 29, 30, 31, 32, 34, 35, 38, 39, 45, 46, 47, 50, 51, 53, 58, 60, 61, 64, 66, 67, 68, 69, 70, 71, 73, 74, 75], "whichev": 43, "while": [2, 5, 9, 10, 11, 15, 16, 18, 31, 33, 39, 43, 45, 46, 59, 66, 68, 70, 71, 75], "who": [15, 26, 43, 47, 53, 67, 71, 75], "whole": [21, 43, 53, 68, 69], "whose": [8, 15, 21, 29, 50], "why": [7, 10, 16, 53, 70, 71], "wide": [10, 46], "width": 66, "wikipedia": [2, 53], "wild": 21, "window": 47, "winzip": 10, "wise": 60, "wish": [19, 39, 50, 67], "witcombe2006sword": 58, "within": [2, 7, 8, 9, 11, 15, 16, 21, 24, 30, 32, 33, 39, 44, 46, 48, 50, 51, 60, 61, 64, 70], "without": [2, 9, 10, 15, 16, 18, 29, 31, 32, 58, 60, 66, 67, 68, 69, 75], "won": [15, 48, 53, 66, 67, 68, 69, 73], "wonder": 50, "wood": 0, "word": [2, 10, 15, 16, 29, 45, 68], "work": [2, 3, 4, 7, 8, 10, 11, 15, 16, 19, 26, 30, 31, 32, 33, 38, 39, 43, 44, 45, 46, 47, 50, 51, 53, 59, 60, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75], "workaround": 68, "worker": 18, "workflow": [29, 33, 53, 69, 70, 74, 75], "workflow_dispatch": 33, "working_set": 15, "workspac": 16, "world": [16, 60, 75], "worri": [10, 16, 50], "wors": 31, "worst": 69, "worth": [45, 53, 68, 75], "would": [2, 9, 10, 12, 15, 16, 18, 19, 26, 31, 32, 33, 37, 38, 39, 42, 45, 46, 50, 53, 58, 60, 61, 64, 66, 68, 70, 71, 74], "wouldn": [16, 53, 68, 69], "wrap": [15, 34, 35, 44, 74], "wrapper": [32, 61], "write": [2, 4, 7, 8, 11, 16, 18, 21, 26, 31, 36, 37, 38, 42, 46, 52, 65, 67, 69, 70, 72, 73, 74, 75], "write_csv": 58, "written": [18, 21, 32, 37, 44, 46, 53, 64, 66, 67, 71], "wrong": [15, 31, 66, 67, 74], "wrote": [50, 65, 66, 67, 69, 70, 74], "wsl": 47, "wunsch": [0, 68, 70], "x": 60, "x86_64": 15, "xdg": 18, "xopen": 15, "y": [53, 60, 70], "yaml": [10, 21, 29, 33, 38, 47], "year": [10, 45, 68], "yet": [9, 10, 16, 32, 33, 50, 58, 67, 68, 69], "yield": 69, "yml": [29, 33, 39, 47], "you": [4, 5, 7, 9, 10, 12, 15, 16, 18, 19, 24, 26, 29, 30, 31, 32, 33, 34, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 53, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75], "your": [0, 4, 7, 16, 18, 19, 29, 31, 32, 34, 37, 41, 42, 44, 50, 51, 52, 53, 58, 60, 65, 67, 68, 69, 70, 72, 74], "your_qiime2_act": 18, "yourself": [2, 26, 32, 46, 51, 53, 69, 74], "zero": [2, 16, 60, 64, 68], "zip": [10, 15, 16, 50], "zipfil": 9, "zipp": 15, "zuckerberg": 26}, "titles": ["List of works cited", "Index", "Glossary", "Back matter", "Distribution Development", "Developer documentation", "Docs Development", "User documentation", "QIIME 2 architecture overview", "Anatomy of an Archive", "How Data is Stored", "File Formats and Directory Formats", "Garbage Collection", "Explanations", "Metaprogramming", "Decentralized retrospective provenance tracking", "Semantic Types, Primitives, and Visualizations", "How-To Guides", "Parallel configuration and usage in QIIME 2", "Pipeline Resumption in QIIME 2", "Framework Development", "Archive versions", "References", "Interface Development", "Interface developer API reference", "References", "Developing with QIIME 2", "Types of QIIME 2 Actions", "Explanations", "The structure of QIIME 2 plugin packages", "Transformers", "Semantic types, data types, file formats, and artifact classes", "Use Artifact Collections as Action inputs or outputs", "Automate testing of your plugin", "Create and register a Method", "Create and register a pipeline", "Creating and registering a Transformer", "Create and register a visualizer", "Distribute plugins on GitHub", "Facilitating installation of your plugin for users", "Defining different Format validation levels", "Handling exceptions in parallel Pipelines", "How-To Guides", "Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)", "How to play nicely with other plugins", "Publicize your QIIME 2 plugins (or other QIIME 2-based tools)", "Register a QIIME 2 plugin", "Set up your development environment", "Provide technical support for your users", "How to test QIIME 2 plugins", "Writing Usage Examples", "How to use Metadata", "Plugin Development", "Plugin development anti-patterns", "Citations", "Pipeline Context Object", "Formats", "Plugin Development API", "Plugin & Registration", "Testing", "Types", "Usage Examples", "Utilities", "References", "User Metadata API", "Add a second transformer", "Add a first Visualizer", "Add a new Artifact Class", "Add a first (real) Method", "Add a Pipeline with parallel computing support", "Add a first Pipeline", "Add a Usage Example", "Conclusion", "Create your plugin from a template", "Integrate metadata in Actions", "Tutorial: A step-by-step guide to building your first QIIME 2 plugin"], "titleterms": {"": 43, "0": 21, "1": 21, "2": [8, 10, 18, 19, 21, 26, 27, 29, 39, 43, 45, 46, 47, 49, 75], "3": [18, 19, 21, 68, 71], "4": 21, "5": 21, "6": 21, "7": 21, "A": [8, 51, 68, 75], "In": 9, "The": [9, 15, 18, 24, 29, 32, 64, 74], "To": [17, 42], "__init__": 29, "_method": 29, "_pipelin": 70, "_version": 29, "access": 10, "acknowledg": 26, "action": [15, 24, 27, 32, 33, 58, 61, 66, 68, 70, 74], "activ": 47, "add": [65, 66, 67, 68, 69, 70, 71, 74], "addit": [57, 68], "advanc": 51, "agnost": 21, "align": [67, 68, 69, 71], "amplicon": 47, "an": [9, 16, 32, 39, 46, 66, 67, 68, 70, 74], "analogi": 16, "anatomi": 9, "ani": 39, "annot": 61, "anti": 53, "api": [18, 19, 24, 32, 51, 57, 64, 68, 71], "appli": 69, "ar": 30, "architectur": 8, "archiv": [9, 21], "artifact": [31, 32, 51, 67], "assert": 61, "associ": 11, "autom": [33, 71], "avoid": 70, "awai": 15, "back": 3, "base": 45, "basic": 60, "between": 43, "bib": 29, "binari": 11, "block": 15, "build": [47, 75], "call": 68, "can": [50, 51], "captur": 15, "categor": 51, "cfg": 29, "check": 10, "choic": 16, "ci": [29, 33], "citat": [29, 54, 68], "cite": 0, "class": [31, 64, 67], "cli": [18, 19, 32], "collect": [12, 32, 60, 61], "column": [51, 64], "combin": 69, "command": [8, 18, 19, 32, 71], "comment": 50, "commun": 45, "compar": 69, "compat": 43, "compon": 8, "comput": 69, "conclus": 72, "conda": 47, "config": 18, "configur": [18, 33], "content": [26, 75], "context": [50, 55], "continu": 33, "contribut": [7, 26, 45, 47], "cookiecutt": 73, "creat": [34, 35, 36, 37, 69, 70, 73], "current": 7, "custom": 39, "data": [9, 10, 15, 29, 31, 50, 71], "decentr": 15, "defin": [16, 40, 46, 50, 65, 67, 68, 69, 71], "depend": 60, "detail": 8, "develop": [4, 5, 6, 16, 20, 23, 24, 26, 47, 52, 53, 57, 67], "diagram": 8, "differ": 40, "directori": [11, 67], "discov": 67, "displai": 71, "distribut": [4, 38, 39, 43, 47], "dna": 65, "doc": 6, "docstr": 5, "document": [5, 7, 70], "dr": [65, 66, 67, 68, 69, 70, 71, 74], "drop": 51, "duplic": 70, "dure": 73, "dwq2": 29, "each": 69, "empti": 51, "entri": 46, "environ": [15, 26, 47], "exampl": [15, 49, 50, 61, 71, 74], "except": [24, 41, 64], "execut": 15, "exercis": [66, 67, 68, 70, 71], "exist": [39, 43, 47], "expand": 38, "explan": [13, 28], "extend": 16, "extens": 10, "facilit": 39, "factori": 50, "feedback": 43, "few": 68, "file": [9, 11, 15, 18, 31, 51, 67], "filepath": 53, "filter": 51, "find": 5, "first": [47, 66, 68, 70, 75], "fix": 11, "flowchart": 69, "follow": 8, "format": [11, 21, 31, 40, 53, 56, 67], "forum": 45, "framework": 20, "free": 51, "from": [51, 65, 73], "function": [24, 34, 35, 37, 66, 68], "fund": 26, "garbag": 12, "gener": [51, 62], "get": [26, 43], "gha": 33, "git": [29, 73], "github": [29, 33, 38], "gitignor": 29, "glossari": 2, "goal": 10, "goe": 9, "guarante": 21, "guid": [17, 42, 75], "handl": 41, "help": [26, 45, 51], "hint": 70, "how": [10, 17, 30, 42, 44, 45, 49, 51], "i": [10, 15], "id": 15, "identifi": 9, "import": [9, 61, 67], "index": 1, "individu": 57, "inform": 70, "init": 32, "initi": [61, 73], "input": [10, 24, 32, 53, 69, 71, 74], "instal": [38, 39, 47, 73], "instanti": 46, "instruct": 38, "integr": [33, 74], "interfac": [16, 18, 19, 23, 24, 32, 71], "interoper": 10, "intersect": 16, "latest": 47, "layout": 11, "level": 40, "librari": 45, "licens": [26, 29], "line": [18, 19, 32, 71], "list": [0, 57], "load": 32, "local": 69, "make": [51, 67], "makefil": 29, "manifest": 29, "matter": 3, "maxim": 43, "md": 29, "me": 51, "merg": 51, "metadata": [9, 10, 51, 60, 61, 64, 74], "metagenom": 47, "metaprogram": 14, "method": [34, 68, 69], "most": 9, "need": 73, "new": [65, 67, 68, 73], "next": 47, "nice": 44, "normal": 51, "note": 16, "number": 69, "numer": 51, "nw": [67, 71], "nw_align": 70, "object": [24, 31, 32, 46, 55, 57, 61], "option": [66, 67, 68, 70, 71, 73, 74], "other": [44, 45, 47], "our": [68, 69], "out": 50, "output": [24, 32, 51, 53], "overview": [8, 46], "packag": 29, "pairwis": 68, "parallel": [18, 41, 69], "paramet": [53, 61], "pattern": 53, "pipelin": [15, 19, 35, 41, 55, 69, 70], "plai": 44, "plan": 7, "plugin": [29, 30, 33, 38, 39, 43, 44, 45, 46, 47, 49, 52, 53, 57, 58, 62, 66, 68, 73, 75], "plugin_setup": [29, 68, 74], "pluginmanag": 24, "point": 46, "post": 45, "pre": 45, "predic": 60, "prerequisit": 47, "primit": [16, 60], "print": 45, "properti": 16, "proven": [9, 10, 15], "provid": [48, 50, 53], "public": 45, "publicli": 67, "put": 31, "py": [29, 68, 70, 74], "python": [18, 19, 32, 66, 68, 71], "q2": 29, "q2_dwq2": [29, 65], "q2cli": 68, "qiim": [8, 10, 18, 19, 26, 27, 29, 39, 43, 45, 46, 47, 49, 64, 75], "rang": 16, "readm": 29, "real": 68, "recommend": 39, "refactor": 7, "refer": [22, 24, 25, 63], "refin": 16, "regist": [32, 34, 35, 36, 37, 46, 50, 66, 67, 68, 69, 70, 71], "registr": 58, "repositori": 73, "requir": 39, "result": 61, "resultcollect": 32, "resumpt": [19, 69], "retrospect": 15, "return": 32, "rule": 9, "run": [69, 73], "save": 32, "search": [69, 74], "search_and_summar": 69, "second": [65, 68], "semant": [16, 31, 60, 67], "sequenc": [68, 69], "serial": 69, "set": [26, 47], "setup": 29, "share": 38, "should": 69, "singl": 11, "singlerecorddnafastaformat": 65, "site_config_dir": 18, "size": 69, "skbio": 65, "skip": 53, "sourc": 5, "split": 69, "split_sequ": 69, "splitter": 69, "sql": 51, "statu": 26, "step": [47, 75], "storag": 10, "store": 10, "structur": 29, "subtyp": 16, "summar": [69, 74], "summari": 8, "support": [48, 69], "tabl": 75, "tabulate_las_result": 74, "take": [15, 32, 69], "technic": 48, "templat": [38, 73], "test": [29, 33, 49, 50, 59, 65, 66, 67, 68, 69, 70, 71, 73, 74], "test_method": 29, "text": 11, "them": 45, "thi": [26, 68], "through": [8, 18, 19], "time": 69, "tini": [39, 47], "tl": [65, 66, 67, 68, 69, 70, 71, 74], "togeth": 31, "tool": [45, 73], "top": 39, "topic": 57, "track": 15, "transfer": 10, "transfom": 65, "transform": [30, 36, 65, 67], "try": [50, 68], "tsv": 51, "tutori": [71, 75], "type": [10, 11, 16, 27, 31, 60, 67], "understand": 45, "union": 16, "uniqu": 15, "unit": [65, 66, 67, 68, 74], "up": [26, 47, 68], "updat": [67, 69, 70, 74], "us": [18, 30, 32, 33, 39, 51, 67, 69], "usag": [18, 50, 61, 71, 74], "user": [7, 39, 48, 64], "user_config_dir": 18, "util": [24, 62], "valid": [10, 11, 40, 53], "variabl": 11, "version": [21, 29, 47], "versu": 69, "viewabl": 51, "visual": [16, 37, 51, 60, 66], "weekli": 33, "what": [15, 68], "why": [9, 15], "work": 0, "wrap": 68, "wrapper": 68, "write": [50, 66, 68, 71], "yaml": [9, 15], "your": [26, 33, 38, 39, 43, 45, 46, 47, 48, 66, 71, 73, 75], "zip": 9}})
\ No newline at end of file
+Search.setIndex({"alltitles": {"": [[9, null], [10, null], [15, null], [29, null], [51, null], [68, null], [68, null], [68, null], [71, null]], "A few additional tests": [[68, "a-few-additional-tests"]], "A first test of our plugin action": [[68, "a-first-test-of-our-plugin-action"]], "A second test of our action": [[68, "a-second-test-of-our-action"]], "A visualizer for free!": [[51, "a-visualizer-for-free"]], "Accessibility and Transferability": [[10, "accessibility-and-transferability"]], "Acknowledgements": [[26, "acknowledgements"]], "Action registration": [[58, "action-registration"]], "Actions": [[24, "actions"], [61, "actions"]], "Activate the conda environment": [[47, "activate-the-conda-environment"]], "Add a Pipeline with parallel computing support": [[69, null]], "Add a Usage Example": [[71, null]], "Add a first (real) Method": [[68, null]], "Add a first Pipeline": [[70, null]], "Add a first Visualizer": [[66, null]], "Add a local alignment search Pipeline": [[69, "add-a-local-alignment-search-pipeline"]], "Add a new Artifact Class": [[67, null]], "Add a second transformer": [[65, null]], "Add an optional input to tabulate_las_results": [[74, "add-an-optional-input-to-tabulate-las-results"]], "Add parallel computing support to search_and_summarize": [[69, "add-parallel-computing-support-to-search-and-summarize"]], "Add tests and documentation": [[70, "add-tests-and-documentation"]], "Add unit tests and update the search-and-summarize usage example": [[74, "add-unit-tests-and-update-the-search-and-summarize-usage-example"]], "Add unit tests of the new transfomer": [[65, "add-unit-tests-of-the-new-transfomer"]], "Additional Objects": [[57, "additional-objects"]], "Advanced Filtering": [[51, "advanced-filtering"]], "Amplicon distribution": [[47, "amplicon-distribution"]], "An Analogy": [[16, "an-analogy"]], "An optional exercise": [[66, "an-optional-exercise"], [67, "an-optional-exercise"], [68, "an-optional-exercise"], [70, "an-optional-exercise"]], "Anatomy of an Archive": [[9, null]], "Annotations": [[61, "annotations"]], "Archive Version 0": [[21, "archive-version-0"]], "Archive Version 1": [[21, "archive-version-1"]], "Archive Version 2": [[21, "archive-version-2"]], "Archive Version 3": [[21, "archive-version-3"]], "Archive Version 4": [[21, "archive-version-4"]], "Archive Version 5": [[21, "archive-version-5"]], "Archive Version 6": [[21, "archive-version-6"]], "Archive Version 7": [[21, "archive-version-7"]], "Archive versions": [[21, null]], "Artifact classes": [[31, "artifact-classes"], [67, "artifact-classes"]], "Associating Formats with a Type": [[11, "associating-formats-with-a-type"]], "Automate testing of your plugin": [[33, null]], "Automated Testing using Continuous Integration (CI) and Github Actions (GHA)": [[33, "automated-testing-using-continuous-integration-ci-and-github-actions-gha"]], "Automated testing of usage examples": [[71, "automated-testing-of-usage-examples"]], "Back matter": [[3, null]], "Basic types": [[60, "basic-types"]], "Binary File Formats": [[11, "binary-file-formats"]], "Building your first plugin": [[47, "building-your-first-plugin"]], "Calling the action with q2cli and the Python 3 API": [[68, "calling-the-action-with-q2cli-and-the-python-3-api"]], "Categorical Metadata Columns": [[51, "categorical-metadata-columns"]], "Choices": [[16, "choices"]], "Citations": [[54, null]], "Collections": [[60, "collections"], [61, "collections"]], "Command line interface": [[71, "command-line-interface"]], "Comments can provide context": [[50, "comments-can-provide-context"]], "Community Contributions on the QIIME 2 Forum": [[45, "community-contributions-on-the-qiime-2-forum"]], "Compare the serial versus parallel run times of the search-and-summarize": [[69, "compare-the-serial-versus-parallel-run-times-of-the-search-and-summarize"]], "Conclusion": [[72, null]], "Configure Continuous Integration (CI) testing": [[33, "configure-continuous-integration-ci-testing"]], "Configure weekly automated testing": [[33, "configure-weekly-automated-testing"]], "Contributing": [[26, "contributing"]], "Contributing to existing plugins": [[47, "contributing-to-existing-plugins"]], "Contributing to the current user documentation": [[7, "contributing-to-the-current-user-documentation"]], "Create _pipelines.py and add a Pipeline": [[70, "create-pipelines-py-and-add-a-pipeline"]], "Create a function to register as a Method": [[34, "create-a-function-to-register-as-a-method"]], "Create a function to register as a Pipeline": [[35, "create-a-function-to-register-as-a-pipeline"]], "Create a function to register as a Visualizer": [[37, "create-a-function-to-register-as-a-visualizer"]], "Create and register a Method": [[34, null]], "Create and register a pipeline": [[35, null]], "Create and register a visualizer": [[37, null]], "Create your plugin from a template": [[73, null]], "Creating and registering a Transformer": [[36, null]], "Data Goes In /data/": [[9, "data-goes-in-data"]], "Data factories for usage examples": [[50, "data-factories-for-usage-examples"]], "Decentralized retrospective provenance tracking": [[15, null]], "Define a citation for this action": [[68, "define-a-citation-for-this-action"]], "Define a transformer from skbio.DNA to q2_dwq2.SingleRecordDNAFASTAFormat": [[65, "define-a-transformer-from-skbio-dna-to-q2-dwq2-singlerecorddnafastaformat"]], "Define input data for your usage example": [[71, "define-input-data-for-your-usage-example"]], "Defining a Type": [[16, "defining-a-type"]], "Defining a new directory format": [[67, "defining-a-new-directory-format"]], "Defining a new file format": [[67, "defining-a-new-file-format"]], "Defining a new semantic type": [[67, "defining-a-new-semantic-type"]], "Defining a split Method": [[69, "defining-a-split-method"]], "Defining a usage example for nw-align": [[71, "defining-a-usage-example-for-nw-align"]], "Defining and registering a combine method": [[69, "defining-and-registering-a-combine-method"]], "Defining and registering a transformer": [[67, "defining-and-registering-a-transformer"]], "Defining different Format validation levels": [[40, null]], "Defining the usage example": [[71, "defining-the-usage-example"]], "Defining usage examples": [[50, "defining-usage-examples"]], "Defining your plugin object as an entry point": [[46, "defining-your-plugin-object-as-an-entry-point"]], "Dependent Types": [[60, "dependent-types"]], "Detailed Component Diagram": [[8, "detailed-component-diagram"]], "Developer documentation": [[5, null]], "Developing a new artifact class": [[67, "developing-a-new-artifact-class"]], "Developing with QIIME 2": [[26, null]], "Development status of this content": [[26, null]], "Directory Formats": [[11, "directory-formats"]], "Discovering artifact classes": [[67, "discovering-artifact-classes"]], "Displaying usage examples": [[71, "displaying-usage-examples"]], "Distribute plugins on GitHub": [[38, null]], "Distribution Development": [[4, null]], "Docs Development": [[6, null]], "Dropping Empty Columns": [[51, "dropping-empty-columns"]], "Examples": [[49, "examples"]], "Exceptions": [[24, "exceptions"], [64, "exceptions"]], "Expanding on the install instructions": [[38, "expanding-on-the-install-instructions"]], "Explanations": [[13, null], [28, null]], "Extending a Type": [[16, "extending-a-type"]], "Facilitating installation of your plugin for users": [[39, null]], "File Formats": [[11, "file-formats"]], "File Formats and Directory Formats": [[11, null]], "File types (or formats) and data types (or objects)": [[31, "file-types-or-formats-and-data-types-or-objects"]], "Finding docstring sources": [[5, "finding-docstring-sources"]], "Fixed Layouts": [[11, "fixed-layouts"]], "Following A Command Through QIIME 2": [[8, "following-a-command-through-qiime-2"]], "Formats": [[56, null]], "Framework Development": [[20, null]], "Funding": [[26, "funding"]], "Garbage Collection": [[12, null]], "General Utils": [[62, "general-utils"]], "Generating metadata as output from visualizations": [[51, "generating-metadata-as-output-from-visualizations"]], "Getting Feedback on your Plugin": [[43, "getting-feedback-on-your-plugin"]], "Getting Help": [[26, "getting-help"]], "Glossary": [[2, null]], "Goals for data storage in QIIME 2": [[10, "goals-for-data-storage-in-qiime-2"]], "Handling exceptions in parallel Pipelines": [[41, null]], "Help others understand how your tool will help them": [[45, "help-others-understand-how-your-tool-will-help-them"]], "Hint": [[70, null]], "How Data is Stored": [[10, null]], "How are transformers used by a plugin?": [[30, "how-are-transformers-used-by-a-plugin"]], "How can the Metadata API Help Me?": [[51, "how-can-the-metadata-api-help-me"]], "How to play nicely with other plugins": [[44, null]], "How to test QIIME 2 plugins": [[49, null]], "How to use Metadata": [[51, null]], "How-To Guides": [[17, null], [42, null]], "Importing": [[61, "importing"]], "Index": [[1, null]], "Individual Topics": [[57, "individual-topics"]], "Initializers": [[61, "initializers"]], "Input Validation (Type Checking)": [[10, "input-validation-type-checking"]], "Inputs and outputs": [[24, "inputs-and-outputs"]], "Install Prerequisites": [[47, "install-prerequisites"]], "Install and test your new plugin": [[73, "install-and-test-your-new-plugin"]], "Install the latest development version of the QIIME 2 \u201cTiny Distribution\u201d": [[47, "install-the-latest-development-version-of-the-qiime-2-tiny-distribution"]], "Install the tools needed for templating your plugin": [[73, "install-the-tools-needed-for-templating-your-plugin"]], "Installing other QIIME 2 distributions": [[47, "installing-other-qiime-2-distributions"]], "Installing your plugin on top of an existing QIIME 2 Distribution (recommended)": [[39, "installing-your-plugin-on-top-of-an-existing-qiime-2-distribution-recommended"]], "Installing your plugin using the Tiny Distribution and any custom required plugins": [[39, "installing-your-plugin-using-the-tiny-distribution-and-any-custom-required-plugins"]], "Instantiating a plugin": [[46, "instantiating-a-plugin"]], "Integrate metadata in Actions": [[74, null]], "Interface Developer Note:": [[16, null]], "Interface Development": [[23, null]], "Interface developer API reference": [[24, null]], "Interface development API": [[24, "interface-development-api"]], "Interoperability and Extension": [[10, "interoperability-and-extension"]], "Intersections": [[16, "intersections"]], "License": [[26, "license"]], "List of works cited": [[0, null]], "Making Artifacts Viewable as Metadata": [[51, "making-artifacts-viewable-as-metadata"]], "Making the new type and formats publicly importable": [[67, "making-the-new-type-and-formats-publicly-importable"]], "Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)": [[43, null]], "Merging Metadata": [[51, "merging-metadata"]], "Metadata": [[51, "metadata"], [60, "metadata"], [61, "metadata"]], "Metadata Columns": [[51, "metadata-columns"]], "Metadata columns": [[64, "metadata-columns"]], "Metagenome distribution": [[47, "metagenome-distribution"]], "Metaprogramming": [[14, null]], "Next steps": [[47, "next-steps"]], "Normalizing TSV Files": [[51, "normalizing-tsv-files"]], "Numeric Metadata Columns": [[51, "numeric-metadata-columns"]], "Optional exercise": [[71, "optional-exercise"]], "Optionally initialize a git repository during plugin templating": [[73, null]], "Overview": [[46, "overview"]], "Pairwise sequence alignment": [[68, "pairwise-sequence-alignment"]], "Parallel configuration and usage in QIIME 2": [[18, null]], "Parameter Objects for Usage.action": [[61, "parameter-objects-for"]], "Pipeline Context Object": [[55, null]], "Pipeline Provenance": [[15, "pipeline-provenance"]], "Pipeline Resumption in QIIME 2": [[19, null]], "Pipeline provenance example": [[15, "pipeline-provenance-example"]], "Pipeline provenance take-aways": [[15, "pipeline-provenance-take-aways"]], "Pipeline resumption through the Python 3 API": [[19, "pipeline-resumption-through-the-python-3-api"]], "Pipeline resumption through the command line interface (CLI)": [[19, "pipeline-resumption-through-the-command-line-interface-cli"]], "Pipeline resumption \u267b\ufe0f": [[69, null]], "Plans for refactoring of user documentation": [[7, "plans-for-refactoring-of-user-documentation"]], "Plugin & Registration": [[58, null]], "Plugin API List": [[57, "plugin-api-list"]], "Plugin Development": [[52, null]], "Plugin Development API": [[57, null]], "Plugin Utils": [[62, "plugin-utils"]], "Plugin development anti-patterns": [[53, null]], "Post a pre-print": [[45, "post-a-pre-print"]], "Predicates": [[60, "predicates"], [60, "id1"]], "Primitive Types": [[16, "primitive-types"]], "Primitive types": [[60, "primitive-types"]], "Properties": [[16, "properties"]], "Provenance Goes In /provenance/": [[9, "provenance-goes-in-provenance"]], "Provenance Metadata": [[10, "provenance-metadata"]], "Provide technical support for your users": [[48, null]], "Providing input or output filepaths as parameters": [[53, "providing-input-or-output-filepaths-as-parameters"]], "Publicize your QIIME 2 plugins (or other QIIME 2-based tools)": [[45, null]], "Putting it together": [[31, "putting-it-together"]], "Python 3 API": [[71, "python-3-api"]], "QIIME 2 Library": [[45, "qiime-2-library"]], "QIIME 2 architecture overview": [[8, null]], "Range": [[16, "range"]], "References": [[22, null], [25, null], [63, null]], "Refining a Type": [[16, "refining-a-type"]], "Register a QIIME 2 plugin": [[46, null]], "Register the Method": [[34, "register-the-method"]], "Register the Pipeline": [[70, "register-the-pipeline"]], "Register the Visualizer": [[37, "register-the-visualizer"]], "Register the action in plugin_setup.py": [[68, "register-the-action-in-plugin-setup-py"]], "Register the wrapper function as a plugin action": [[68, "register-the-wrapper-function-as-a-plugin-action"]], "Register your Python function as a plugin action": [[66, "register-your-python-function-as-a-plugin-action"]], "Registering an Action that Returns an Output Collection": [[32, "registering-an-action-that-returns-an-output-collection"]], "Registering an Action that Takes an Input Collection": [[32, "registering-an-action-that-takes-an-input-collection"]], "Registering an artifact class": [[67, "registering-an-artifact-class"]], "Registering split_sequences": [[69, "registering-split-sequences"]], "Registering the Pipeline": [[35, "registering-the-pipeline"]], "Registering the type, formats, and artifact class": [[67, "registering-the-type-formats-and-artifact-class"]], "Registering the usage example": [[71, "registering-the-usage-example"]], "Registering usage examples": [[50, "registering-usage-examples"]], "Results and Assertions": [[61, "results-and-assertions"]], "Rules for identifying an archive": [[9, "rules-for-identifying-an-archive"]], "Run cookiecutter to create your plugin": [[73, "run-cookiecutter-to-create-your-plugin"]], "SQL Filtering": [[51, "sql-filtering"]], "Semantic Properties": [[16, "semantic-properties"]], "Semantic Subtyping": [[16, "semantic-subtyping"]], "Semantic Type": [[60, "semantic-type"]], "Semantic Types, Primitives, and Visualizations": [[16, null]], "Semantic types": [[31, "semantic-types"]], "Semantic types, data types, file formats, and artifact classes": [[31, null]], "Set up your development environment": [[47, null]], "Setting up your development environment": [[26, null]], "Share your plugin on GitHub": [[38, "share-your-plugin-on-github"]], "Should our sequence splitter take the size of each split or the number of splits to create as input?": [[69, null]], "Single File Directory Formats": [[11, "single-file-directory-formats"]], "Skipping format validation": [[53, "skipping-format-validation"]], "Summary": [[8, "summary"]], "Template your plugin": [[38, "template-your-plugin"]], "Testing": [[59, null]], "Testing the parallel Pipeline": [[69, "testing-the-parallel-pipeline"]], "Testing the semantic type and formats": [[67, "testing-the-semantic-type-and-formats"]], "Testing the transformer": [[67, "testing-the-transformer"]], "Testing usage examples": [[50, "testing-usage-examples"]], "Text File Formats": [[11, "text-file-formats"]], "The Config File": [[18, "the-config-file"]], "The Most Important File: metadata.yaml": [[9, "the-most-important-file-metadata-yaml"]], "The PluginManager Object": [[24, "the-pluginmanager-object"]], "The ResultCollection object": [[32, "the-resultcollection-object"]], "The action block": [[15, "the-action-block"]], "The action.yaml file": [[15, "the-action-yaml-file"]], "The environment block": [[15, "the-environment-block"]], "The execution block": [[15, "the-execution-block"]], "The input metadata": [[74, "the-input-metadata"]], "The qiime.Metadata class": [[64, "the-qiime-metadata-class"]], "The structure of QIIME 2 plugin packages": [[29, null]], "Transformers": [[30, null]], "Trying it out": [[50, "trying-it-out"]], "Trying the new action": [[68, "trying-the-new-action"]], "Tutorial table of contents": [[75, "tutorial-table-of-contents"]], "Tutorial: A step-by-step guide to building your first QIIME 2 plugin": [[75, null]], "Types": [[60, null]], "Types of QIIME 2 Actions": [[27, null]], "Unions": [[16, "unions"]], "Unique IDs": [[15, "unique-ids"]], "Unit testing": [[67, "unit-testing"]], "Unit testing the visualizer function": [[66, "unit-testing-the-visualizer-function"]], "Update plugin_setup.py": [[74, "update-plugin-setup-py"]], "Update search-and-summarize": [[74, "update-search-and-summarize"]], "Update search-and-summarize to use split and combine Methods": [[69, "update-search-and-summarize-to-use-split-and-combine-methods"]], "Update the nw_align action to avoid duplicating information": [[70, "update-the-nw-align-action-to-avoid-duplicating-information"]], "Updating nw-align to use the new artifact class": [[67, "updating-nw-align-to-use-the-new-artifact-class"]], "Usage Examples": [[61, null]], "Use Artifact Collections as Action inputs or outputs": [[32, null]], "User Metadata API": [[64, null]], "User documentation": [[7, null]], "Using Collections": [[32, "using-collections"]], "Using Collections with the Python API": [[32, "using-collections-with-the-python-api"]], "Using Collections with the command line interface (CLI)": [[32, "using-collections-with-the-command-line-interface-cli"]], "Using QIIME 2 in parallel through the Python 3 API": [[18, "using-qiime-2-in-parallel-through-the-python-3-api"]], "Using QIIME 2 in parallel through the command line interface (CLI)": [[18, "using-qiime-2-in-parallel-through-the-command-line-interface-cli"]], "Utilities": [[62, null]], "Utility functions": [[24, "utility-functions"]], "Validation": [[11, "validation"]], "Variable Layouts": [[11, "variable-layouts"]], "Version-agnostic format guarantees": [[21, "version-agnostic-format-guarantees"]], "Visualization type": [[60, "visualization-type"]], "What Provenance Data is Captured?": [[15, "what-provenance-data-is-captured"]], "What to test and what not to test": [[68, "what-to-test-and-what-not-to-test"]], "Why Capture Provenance Data?": [[15, "why-capture-provenance-data"]], "Why a ZIP File?": [[9, "why-a-zip-file"]], "Wrapping up testing": [[68, "wrapping-up-testing"]], "Write a wrapper function": [[68, "write-a-wrapper-function"]], "Write the visualizer function": [[66, "write-the-visualizer-function"]], "Write unit tests": [[68, "write-unit-tests"]], "Writing Usage Examples": [[50, null]], "Writing tutorials": [[71, "writing-tutorials"]], "init": [[32, "init"]], "load": [[32, "load"]], "q2-dwq2": [[29, "q2-dwq2"]], "q2-dwq2/.git": [[29, "q2-dwq2-git"]], "q2-dwq2/.github": [[29, "q2-dwq2-github"]], "q2-dwq2/.gitignore": [[29, "q2-dwq2-gitignore"]], "q2-dwq2/LICENSE": [[29, "q2-dwq2-license"]], "q2-dwq2/MANIFEST.in": [[29, "q2-dwq2-manifest-in"]], "q2-dwq2/Makefile": [[29, "q2-dwq2-makefile"]], "q2-dwq2/README.md": [[29, "q2-dwq2-readme-md"]], "q2-dwq2/ci": [[29, "q2-dwq2-ci"]], "q2-dwq2/q2_dwq2": [[29, "q2-dwq2-q2-dwq2"]], "q2-dwq2/q2_dwq2/__init__.py": [[29, "q2-dwq2-q2-dwq2-init-py"]], "q2-dwq2/q2_dwq2/_methods.py": [[29, "q2-dwq2-q2-dwq2-methods-py"]], "q2-dwq2/q2_dwq2/_version.py": [[29, "q2-dwq2-q2-dwq2-version-py"]], "q2-dwq2/q2_dwq2/citations.bib": [[29, "q2-dwq2-q2-dwq2-citations-bib"]], "q2-dwq2/q2_dwq2/plugin_setup.py": [[29, "q2-dwq2-q2-dwq2-plugin-setup-py"]], "q2-dwq2/q2_dwq2/setup.cfg": [[29, "q2-dwq2-q2-dwq2-setup-cfg"]], "q2-dwq2/q2_dwq2/setup.py": [[29, "q2-dwq2-q2-dwq2-setup-py"]], "q2-dwq2/q2_dwq2/tests": [[29, "q2-dwq2-q2-dwq2-tests"]], "q2-dwq2/q2_dwq2/tests/__init__.py": [[29, "q2-dwq2-q2-dwq2-tests-init-py"]], "q2-dwq2/q2_dwq2/tests/data": [[29, "q2-dwq2-q2-dwq2-tests-data"]], "q2-dwq2/q2_dwq2/tests/test_methods.py": [[29, "q2-dwq2-q2-dwq2-tests-test-methods-py"]], "q2-dwq2/q2_dwq2/versioneer.py": [[29, "q2-dwq2-q2-dwq2-versioneer-py"]], "save": [[32, "save"]], "site_config_dir": [[18, null]], "split-apply-combine flowchart for search and summarize": [[69, "split-apply-combine-flowchart"]], "tl;dr": [[65, null], [66, "add-alignment-visualizer-commit"], [67, "add-artifact-class-commit"], [68, "add-nw-align-method-commit"], [69, "add-parallel-pipeline-commits"], [70, "add-pipeline-commit"], [71, "add-usage-example-commit"], [74, "integrate-metadata-commits"]], "user_config_dir": [[18, null]]}, "docnames": ["back-matter/bibliography", "back-matter/genindex", "back-matter/glossary", "back-matter/intro", "ci/intro", "docs/developer-documentation", "docs/intro", "docs/user-documentation", "framework/explanations/architecture", "framework/explanations/archives", "framework/explanations/data-storage", "framework/explanations/formats", "framework/explanations/garbage-collection", "framework/explanations/intro", "framework/explanations/metaprogramming", "framework/explanations/provenance", "framework/explanations/types", "framework/how-to-guides/intro", "framework/how-to-guides/parallel-configuration", "framework/how-to-guides/pipeline-resumption", "framework/intro", "framework/references/archive-versions", "framework/references/intro", "interfaces/intro", "interfaces/references/api", "interfaces/references/intro", "intro", "plugins/explanations/actions", "plugins/explanations/intro", "plugins/explanations/package-structure", "plugins/explanations/transformers", "plugins/explanations/types-of-types", "plugins/how-to-guides/artifact-collections-as-io", "plugins/how-to-guides/automate-testing", "plugins/how-to-guides/create-register-method", "plugins/how-to-guides/create-register-pipeline", "plugins/how-to-guides/create-register-transformer", "plugins/how-to-guides/create-register-visualizer", "plugins/how-to-guides/distribute-on-gh", "plugins/how-to-guides/facilitate-installation", "plugins/how-to-guides/format-validation-levels", "plugins/how-to-guides/handle-exceptions-in-parallel-pipelines", "plugins/how-to-guides/intro", "plugins/how-to-guides/maximize-compatibility", "plugins/how-to-guides/play-nicely-with-others", "plugins/how-to-guides/publicize", "plugins/how-to-guides/register-a-plugin", "plugins/how-to-guides/set-up-development-environment", "plugins/how-to-guides/support-your-users", "plugins/how-to-guides/test-plugins", "plugins/how-to-guides/usage-examples", "plugins/how-to-guides/use-metadata", "plugins/intro", "plugins/references/antipatterns", "plugins/references/api/citations", "plugins/references/api/context", "plugins/references/api/formats", "plugins/references/api/intro", "plugins/references/api/plugin", "plugins/references/api/testing", "plugins/references/api/types", "plugins/references/api/usage", "plugins/references/api/utils", "plugins/references/intro", "plugins/references/metadata-api", "plugins/tutorials/add-2nd-transformer", "plugins/tutorials/add-alignment-visualizer", "plugins/tutorials/add-artifact-class", "plugins/tutorials/add-nw-align-method", "plugins/tutorials/add-parallel-pipeline", "plugins/tutorials/add-pipeline", "plugins/tutorials/add-usage-examples", "plugins/tutorials/conclusion", "plugins/tutorials/create-from-template", "plugins/tutorials/integrate-metadata", "plugins/tutorials/intro"], "envversion": {"sphinx": 62, "sphinx.domains.c": 3, "sphinx.domains.changeset": 1, "sphinx.domains.citation": 1, "sphinx.domains.cpp": 9, "sphinx.domains.index": 1, "sphinx.domains.javascript": 3, "sphinx.domains.math": 2, "sphinx.domains.python": 4, "sphinx.domains.rst": 2, "sphinx.domains.std": 2, "sphinx.ext.intersphinx": 1, "sphinxcontrib.bibtex": 9}, "filenames": ["back-matter/bibliography.md", "back-matter/genindex.md", "back-matter/glossary.md", "back-matter/intro.md", "ci/intro.md", "docs/developer-documentation.md", "docs/intro.md", "docs/user-documentation.md", "framework/explanations/architecture.md", "framework/explanations/archives.md", "framework/explanations/data-storage.md", "framework/explanations/formats.md", "framework/explanations/garbage-collection.md", "framework/explanations/intro.md", "framework/explanations/metaprogramming.md", "framework/explanations/provenance.md", "framework/explanations/types.md", "framework/how-to-guides/intro.md", "framework/how-to-guides/parallel-configuration.md", "framework/how-to-guides/pipeline-resumption.md", "framework/intro.md", "framework/references/archive-versions.md", "framework/references/intro.md", "interfaces/intro.md", "interfaces/references/api.md", "interfaces/references/intro.md", "intro.md", "plugins/explanations/actions.md", "plugins/explanations/intro.md", "plugins/explanations/package-structure.md", "plugins/explanations/transformers.md", "plugins/explanations/types-of-types.md", "plugins/how-to-guides/artifact-collections-as-io.md", "plugins/how-to-guides/automate-testing.md", "plugins/how-to-guides/create-register-method.md", "plugins/how-to-guides/create-register-pipeline.md", "plugins/how-to-guides/create-register-transformer.md", "plugins/how-to-guides/create-register-visualizer.md", "plugins/how-to-guides/distribute-on-gh.md", "plugins/how-to-guides/facilitate-installation.md", "plugins/how-to-guides/format-validation-levels.md", "plugins/how-to-guides/handle-exceptions-in-parallel-pipelines.md", "plugins/how-to-guides/intro.md", "plugins/how-to-guides/maximize-compatibility.md", "plugins/how-to-guides/play-nicely-with-others.md", "plugins/how-to-guides/publicize.md", "plugins/how-to-guides/register-a-plugin.md", "plugins/how-to-guides/set-up-development-environment.md", "plugins/how-to-guides/support-your-users.md", "plugins/how-to-guides/test-plugins.md", "plugins/how-to-guides/usage-examples.md", "plugins/how-to-guides/use-metadata.md", "plugins/intro.md", "plugins/references/antipatterns.md", "plugins/references/api/citations.md", "plugins/references/api/context.md", "plugins/references/api/formats.md", "plugins/references/api/intro.md", "plugins/references/api/plugin.md", "plugins/references/api/testing.md", "plugins/references/api/types.md", "plugins/references/api/usage.md", "plugins/references/api/utils.md", "plugins/references/intro.md", "plugins/references/metadata-api.md", "plugins/tutorials/add-2nd-transformer.md", "plugins/tutorials/add-alignment-visualizer.md", "plugins/tutorials/add-artifact-class.md", "plugins/tutorials/add-nw-align-method.md", "plugins/tutorials/add-parallel-pipeline.md", "plugins/tutorials/add-pipeline.md", "plugins/tutorials/add-usage-examples.md", "plugins/tutorials/conclusion.md", "plugins/tutorials/create-from-template.md", "plugins/tutorials/integrate-metadata.md", "plugins/tutorials/intro.md"], "indexentries": {"__iter__() (qiime2.plugin.citations method)": [[54, "qiime2.plugin.Citations.__iter__", false]], "action": [[2, "term-Action", true]], "action() (in module qiime2.sdk)": [[24, "qiime2.sdk.Action", false]], "action() (qiime2.sdk.usage.usage method)": [[61, "qiime2.sdk.usage.Usage.action", false]], "archive": [[2, "term-Archive", true]], "artifact": [[2, "term-Artifact", true]], "artifact api": [[2, "term-Artifact-API", true]], "artifact class": [[2, "term-Artifact-class", true]], "artifact() (in module qiime2.sdk)": [[24, "qiime2.sdk.Artifact", false]], "assert_has_line_matching() (qiime2.sdk.usage.usagevariable method)": [[61, "qiime2.sdk.usage.UsageVariable.assert_has_line_matching", false]], "assert_no_nans_in_tables() (in module qiime2.plugin.testing)": [[59, "qiime2.plugin.testing.assert_no_nans_in_tables", false]], "assert_output_type() (qiime2.sdk.usage.usagevariable method)": [[61, "qiime2.sdk.usage.UsageVariable.assert_output_type", false]], "assertregisteredsemantictype() (qiime2.plugin.testing.testpluginbase method)": [[59, "qiime2.plugin.testing.TestPluginBase.assertRegisteredSemanticType", false]], "assertsemantictyperegisteredtoformat() (qiime2.plugin.testing.testpluginbase method)": [[59, "qiime2.plugin.testing.TestPluginBase.assertSemanticTypeRegisteredToFormat", false]], "binaryfileformat (class in qiime2.plugin)": [[56, "qiime2.plugin.BinaryFileFormat", false]], "bool (in module qiime2.plugin)": [[60, "qiime2.plugin.Bool", false]], "categorical (in module qiime2.plugin)": [[60, "qiime2.plugin.Categorical", false]], "categoricalmetadatacolumn (class in qiime2)": [[64, "qiime2.CategoricalMetadataColumn", false]], "choices (class in qiime2.plugin)": [[60, "qiime2.plugin.Choices", false]], "citationrecord (class in qiime2.plugin)": [[54, "qiime2.plugin.CitationRecord", false]], "citations (class in qiime2.plugin)": [[54, "qiime2.plugin.Citations", false]], "collection (in module qiime2.plugin)": [[60, "qiime2.plugin.Collection", false]], "column_count (qiime2.metadata property)": [[64, "qiime2.Metadata.column_count", false]], "columns (qiime2.metadata property)": [[64, "qiime2.Metadata.columns", false]], "comment() (qiime2.sdk.usage.usage method)": [[61, "qiime2.sdk.usage.Usage.comment", false]], "conda metapackage": [[2, "term-Conda-metapackage", true]], "construct_artifact_collection() (qiime2.sdk.usage.usage method)": [[61, "qiime2.sdk.usage.Usage.construct_artifact_collection", false]], "deployment": [[2, "term-Deployment", true]], "directory format": [[2, "term-Directory-Format", true]], "directoryformat (class in qiime2.plugin)": [[56, "qiime2.plugin.DirectoryFormat", false]], "distribution": [[2, "term-Distribution", true]], "dr": [[2, "term-tl-dr", true]], "drop_missing_values() (qiime2.metadatacolumn method)": [[64, "qiime2.MetadataColumn.drop_missing_values", false]], "dry": [[2, "term-DRY", true]], "duplicate() (in module qiime2.util)": [[62, "qiime2.util.duplicate", false]], "end() (in module qiime2.plugin)": [[60, "qiime2.plugin.End", false]], "execute_examples() (qiime2.plugin.testing.testpluginbase method)": [[59, "qiime2.plugin.testing.TestPluginBase.execute_examples", false]], "file format": [[2, "term-File-Format", true]], "filter_columns() (qiime2.metadata method)": [[64, "qiime2.Metadata.filter_columns", false]], "filter_ids() (qiime2.metadata method)": [[64, "qiime2.Metadata.filter_ids", false]], "filter_ids() (qiime2.metadatacolumn method)": [[64, "qiime2.MetadataColumn.filter_ids", false]], "float (in module qiime2.plugin)": [[60, "qiime2.plugin.Float", false]], "format": [[2, "term-Format", true]], "framework": [[2, "term-Framework", true]], "galaxy": [[2, "term-Galaxy", true]], "get_action() (qiime2.sdk.context method)": [[55, "qiime2.sdk.Context.get_action", false]], "get_artifact_collection_member() (qiime2.sdk.usage.usage method)": [[61, "qiime2.sdk.usage.Usage.get_artifact_collection_member", false]], "get_available_cores() (in module qiime2.plugin.util)": [[62, "qiime2.plugin.util.get_available_cores", false]], "get_column() (qiime2.metadata method)": [[64, "qiime2.Metadata.get_column", false]], "get_data_path() (qiime2.plugin.testing.testpluginbase method)": [[59, "qiime2.plugin.testing.TestPluginBase.get_data_path", false]], "get_ids() (qiime2.metadata method)": [[64, "qiime2.Metadata.get_ids", false]], "get_ids() (qiime2.metadatacolumn method)": [[64, "qiime2.MetadataColumn.get_ids", false]], "get_metadata_column() (qiime2.sdk.usage.usage method)": [[61, "qiime2.sdk.usage.Usage.get_metadata_column", false]], "get_missing() (qiime2.metadatacolumn method)": [[64, "qiime2.MetadataColumn.get_missing", false]], "get_transformer() (qiime2.plugin.testing.testpluginbase method)": [[59, "qiime2.plugin.testing.TestPluginBase.get_transformer", false]], "get_value() (qiime2.metadatacolumn method)": [[64, "qiime2.MetadataColumn.get_value", false]], "has_missing_values() (qiime2.metadatacolumn method)": [[64, "qiime2.MetadataColumn.has_missing_values", false]], "help() (qiime2.sdk.usage.usage method)": [[61, "qiime2.sdk.usage.Usage.help", false]], "identifier": [[2, "term-Identifier", true]], "identity": [[2, "term-Identity", true]], "implementationerror() (in module qiime2.sdk)": [[24, "qiime2.sdk.ImplementationError", false]], "import_from_format() (qiime2.sdk.usage.usage method)": [[61, "qiime2.sdk.usage.Usage.import_from_format", false]], "init_artifact() (qiime2.sdk.usage.usage method)": [[61, "qiime2.sdk.usage.Usage.init_artifact", false]], "init_artifact_collection() (qiime2.sdk.usage.usage method)": [[61, "qiime2.sdk.usage.Usage.init_artifact_collection", false]], "init_artifact_from_url() (qiime2.sdk.usage.usage method)": [[61, "qiime2.sdk.usage.Usage.init_artifact_from_url", false]], "init_format() (qiime2.sdk.usage.usage method)": [[61, "qiime2.sdk.usage.Usage.init_format", false]], "init_metadata() (qiime2.sdk.usage.usage method)": [[61, "qiime2.sdk.usage.Usage.init_metadata", false]], "init_metadata_from_url() (qiime2.sdk.usage.usage method)": [[61, "qiime2.sdk.usage.Usage.init_metadata_from_url", false]], "input": [[2, "term-Input", true]], "int (in module qiime2.plugin)": [[60, "qiime2.plugin.Int", false]], "interface": [[2, "term-Interface", true]], "jobs (in module qiime2.plugin)": [[60, "qiime2.plugin.Jobs", false]], "list (in module qiime2.plugin)": [[60, "qiime2.plugin.List", false]], "load() (qiime2.metadata class method)": [[64, "qiime2.Metadata.load", false]], "load() (qiime2.plugin.citations class method)": [[54, "qiime2.plugin.Citations.load", false]], "make_artifact() (qiime2.sdk.context method)": [[55, "qiime2.sdk.Context.make_artifact", false]], "merge() (qiime2.metadata method)": [[64, "qiime2.Metadata.merge", false]], "merge_metadata() (qiime2.sdk.usage.usage method)": [[61, "qiime2.sdk.usage.Usage.merge_metadata", false]], "metadata": [[2, "term-Metadata", true]], "metadata (class in qiime2)": [[64, "qiime2.Metadata", false]], "metadata (in module qiime2.plugin)": [[60, "qiime2.plugin.Metadata", false]], "metadatacolumn (class in qiime2)": [[64, "qiime2.MetadataColumn", false]], "metadatacolumn (in module qiime2.plugin)": [[60, "qiime2.plugin.MetadataColumn", false]], "metadatafileerror (class in qiime2.metadata)": [[64, "qiime2.metadata.MetadataFileError", false]], "method": [[2, "term-Method", true]], "method() (in module qiime2.sdk)": [[24, "qiime2.sdk.Method", false]], "missing_scheme (qiime2.metadatacolumn property)": [[64, "qiime2.MetadataColumn.missing_scheme", false]], "name (qiime2.metadatacolumn property)": [[64, "qiime2.MetadataColumn.name", false]], "numeric (in module qiime2.plugin)": [[60, "qiime2.plugin.Numeric", false]], "numericmetadatacolumn (class in qiime2)": [[64, "qiime2.NumericMetadataColumn", false]], "output": [[2, "term-Output", true]], "package (qiime2.plugin.testing.testpluginbase attribute)": [[59, "qiime2.plugin.testing.TestPluginBase.package", false]], "pairwise sequence alignment": [[2, "term-Pairwise-sequence-alignment", true]], "parameter": [[2, "term-Parameter", true]], "parse_format() (in module qiime2.sdk)": [[24, "qiime2.sdk.parse_format", false]], "parse_type() (in module qiime2.sdk)": [[24, "qiime2.sdk.parse_type", false]], "payload": [[2, "term-Payload", true]], "peek() (qiime2.sdk.usage.usage method)": [[61, "qiime2.sdk.usage.Usage.peek", false]], "pipeline": [[2, "term-Pipeline", true]], "pipeline() (in module qiime2.sdk)": [[24, "qiime2.sdk.Pipeline", false]], "plugin": [[2, "term-Plugin", true]], "plugin (class in qiime2.plugin)": [[58, "qiime2.plugin.Plugin", false]], "plugin manager": [[2, "term-Plugin-Manager", true]], "pluginmanager() (in module qiime2.sdk)": [[24, "qiime2.sdk.PluginManager", false]], "pluginmethods (class in qiime2.plugin.plugin)": [[58, "qiime2.plugin.plugin.PluginMethods", false]], "pluginpipelines (class in qiime2.plugin.plugin)": [[58, "qiime2.plugin.plugin.PluginPipelines", false]], "pluginvisualizers (class in qiime2.plugin.plugin)": [[58, "qiime2.plugin.plugin.PluginVisualizers", false]], "primitive type": [[2, "term-Primitive-Type", true]], "properties (class in qiime2.plugin)": [[60, "qiime2.plugin.Properties", false]], "provenance": [[2, "term-Provenance", true]], "provenance replay": [[2, "term-Provenance-Replay", true]], "python 3 api": [[2, "term-Python-3-API", true]], "q2cli": [[2, "term-q2cli", true]], "range (class in qiime2.plugin)": [[60, "qiime2.plugin.Range", false]], "redirected_stdio() (in module qiime2.util)": [[62, "qiime2.util.redirected_stdio", false]], "register_artifact_class() (qiime2.plugin.plugin method)": [[58, "qiime2.plugin.Plugin.register_artifact_class", false]], "register_formats() (qiime2.plugin.plugin method)": [[58, "qiime2.plugin.Plugin.register_formats", false]], "register_function() (qiime2.plugin.plugin.pluginmethods method)": [[58, "qiime2.plugin.plugin.PluginMethods.register_function", false]], "register_function() (qiime2.plugin.plugin.pluginpipelines method)": [[58, "qiime2.plugin.plugin.PluginPipelines.register_function", false]], "register_function() (qiime2.plugin.plugin.pluginvisualizers method)": [[58, "qiime2.plugin.plugin.PluginVisualizers.register_function", false]], "register_semantic_type_to_format() (qiime2.plugin.plugin method)": [[58, "qiime2.plugin.Plugin.register_semantic_type_to_format", false]], "register_semantic_types() (qiime2.plugin.plugin method)": [[58, "qiime2.plugin.Plugin.register_semantic_types", false]], "register_transformer() (qiime2.plugin.plugin method)": [[58, "qiime2.plugin.Plugin.register_transformer", false]], "register_validator() (qiime2.plugin.plugin method)": [[58, "qiime2.plugin.Plugin.register_validator", false]], "register_views() (qiime2.plugin.plugin method)": [[58, "qiime2.plugin.Plugin.register_views", false]], "result": [[2, "term-Result", true]], "result() (in module qiime2.sdk)": [[24, "qiime2.sdk.Result", false]], "resultcollection() (in module qiime2.sdk)": [[24, "qiime2.sdk.ResultCollection", false]], "results() (in module qiime2.sdk)": [[24, "qiime2.sdk.Results", false]], "save() (qiime2.plugin.citations method)": [[54, "qiime2.plugin.Citations.save", false]], "semantic type": [[2, "term-Semantic-Type", true]], "semantictype() (in module qiime2.plugin)": [[60, "qiime2.plugin.SemanticType", false]], "set (in module qiime2.plugin)": [[60, "qiime2.plugin.Set", false]], "setup() (qiime2.plugin.testing.testpluginbase method)": [[59, "qiime2.plugin.testing.TestPluginBase.setUp", false]], "single-use plugin (sup)": [[2, "term-Single-Use-Plugin-SUP", true]], "singlefiledirectoryformat() (in module qiime2.plugin)": [[56, "qiime2.plugin.SingleFileDirectoryFormat", false]], "start() (in module qiime2.plugin)": [[60, "qiime2.plugin.Start", false]], "str (in module qiime2.plugin)": [[60, "qiime2.plugin.Str", false]], "teardown() (qiime2.plugin.testing.testpluginbase method)": [[59, "qiime2.plugin.testing.TestPluginBase.tearDown", false]], "test_dir_prefix (qiime2.plugin.testing.testpluginbase attribute)": [[59, "qiime2.plugin.testing.TestPluginBase.test_dir_prefix", false]], "testpluginbase (class in qiime2.plugin.testing)": [[59, "qiime2.plugin.testing.TestPluginBase", false]], "textfileformat (class in qiime2.plugin)": [[56, "qiime2.plugin.TextFileFormat", false]], "threads (in module qiime2.plugin)": [[60, "qiime2.plugin.Threads", false]], "tl": [[2, "term-tl-dr", true]], "to_dataframe() (qiime2.metadata method)": [[64, "qiime2.Metadata.to_dataframe", false]], "to_dataframe() (qiime2.metadatacolumn method)": [[64, "qiime2.MetadataColumn.to_dataframe", false]], "to_series() (qiime2.metadatacolumn method)": [[64, "qiime2.MetadataColumn.to_series", false]], "transform() (in module qiime2.plugin.util)": [[62, "qiime2.plugin.util.transform", false]], "transform_format() (qiime2.plugin.testing.testpluginbase method)": [[59, "qiime2.plugin.testing.TestPluginBase.transform_format", false]], "transformer": [[2, "term-Transformer", true]], "type": [[2, "term-Type", true]], "type_from_ast() (in module qiime2.sdk)": [[24, "qiime2.sdk.type_from_ast", false]], "typemap (class in qiime2.plugin)": [[60, "qiime2.plugin.TypeMap", false]], "typematch (class in qiime2.plugin)": [[60, "qiime2.plugin.TypeMatch", false]], "uninitializedpluginmanagererror() (in module qiime2.sdk)": [[24, "qiime2.sdk.UninitializedPluginManagerError", false]], "usageaction (class in qiime2.sdk.usage)": [[61, "qiime2.sdk.usage.UsageAction", false]], "usageaction (qiime2.sdk.usage.usage attribute)": [[61, "qiime2.sdk.usage.Usage.UsageAction", false]], "usageinputs (class in qiime2.sdk.usage)": [[61, "qiime2.sdk.usage.UsageInputs", false]], "usageinputs (qiime2.sdk.usage.usage attribute)": [[61, "qiime2.sdk.usage.Usage.UsageInputs", false]], "usageoutputnames (class in qiime2.sdk.usage)": [[61, "qiime2.sdk.usage.UsageOutputNames", false]], "usageoutputnames (qiime2.sdk.usage.usage attribute)": [[61, "qiime2.sdk.usage.Usage.UsageOutputNames", false]], "usageoutputs (class in qiime2.sdk.usage)": [[61, "qiime2.sdk.usage.UsageOutputs", false]], "usagevariable (class in qiime2.sdk.usage)": [[61, "qiime2.sdk.usage.UsageVariable", false]], "uuid": [[2, "term-UUID", true]], "validationerror (class in qiime2.plugin)": [[56, "qiime2.plugin.ValidationError", false]], "validationerror() (in module qiime2.sdk)": [[24, "qiime2.sdk.ValidationError", false]], "view": [[2, "term-View", true]], "view_as_metadata() (qiime2.sdk.usage.usage method)": [[61, "qiime2.sdk.usage.Usage.view_as_metadata", false]], "visualization": [[2, "term-Visualization", true]], "visualization (in module qiime2.plugin)": [[60, "qiime2.plugin.Visualization", false]], "visualization (type)": [[2, "term-Visualization-Type", true]], "visualization() (in module qiime2.sdk)": [[24, "qiime2.sdk.Visualization", false]], "visualizer": [[2, "term-Visualizer", true]], "visualizer() (in module qiime2.sdk)": [[24, "qiime2.sdk.Visualizer", false]]}, "objects": {"qiime2": [[64, 0, 1, "", "CategoricalMetadataColumn"], [64, 0, 1, "", "Metadata"], [64, 0, 1, "", "MetadataColumn"], [64, 0, 1, "", "NumericMetadataColumn"]], "qiime2.Metadata": [[64, 1, 1, "", "column_count"], [64, 1, 1, "", "columns"], [64, 2, 1, "", "filter_columns"], [64, 2, 1, "", "filter_ids"], [64, 2, 1, "", "get_column"], [64, 2, 1, "", "get_ids"], [64, 2, 1, "", "load"], [64, 2, 1, "", "merge"], [64, 2, 1, "", "to_dataframe"]], "qiime2.MetadataColumn": [[64, 2, 1, "", "drop_missing_values"], [64, 2, 1, "", "filter_ids"], [64, 2, 1, "", "get_ids"], [64, 2, 1, "", "get_missing"], [64, 2, 1, "", "get_value"], [64, 2, 1, "", "has_missing_values"], [64, 1, 1, "", "missing_scheme"], [64, 1, 1, "", "name"], [64, 2, 1, "", "to_dataframe"], [64, 2, 1, "", "to_series"]], "qiime2.metadata": [[64, 0, 1, "", "MetadataFileError"]], "qiime2.plugin": [[56, 0, 1, "", "BinaryFileFormat"], [60, 3, 1, "", "Bool"], [60, 3, 1, "", "Categorical"], [60, 0, 1, "", "Choices"], [54, 0, 1, "", "CitationRecord"], [54, 0, 1, "", "Citations"], [60, 3, 1, "", "Collection"], [56, 0, 1, "", "DirectoryFormat"], [60, 4, 1, "", "End"], [60, 3, 1, "", "Float"], [60, 3, 1, "", "Int"], [60, 3, 1, "", "Jobs"], [60, 3, 1, "", "List"], [60, 3, 1, "", "Metadata"], [60, 3, 1, "", "MetadataColumn"], [60, 3, 1, "", "Numeric"], [58, 0, 1, "", "Plugin"], [60, 0, 1, "", "Properties"], [60, 0, 1, "", "Range"], [60, 4, 1, "", "SemanticType"], [60, 3, 1, "", "Set"], [56, 4, 1, "", "SingleFileDirectoryFormat"], [60, 4, 1, "", "Start"], [60, 3, 1, "", "Str"], [56, 0, 1, "", "TextFileFormat"], [60, 3, 1, "", "Threads"], [60, 0, 1, "", "TypeMap"], [60, 0, 1, "", "TypeMatch"], [56, 0, 1, "", "ValidationError"], [60, 3, 1, "", "Visualization"]], "qiime2.plugin.Citations": [[54, 2, 1, "", "__iter__"], [54, 2, 1, "", "load"], [54, 2, 1, "", "save"]], "qiime2.plugin.Plugin": [[58, 2, 1, "", "register_artifact_class"], [58, 2, 1, "", "register_formats"], [58, 2, 1, "", "register_semantic_type_to_format"], [58, 2, 1, "", "register_semantic_types"], [58, 2, 1, "", "register_transformer"], [58, 2, 1, "", "register_validator"], [58, 2, 1, "", "register_views"]], "qiime2.plugin.plugin": [[58, 0, 1, "", "PluginMethods"], [58, 0, 1, "", "PluginPipelines"], [58, 0, 1, "", "PluginVisualizers"]], "qiime2.plugin.plugin.PluginMethods": [[58, 2, 1, "", "register_function"]], "qiime2.plugin.plugin.PluginPipelines": [[58, 2, 1, "", "register_function"]], "qiime2.plugin.plugin.PluginVisualizers": [[58, 2, 1, "", "register_function"]], "qiime2.plugin.testing": [[59, 0, 1, "", "TestPluginBase"], [59, 4, 1, "", "assert_no_nans_in_tables"]], "qiime2.plugin.testing.TestPluginBase": [[59, 2, 1, "", "assertRegisteredSemanticType"], [59, 2, 1, "", "assertSemanticTypeRegisteredToFormat"], [59, 2, 1, "", "execute_examples"], [59, 2, 1, "", "get_data_path"], [59, 2, 1, "", "get_transformer"], [59, 5, 1, "", "package"], [59, 2, 1, "", "setUp"], [59, 2, 1, "", "tearDown"], [59, 5, 1, "", "test_dir_prefix"], [59, 2, 1, "", "transform_format"]], "qiime2.plugin.util": [[62, 4, 1, "", "get_available_cores"], [62, 4, 1, "", "transform"]], "qiime2.sdk": [[24, 4, 1, "", "Action"], [24, 4, 1, "", "Artifact"], [24, 4, 1, "", "ImplementationError"], [24, 4, 1, "", "Method"], [24, 4, 1, "", "Pipeline"], [24, 4, 1, "", "PluginManager"], [24, 4, 1, "", "Result"], [24, 4, 1, "", "ResultCollection"], [24, 4, 1, "", "Results"], [24, 4, 1, "", "UninitializedPluginManagerError"], [24, 4, 1, "", "ValidationError"], [24, 4, 1, "", "Visualization"], [24, 4, 1, "", "Visualizer"], [24, 4, 1, "", "parse_format"], [24, 4, 1, "", "parse_type"], [24, 4, 1, "", "type_from_ast"]], "qiime2.sdk.Context": [[55, 2, 1, "", "get_action"], [55, 2, 1, "", "make_artifact"]], "qiime2.sdk.usage": [[61, 0, 1, "", "UsageAction"], [61, 0, 1, "", "UsageInputs"], [61, 0, 1, "", "UsageOutputNames"], [61, 0, 1, "", "UsageOutputs"], [61, 0, 1, "", "UsageVariable"]], "qiime2.sdk.usage.Usage": [[61, 5, 1, "", "UsageAction"], [61, 5, 1, "", "UsageInputs"], [61, 5, 1, "", "UsageOutputNames"], [61, 2, 1, "", "action"], [61, 2, 1, "", "comment"], [61, 2, 1, "", "construct_artifact_collection"], [61, 2, 1, "", "get_artifact_collection_member"], [61, 2, 1, "", "get_metadata_column"], [61, 2, 1, "", "help"], [61, 2, 1, "", "import_from_format"], [61, 2, 1, "", "init_artifact"], [61, 2, 1, "", "init_artifact_collection"], [61, 2, 1, "", "init_artifact_from_url"], [61, 2, 1, "", "init_format"], [61, 2, 1, "", "init_metadata"], [61, 2, 1, "", "init_metadata_from_url"], [61, 2, 1, "", "merge_metadata"], [61, 2, 1, "", "peek"], [61, 2, 1, "", "view_as_metadata"]], "qiime2.sdk.usage.UsageVariable": [[61, 2, 1, "", "assert_has_line_matching"], [61, 2, 1, "", "assert_output_type"]], "qiime2.util": [[62, 4, 1, "", "duplicate"], [62, 4, 1, "", "redirected_stdio"]]}, "objnames": {"0": ["py", "class", "Python class"], "1": ["py", "property", "Python property"], "2": ["py", "method", "Python method"], "3": ["py", "data", "Python data"], "4": ["py", "function", "Python function"], "5": ["py", "attribute", "Python attribute"]}, "objtypes": {"0": "py:class", "1": "py:property", "2": "py:method", "3": "py:data", "4": "py:function", "5": "py:attribute"}, "terms": {"": [0, 2, 5, 8, 9, 10, 11, 15, 16, 18, 19, 21, 26, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 42, 44, 45, 46, 48, 50, 51, 52, 53, 54, 58, 59, 60, 61, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75], "0": [9, 11, 15, 16, 26, 32, 33, 35, 47, 50, 60, 61, 62, 66, 67, 68, 70, 73, 74], "00": 15, "001": 68, "00a294c": 21, "01": [26, 68], "03d_r": 11, "04": 15, "06": 71, "07": 15, "080381": 15, "1": [0, 11, 15, 16, 18, 26, 29, 32, 34, 35, 39, 50, 60, 61, 65, 66, 67, 68, 70, 71], "10": [11, 15, 21, 26, 33, 39, 60, 61, 62, 68], "100": [46, 60, 61, 69], "100014989": 26, "11": [0, 15, 21, 47, 53, 61], "1103": 15, "12": [7, 11, 15, 21, 47, 60], "13039": 26, "14": 67, "147": 0, "15": [43, 47, 69, 71], "16": [15, 33, 48, 69], "17": 68, "171": 67, "18": [47, 70], "184": 16, "19": 0, "195": 0, "197": 0, "1970": [0, 68], "1976": 29, "1981": 0, "1990": 0, "1u24ca248454": 26, "2": [0, 2, 4, 5, 7, 9, 11, 12, 13, 15, 16, 17, 20, 24, 28, 30, 31, 32, 33, 34, 35, 37, 38, 40, 41, 42, 44, 48, 50, 51, 52, 53, 54, 57, 58, 59, 60, 61, 62, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74], "20": [10, 15, 31, 60, 69], "2016": 21, "2017": 21, "2018": 21, "2019": [0, 21], "2021": [0, 15], "2022": 61, "2023": [0, 7, 47, 53], "2024": [2, 4, 11, 33, 38, 39, 43, 45, 48, 53, 67, 68, 72, 73], "2025": 33, "207342": 26, "20px": 66, "20th": [0, 68], "21": 15, "215": 0, "21t14": 15, "22": 72, "23": [4, 45, 67, 68], "24": [21, 38], "25": [66, 69, 71], "27a5": 15, "29": 70, "2adb9": 15, "2adb9f00": 15, "2c00": 21, "2nd": 0, "3": [0, 2, 11, 15, 16, 26, 34, 46, 47, 50, 60, 61, 64, 69, 74, 75], "30": 69, "333fd63a2b4a102e58e364f37cd98b74": 21, "34b07e56": 15, "35": 69, "3611a0c1": 15, "37921": 26, "38": 15, "3rd": 44, "4": [0, 2, 9, 15, 18, 26, 33, 60, 61, 67, 68, 70], "40": 69, "403": 0, "41": 68, "410": 0, "411d": 15, "414": 21, "42": [15, 61], "42b5": 15, "4308": 15, "4322": 15, "4373b96f26689f78889caeb1fbb94090": 21, "4389a0b": 21, "44": 73, "443": [0, 68], "453": [0, 68], "45c12936": 9, "469998": 15, "48": [0, 68], "484d": 9, "4886": 21, "4b60": 9, "4e2f": 15, "4f03": 15, "5": [0, 11, 15, 16, 39, 53, 60, 61, 67, 68, 69, 70], "50": 67, "5000": 11, "51": 67, "587": 15, "5a7118c14fd1bacc957ddf01e61491b7": 21, "6": [0, 15, 61, 68, 69], "610383": 15, "62c7": 15, "64": [47, 60], "66": 70, "68": 16, "684b8b7": 21, "6dada99d0c81": 21, "7": [0, 2, 15, 18], "7a40cff7855daffa28d4082194bdf60": 21, "7zip": 10, "8": [11, 15, 21, 47, 62, 66, 68], "80": 66, "8000": 7, "81b130d538c3": 15, "85": 69, "8601": 15, "862772dbrrej": 26, "87058ae3": 15, "8dd3": 15, "9": [11, 15, 21], "90": 69, "93224813": 15, "95": 69, "98ff96bad145": 9, "999": 60, "A": [0, 2, 9, 10, 11, 15, 16, 18, 21, 24, 26, 27, 29, 32, 34, 35, 37, 43, 46, 47, 50, 52, 54, 58, 59, 60, 61, 62, 64, 65, 67, 69, 70, 72], "And": [16, 51, 67, 69, 71, 75], "As": [4, 7, 9, 11, 15, 16, 21, 29, 32, 34, 35, 38, 39, 45, 50, 53, 58, 60, 65, 66, 67, 68, 69, 70, 71, 72], "At": [5, 8, 47, 51, 58, 65, 67, 68, 69, 74], "BY": 26, "Be": 38, "But": [53, 60, 67, 68, 74], "By": [15, 19, 29, 34, 39, 50, 51, 68, 74], "For": [2, 5, 10, 11, 12, 15, 16, 18, 21, 26, 27, 29, 30, 31, 32, 33, 34, 38, 44, 45, 46, 47, 50, 51, 53, 62, 64, 66, 67, 68, 69, 70, 71, 73, 74], "If": [5, 9, 10, 12, 15, 16, 18, 19, 26, 29, 31, 32, 33, 34, 37, 38, 39, 41, 42, 43, 44, 45, 46, 47, 48, 50, 51, 53, 58, 59, 60, 61, 64, 65, 66, 67, 68, 69, 70, 71, 73, 74, 75], "In": [2, 5, 8, 10, 11, 15, 16, 19, 21, 27, 29, 32, 33, 34, 37, 39, 41, 46, 50, 51, 53, 58, 60, 64, 65, 66, 67, 68, 69, 70, 71, 73, 74], "It": [8, 9, 11, 12, 15, 16, 19, 21, 24, 26, 27, 31, 32, 33, 35, 38, 45, 46, 50, 53, 58, 60, 65, 66, 67, 68, 70, 71, 75], "NOT": 32, "No": [60, 67], "Not": [8, 16, 60], "Of": [16, 61], "On": [18, 32, 67, 74], "One": [11, 16, 31, 61, 64, 67, 68, 69, 70, 75], "Or": [18, 60, 68, 73], "That": [15, 16, 18, 31, 45, 53, 66, 67, 68, 69, 70, 71, 72, 74], "Thats": 16, "The": [0, 2, 7, 8, 10, 11, 12, 14, 16, 19, 21, 26, 28, 30, 31, 33, 34, 35, 36, 37, 38, 39, 41, 43, 44, 45, 46, 47, 50, 51, 52, 53, 54, 55, 58, 59, 60, 61, 62, 65, 66, 67, 68, 69, 70, 71, 72, 73, 75], "Then": [7, 8, 9, 29, 66, 67, 68, 69, 71, 74], "There": [2, 9, 10, 15, 16, 18, 29, 31, 33, 41, 44, 46, 50, 53, 60, 61, 67, 68, 69], "These": [2, 7, 8, 9, 10, 11, 15, 16, 18, 21, 27, 30, 32, 33, 34, 36, 46, 50, 53, 57, 60, 61, 64, 68, 69, 70, 71], "To": [7, 8, 10, 11, 16, 18, 20, 26, 29, 31, 33, 38, 43, 47, 50, 52, 53, 59, 64, 66, 67, 68, 69, 70, 71, 73, 74, 75], "Will": [24, 60], "With": [15, 21, 33, 39, 43, 65, 67], "_": [11, 18, 19, 29, 34, 46, 58, 67, 68, 70], "_0": 58, "_001": 11, "_1": [36, 51, 58, 67], "_2": [36, 65, 67], "_3": 67, "_4": 67, "__all__": 67, "__getitem__": 16, "__init__": [5, 21, 67], "__iter__": 54, "__release__": 61, "__repr__": 66, "__super__": 59, "__version__": [46, 58, 68], "_action": 70, "_align_and_summarize_output": 70, "_align_and_summarize_output_descript": 70, "_archiv": [9, 21], "_batch": 69, "_confirm_acgt_onli": 67, "_confirm_single_record": 67, "_create_seq_artifact": [65, 71], "_exampl": [65, 71], "_exit": 12, "_fn": 58, "_html_templat": [66, 74], "_l": 11, "_method": [67, 68, 69, 70], "_nw_align_default": 70, "_nw_align_input": 70, "_nw_align_input_descript": 70, "_nw_align_paramet": 70, "_nw_align_parameter_descript": 70, "_pipelin": [69, 74], "_r": 11, "_result": [18, 41], "_split_seqs_default": 69, "_tabulate_las_default": 74, "_tabulate_las_paramet": 74, "_tabulate_las_parameter_descript": 74, "_test_simple1_help": 69, "_transform": [21, 65, 67], "_transform_singlerecorddnafastaformat_to_dna": 67, "_types_and_format": 67, "_validate_": [11, 40, 53, 67], "_validate_field_": 16, "_validate_n_int": 11, "_visual": [66, 74], "_ziparch": 9, "a10d5d44": 15, "a416": 15, "a692": 15, "a6d07fc80a01": 15, "a983": 15, "a_boo": 61, "a_div_vector": 50, "aaa": 68, "aaaa": 68, "aaaaaaaagg": [66, 68], "aaaaaaaaggggcctttttttt": 68, "aaaaaaaaggtggcctttttttt": [66, 68], "aaaag": 68, "aaaaggttt": 68, "aaaattt": 68, "aaccgctggcgaa": [65, 71], "aaccggttaacacccac": [66, 68], "aaccggttggccaa": [65, 71], "abbrevi": [15, 69], "abil": [40, 67], "abl": [9, 10, 11, 15, 16, 21, 29, 38, 44, 47, 48, 61, 66, 67, 68, 70, 71, 75], "about": [2, 7, 8, 10, 11, 15, 16, 18, 29, 31, 38, 45, 46, 49, 50, 51, 53, 58, 60, 64, 65, 68, 69, 71, 73, 74, 75], "abov": [7, 8, 15, 16, 18, 21, 29, 33, 34, 39, 43, 46, 47, 50, 60, 66, 67, 68, 69, 70, 71], "absenc": 60, "abstract": [10, 15, 16, 24, 64, 71], "abstractli": 71, "ac92": 15, "acactcaccacccaattgct": 69, "acactctccacccatttgct": 69, "acactctccagccatttgct": 69, "accept": [2, 5, 16, 27, 34, 35, 37, 45, 50, 58, 68, 69], "access": [2, 9, 15, 24, 26, 34, 43, 46, 53, 58, 59, 60, 61, 64, 65, 66, 67, 68, 69, 70, 75], "accggt": [66, 68], "accggtaaccggttaacacccac": [65, 67, 68], "accggtggaaccgg": [66, 68], "accggtggaaccggtaacacccac": [65, 67, 68], "accident": [10, 15, 31, 60], "accomplish": [10, 26, 35], "accord": [16, 38, 50], "accordingli": 68, "account": 39, "accur": [11, 15], "accuraci": 34, "acgt": 67, "achiev": [10, 14, 31, 42, 53, 68, 69, 70, 75], "acid": [0, 68], "acknowledg": 5, "acronym": 2, "across": [15, 18, 21, 29, 34, 53, 64, 68, 69, 70], "act": [24, 71], "actinomycetota": 74, "action": [2, 7, 8, 9, 10, 11, 14, 16, 18, 19, 21, 28, 29, 30, 31, 35, 42, 44, 46, 50, 51, 52, 53, 55, 60, 64, 67, 69, 71, 73, 75], "action_executor_map": 18, "action_id": [50, 61, 71], "activ": [4, 8, 15, 26, 31, 33, 45, 48, 68], "actor": 8, "actual": [15, 16, 18, 31, 32, 41, 50, 51, 61, 66, 67, 68, 69, 71, 74], "ad": [9, 11, 16, 21, 29, 31, 34, 35, 37, 44, 50, 60, 65, 66, 67, 68, 69, 70, 71, 72, 74], "adapt": [8, 26, 65, 67, 69, 70, 71], "add": [7, 16, 18, 21, 38, 41, 43, 52, 58, 60, 73, 75], "add_plugin": 24, "addion": 71, "addison": 0, "addit": [2, 9, 10, 12, 15, 16, 18, 29, 33, 37, 38, 39, 45, 47, 50, 51, 58, 60, 64, 66, 67, 69, 71, 74, 75], "addition": [10, 12, 16, 31, 51, 71], "additon": 9, "address": [10, 31, 33, 43, 66, 67, 68, 70], "adequ": 10, "adher": [34, 70], "adhoc": 18, "adjust": [33, 68], "administr": [18, 19], "adopt": [16, 29, 53, 67, 68], "advanc": [10, 18, 19, 32, 33, 45], "advantag": 10, "advis": 26, "ae0d0e26da5b84a6c0722148789c51e0": 21, "ae57": 15, "afb": 15, "afford": 60, "after": [18, 29, 31, 33, 38, 41, 47, 64, 67, 68, 69, 70, 71, 73, 74, 75], "ag": [45, 51, 61], "again": [8, 29, 32, 33, 39, 44, 64, 65, 66, 68, 69, 70, 74], "against": [33, 38, 61, 67, 69], "agnost": [4, 15], "ahead": [8, 50], "aid": 26, "aim": [11, 15], "airplan": 60, "alabast": 15, "alert": 33, "alfr": 26, "algorithm": [15, 31, 34, 68, 69, 75], "alia": [15, 21, 60], "alias": 15, "align": [0, 2, 15, 21, 66, 70, 74], "align_and_summar": 70, "aligned_sequ": [68, 71], "aligned_sequence1": [66, 68], "aligned_sequence2": [66, 68], "alignedproteinsequ": 67, "alignedrnasequ": 67, "alignedsequ": [66, 68, 70], "all": [2, 7, 8, 9, 10, 11, 15, 16, 18, 19, 21, 24, 26, 29, 30, 31, 32, 33, 34, 38, 39, 45, 46, 49, 50, 51, 53, 58, 59, 60, 61, 64, 66, 67, 68, 69, 70, 71, 73, 74, 75], "alloc": 12, "allot": 69, "allow": [2, 8, 9, 10, 11, 15, 16, 18, 21, 24, 26, 29, 31, 33, 43, 46, 50, 51, 53, 58, 60, 64, 67, 68, 69, 70, 71, 74], "almost": [2, 16, 38, 74], "alon": 21, "along": [2, 29, 30, 32, 43, 69, 73, 74], "alongsid": [10, 21], "alpha": [21, 27, 35, 37, 46, 50], "alpha_divers": 37, "alpha_group_signific": 37, "alphadivers": [35, 37, 50], "alreadi": [15, 16, 19, 31, 38, 42, 43, 48, 50, 53, 67, 68, 69, 73, 74, 75], "also": [4, 8, 9, 11, 15, 16, 18, 21, 24, 26, 31, 32, 33, 38, 39, 45, 48, 50, 51, 53, 58, 59, 60, 64, 65, 66, 67, 68, 69, 70, 71, 73, 74, 75], "alter": 2, "altern": [10, 18, 43, 62, 68, 69, 70], "although": [11, 51], "altschul": 0, "alwai": [8, 9, 11, 12, 15, 16, 33, 51, 60, 61, 64, 65, 66, 67, 68, 69, 70], "am": [29, 71], "ambigu": [2, 60, 67], "amino": [0, 68], "among": [15, 67], "amongst": 51, "amount": [8, 14, 69], "ampl": 33, "amplicon": [2, 7, 33, 38, 39, 43, 51], "an": [0, 2, 4, 8, 10, 11, 12, 13, 15, 18, 19, 20, 21, 24, 26, 29, 30, 31, 33, 34, 35, 36, 37, 38, 42, 43, 44, 49, 50, 51, 53, 54, 55, 58, 59, 60, 61, 64, 65, 69, 71, 73], "an_input_filepath": 53, "an_output_filepath": 53, "anaconda": 46, "analys": [15, 71], "analysi": [2, 10, 15, 27, 34, 37, 54, 68], "analyt": [37, 67], "analyz": [45, 69], "anatomi": [10, 13, 15, 20], "ancestor": [9, 21], "ancestor_uuid": 21, "ancestr": [2, 9, 68], "andrew": 0, "angl": 8, "angri": 68, "ani": [2, 7, 8, 9, 10, 11, 12, 15, 16, 18, 19, 26, 27, 29, 30, 32, 33, 34, 38, 43, 46, 47, 50, 51, 58, 59, 60, 64, 65, 66, 67, 68, 69, 70, 71, 73, 74], "anniversari": [0, 68], "annot": [2, 16, 30, 32, 34, 35, 36, 37, 50, 51, 58, 68, 69], "announc": 45, "anoth": [2, 9, 10, 11, 12, 16, 18, 27, 29, 36, 45, 48, 51, 60, 66, 67, 69, 70, 71, 74], "answer": [12, 38, 43, 48, 73], "anti": [11, 52, 63, 67], "antipattern": 68, "anyon": [4, 16, 67], "anyth": [10, 12, 16, 19, 26, 29, 31, 32, 33, 34, 37, 41, 50, 60, 61, 66, 67, 68, 69, 71, 74], "anytim": 33, "anywai": 16, "anywher": [16, 46, 51, 70], "api": [2, 5, 8, 14, 15, 16, 23, 25, 26, 33, 34, 35, 46, 50, 52, 53, 55, 59, 61, 63, 65, 66, 67, 70, 75], "app": 53, "appar": 69, "appdir": 18, "appear": [15, 16, 53, 68, 69], "append": [35, 69], "appl": [16, 47, 60], "appli": [0, 2, 29, 31, 34, 35, 53, 58, 64, 65, 68, 70, 74, 75], "applic": [0, 18, 34, 47, 64, 68, 70, 71, 74, 75], "approach": [4, 7, 10, 15, 26, 39, 43, 44, 45, 53, 67, 69, 75], "appropri": [9, 12, 21, 30, 31, 35, 46, 50, 55, 68], "approv": 4, "april": [4, 33, 38, 45, 67], "apt": 29, "aptli": 9, "ar": [2, 4, 5, 7, 8, 9, 10, 11, 12, 14, 15, 16, 18, 19, 21, 24, 26, 27, 29, 31, 32, 33, 34, 35, 36, 37, 38, 39, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 53, 57, 58, 60, 61, 62, 64, 65, 66, 67, 68, 69, 70, 71, 73, 74, 75], "arbitrari": [15, 53, 58, 60, 67, 69, 74], "arbitrarili": 2, "arbitrary_kei": 60, "architectur": [4, 13, 20], "archiv": [2, 8, 10, 11, 13, 15, 20, 22, 26, 31], "archiveformat": 21, "area": 4, "aren": [11, 16, 21, 53, 68], "arg": [16, 18, 41, 67, 68], "argument": [8, 16, 21, 32, 50, 53, 55, 58, 60, 61, 67, 70], "argumentless": 58, "aris": [16, 31, 33, 67], "aritfact": 65, "around": [10, 29, 32, 33, 48, 61, 68, 69], "arrai": [10, 50], "arrow": [8, 21], "art": 10, "articl": [29, 31, 45, 54, 67, 68, 71], "artifact": [2, 8, 9, 10, 11, 12, 14, 15, 16, 21, 24, 27, 28, 29, 30, 34, 35, 36, 37, 42, 43, 44, 50, 52, 53, 55, 58, 60, 61, 64, 65, 66, 68, 69, 70, 71, 73, 74, 75], "artifact_collect": 61, "artifact_for_md": 61, "artifact_format": 58, "artifactapiusag": [50, 71], "artifactclass": 67, "arvum": 74, "arxiv": 45, "ask": [16, 38, 43, 45], "aspect": [10, 14, 15, 20, 49, 67, 68], "assembl": 68, "assert": [16, 50, 59], "assert_frame_equ": 69, "assert_has_line_match": [50, 61], "assert_no_nans_in_t": 59, "assert_output_typ": [50, 61], "assertequ": [65, 67, 68], "assertin": [66, 69], "assertionerror": 61, "assertnotequ": 68, "assertraisesregex": 67, "assertregisteredsemantictyp": [59, 67], "assertsemantictyperegisteredtoformat": 59, "assess": 71, "asset": [9, 46, 47, 59], "assign": [15, 16, 21, 31, 50, 51, 60, 68, 70, 71], "assist": [29, 39, 43, 47], "associ": [2, 7, 15, 16, 21, 29, 30, 31, 39, 46, 53, 58, 60, 61, 64, 65, 67, 68, 69, 70, 71, 73, 74], "assum": [10, 18, 33, 38, 39, 53, 64, 68], "assur": 60, "ast": 24, "astut": 11, "asynchron": 8, "attach": 16, "attempt": [18, 19, 50, 51, 67, 68], "attent": 38, "attribut": [24, 32, 59, 69], "attt": 68, "audienc": 8, "august": [33, 43, 48, 72], "auth": 38, "authent": 38, "author": [5, 26, 45, 61, 68, 70], "authorit": 70, "auto": 60, "autodoc": 5, "autom": [7, 29, 42, 48, 50, 52, 67, 75], "automat": [12, 15, 16, 34, 35, 37, 54, 55, 58, 67, 70, 71], "avail": [2, 8, 9, 11, 18, 26, 31, 39, 43, 44, 50, 51, 55, 57, 61, 62, 67, 68, 69, 70, 71, 74], "avoid": [7, 16, 19, 31, 43, 44, 46, 50, 53, 67, 68, 71, 75], "awai": [16, 53, 58, 67], "awar": [16, 31, 39, 48, 53, 55, 67, 69, 74], "ax": 60, "b": [0, 16, 60, 61, 68], "b733": 21, "bacillota": 74, "bacillus_a": 74, "back": [10, 15, 16, 33, 53, 62, 64, 65, 66, 67, 68, 70, 71, 72, 73, 75], "backfir": 45, "background": [67, 68], "backward": [9, 32, 44, 75], "bacteri": 31, "bacteria": 74, "bad": [53, 67], "baerheim1994effect": 58, "bag": 16, "bail": 11, "banana": [16, 60], "bar": [32, 58, 60, 61], "bar1": 61, "bar2": 61, "bar3": 61, "bar4": 61, "bar5": 61, "bar6": 61, "bar7": 61, "barcod": [11, 51], "barcode_id": 11, "base": [2, 4, 10, 11, 14, 18, 19, 24, 29, 30, 31, 33, 42, 43, 48, 51, 52, 53, 58, 60, 64, 66, 67, 68, 69, 71], "basetyp": 58, "basi": [18, 31, 33, 68], "basic": [0, 11, 15, 16, 18, 32, 33, 39, 50, 67, 68], "baz": 60, "bbe1": 9, "bdc8a": 21, "beauti": 4, "becaus": [2, 8, 9, 10, 11, 12, 15, 16, 21, 29, 31, 33, 39, 41, 50, 53, 64, 65, 66, 67, 68, 69, 70, 71, 74], "becom": [8, 11, 12, 16, 30, 33, 58, 60, 67, 69, 71], "been": [9, 16, 21, 26, 29, 30, 32, 38, 43, 53, 64, 67, 68, 69, 70, 73, 75], "befor": [7, 8, 16, 19, 31, 33, 41, 42, 43, 44, 46, 50, 51, 65, 66, 67, 68, 69, 70, 71, 74, 75], "begin": [30, 45, 48, 64, 67, 68, 70, 75], "behav": 74, "behavior": [2, 8, 35, 50, 51, 58, 60, 68, 69, 70], "behind": [15, 16, 65, 70], "being": [5, 10, 12, 15, 16, 21, 31, 34, 39, 41, 44, 51, 53, 64, 67, 68], "believ": 10, "belong": [16, 18], "below": [8, 9, 15, 18, 21, 32, 33, 39, 46, 61, 64, 67], "benchmark": 48, "beneath": 18, "benefici": 33, "benefit": [15, 53, 67, 69, 71], "best": [16, 53, 60, 67, 68, 69], "beta": [30, 34, 35, 46], "beta_phylogenet": [30, 34], "beta_result": 35, "better": [8, 10, 12, 15, 16, 31, 47, 58, 65, 67], "between": [2, 4, 7, 8, 9, 10, 11, 15, 16, 21, 24, 30, 31, 33, 34, 35, 42, 52, 53, 60, 65, 67, 69, 74], "beyond": 50, "bib": [15, 21, 34, 46, 68], "bibtex": [15, 29, 34, 46, 54, 68], "bibtext": 68, "big": [53, 69, 71], "bigger": [46, 66], "binaryfileformat": [2, 11, 56, 58], "bio": [66, 67, 68], "bioconda": [33, 39], "bioinformat": [0, 2, 67, 68, 69, 74, 75], "biol": 0, "biolog": [2, 11], "biologi": [45, 68], "biom": [11, 29, 30, 31, 50, 68], "biomv210dirfmt": 9, "biopython": 67, "birthdai": 16, "bit": [11, 16, 18, 33, 46, 60, 66, 67, 68, 69, 70], "blame": 53, "blank": [16, 60, 64], "blast": [68, 69], "blith": 16, "blob": 47, "block": [41, 50, 67, 69, 70, 74], "blue": [15, 21], "blur": 7, "bodi": [51, 66, 67], "bolyen": [0, 5, 26], "book": [26, 29, 35, 68, 71], "bool": [16, 32, 58, 59, 60, 64], "bool_dict": 32, "bool_list": 32, "boolean": [16, 60, 61, 68], "bore": 67, "both": [8, 11, 15, 16, 31, 44, 46, 50, 60, 67, 68, 69, 70, 71], "bother": 71, "bottleneck": 4, "bottom": [8, 15, 67, 68, 71], "bound": [16, 60], "boundari": 68, "bowtie2index": 67, "box": [8, 15, 21, 53, 70], "brackendb": 67, "bracket": [8, 33, 39], "brai": 35, "branch": [7, 33, 39, 60], "bray_curtis_distance_matrix": 35, "bray_curtis_emperor": 35, "bray_curtis_pcoa_result": 35, "braycurti": 35, "break": [9, 11, 16, 18, 29, 71], "breviti": 8, "brief": [45, 46, 67, 68, 74], "briefli": [18, 49, 67, 68, 69], "bring": [15, 16, 68], "broad": [16, 60], "broadli": [53, 57, 71], "broken": [15, 26, 71], "browser": [2, 7, 38, 53], "bsd": [26, 68], "bug": [15, 53, 70], "buggi": 53, "bui": 45, "build": [4, 7, 16, 26, 29, 33, 42, 43, 52, 53, 57, 67, 68, 69, 70, 73], "built": [7, 8, 10, 16, 26, 29, 42, 45, 53, 64, 66, 67, 68, 70, 74], "bunch": [43, 66, 68], "bundl": 16, "burn": 53, "busi": [11, 45, 53], "bytesio": 62, "c": [0, 16, 18, 53, 60, 61, 68], "c1": 60, "c9811bcaa3e6": 15, "cach": [7, 19, 50, 66, 67, 68, 70, 74], "cache_path": 19, "cake": 16, "calcul": [19, 27, 46], "call": [8, 9, 10, 11, 12, 16, 18, 24, 29, 30, 31, 32, 34, 35, 36, 37, 41, 46, 50, 51, 53, 58, 59, 61, 62, 66, 67, 69, 70, 71, 73, 74], "callabl": [55, 58, 61], "came": 50, "can": [2, 4, 5, 7, 8, 9, 10, 11, 12, 15, 16, 18, 19, 21, 26, 27, 29, 30, 31, 32, 33, 34, 35, 37, 38, 39, 40, 43, 45, 46, 47, 48, 49, 53, 54, 58, 59, 60, 61, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75], "cancer": [7, 26], "cannot": [2, 8, 16, 27, 37, 62, 64], "canon": [26, 61], "capabl": [2, 11], "capit": 16, "caporaso": [0, 5, 26, 39, 43, 65, 66, 67, 68, 69, 70, 71, 73, 74], "captur": [9, 21, 43, 50, 75], "care": [8, 15, 30, 31, 50, 69], "carri": [10, 16, 31, 58], "casava": 11, "casavaoneeightsinglelanepersampledirfmt": 11, "case": [2, 5, 8, 9, 11, 12, 15, 16, 29, 31, 32, 34, 39, 43, 47, 50, 51, 53, 60, 61, 64, 66, 67, 68, 69, 70, 71, 73, 74], "cast": [51, 64, 71], "cat": [60, 68], "cat1": 21, "catch": 33, "categor": [16, 60, 64], "categori": [16, 45, 48], "categorical_md_col": 51, "categoricalmetadatacolumn": [51, 64], "caught": 41, "caus": [8, 60], "caveat": [43, 75], "cc": 26, "cd": [7, 47], "cd4015db31da": 15, "cell": 51, "central": [2, 15, 48, 51, 65], "certain": [5, 10, 64, 70], "certainli": [2, 38], "chain": [15, 65, 67, 70], "chalk": 16, "challeng": [10, 67], "chan": 26, "chang": [2, 4, 7, 8, 19, 21, 26, 29, 32, 33, 38, 44, 45, 47, 50, 53, 58, 61, 66, 67, 68, 69, 70, 71, 73, 75], "changelog": 21, "channel": [33, 39], "chapter": [2, 26, 32, 42, 68, 69, 70, 74], "charact": [46, 60, 64, 66, 67, 68], "characterist": [15, 21], "charset": 66, "chart": 69, "check": [8, 9, 11, 18, 21, 31, 45, 47, 50, 51, 59, 61, 65, 66, 67, 68, 69, 71, 73], "checkbox": [16, 68], "checksum": 21, "chef": 16, "child": 12, "chloe": 0, "choic": [30, 31, 34, 38, 45, 60, 70], "choos": [10, 12, 15, 31, 44, 48, 51, 69], "chose": [15, 68, 74], "christian": 68, "christoph": 0, "ci": 47, "circl": [15, 16, 65], "circular": 44, "circumst": 53, "circumv": 53, "citabl": 45, "citat": [10, 15, 21, 34, 35, 37, 46, 52, 53, 57, 58, 63, 66, 70, 71, 73], "citation_text": 58, "citationrecord": [54, 58], "citatonrecord": 58, "cite": [2, 3, 9, 15, 21, 45, 68], "clang": 15, "clarifi": [10, 16], "class": [2, 10, 11, 15, 16, 18, 21, 24, 28, 30, 32, 34, 36, 43, 44, 49, 50, 51, 52, 53, 54, 56, 58, 59, 60, 61, 65, 66, 68, 69, 70, 71, 74, 75], "classmethod": [54, 64], "claus": [26, 64], "clean": [12, 29, 55], "cleaner": 50, "cleanup": [12, 55], "clear": [45, 68], "cleric": 15, "clever": [50, 58], "cli": 15, "click": [15, 68], "client": [15, 29], "clinic": [53, 68], "clone": [7, 47], "close": [9, 10, 16, 43, 64, 67], "closest": 74, "clunki": [50, 66, 67, 68], "cluster": [18, 31, 69], "co": 45, "code": [2, 5, 7, 8, 9, 11, 15, 21, 24, 29, 30, 33, 41, 43, 46, 50, 51, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75], "coerc": [30, 60], "cogniz": 43, "cohes": 2, "colin": 0, "colleagu": 15, "collect": [2, 13, 15, 16, 20, 21, 24, 35, 42, 50, 52, 54, 58, 64, 67, 68, 69], "collection_1": 61, "collection_2": 61, "collector": 12, "collis": 44, "color": 66, "column": [8, 16, 60, 61, 69, 74], "column_a": 61, "column_count": 64, "column_missing_schem": 64, "column_nam": 61, "column_ord": 74, "column_typ": [51, 64], "columnar": 2, "columnproperti": [60, 64], "com": [7, 15, 21, 33, 39, 46, 47], "combin": [2, 10, 11, 15, 16, 27, 34, 35, 37, 41, 50, 59], "combinator": 16, "combine_act": 69, "combine_las_report": 69, "come": [16, 27, 30, 31, 48, 53, 60, 65, 67, 68, 71, 72, 73, 74, 75], "comfort": [42, 47, 69, 73, 75], "comma": 70, "command": [2, 7, 15, 16, 27, 29, 31, 34, 38, 39, 43, 46, 47, 50, 53, 67, 68, 70, 73, 74, 75], "comment": [61, 64], "commentari": 61, "commerci": 26, "commit": [21, 29, 33, 38, 44, 67, 69, 71, 73], "common": [0, 2, 9, 10, 11, 15, 16, 21, 24, 30, 50, 53, 58, 67, 68, 70, 74], "commonli": [31, 51, 57, 68], "commun": [2, 8, 26, 33, 46, 48, 61, 70, 71], "compabl": 44, "compar": [8, 37, 58, 66, 67, 68, 70], "comparison": 37, "compat": [8, 9, 10, 24, 33, 39, 42, 46, 52, 53, 60], "complet": [7, 8, 10, 15, 16, 26, 31, 36, 38, 41, 43, 46, 58, 66, 67, 68, 69, 70, 71, 73, 75], "complex": [9, 15, 16, 46, 50, 66, 69], "complic": 74, "compon": [11, 21, 26, 29], "compos": [10, 11, 43, 60, 64, 70], "composit": [10, 15, 16, 39, 60], "compound": 16, "comprehens": 16, "compromis": [15, 16], "comput": [0, 2, 7, 10, 15, 16, 18, 31, 34, 35, 38, 41, 50, 51, 52, 53, 67, 70, 71, 73, 75], "computation": 70, "concat": 69, "concaten": 69, "concept": [31, 68], "conceptu": [60, 67], "concern": [8, 15, 26, 31, 34, 67, 68], "concis": 16, "conclud": 31, "conclus": [52, 75], "concret": [16, 51, 58, 62, 64], "concurr": 44, "conda": [2, 15, 18, 33, 38, 39, 43, 50], "conda_prefix": 18, "conda_subdir": 47, "condit": [59, 68], "confid": 53, "config": 47, "configur": [9, 11, 17, 20, 29, 48, 69, 70], "confirm": [7, 38, 45, 50, 65, 67, 68, 69, 71, 74], "conflict": [10, 33, 43], "confound": 12, "confus": [10, 31, 33], "congratul": 73, "connect": [46, 58], "consensu": 16, "consequ": [16, 60], "consid": [2, 10, 11, 15, 16, 21, 29, 43, 53, 60, 64, 67, 68, 69, 70], "consider": [16, 44, 64, 69], "consist": [9, 21, 51, 60, 64], "constrain": [16, 60], "constraint": [8, 10, 38], "construct": [8, 11, 14, 16, 18, 24, 43, 60, 64], "construct_artifact_collect": 61, "constructor": 61, "consum": [51, 53], "consumm": [15, 68], "consumpt": [2, 68], "contain": [2, 8, 9, 10, 11, 15, 16, 18, 26, 29, 31, 32, 34, 35, 37, 46, 51, 53, 54, 58, 61, 64, 67, 68, 71, 73, 74, 75], "content": [2, 4, 7, 9, 15, 31, 32, 39, 50, 64, 66, 67, 68, 72], "context": [2, 12, 15, 16, 18, 19, 29, 39, 46, 47, 52, 57, 58, 62, 63, 67, 69, 70, 71], "contigu": 60, "continu": [29, 38, 53, 67, 69, 73], "contract": 34, "contraint": 10, "contrast": [2, 9, 15, 27], "contribut": [5, 15], "contributor": 5, "control": [29, 67, 69, 70, 73], "convei": 68, "conveni": [9, 10, 16, 21, 29, 51, 53, 58, 59, 65, 66, 67], "convent": [29, 36, 46, 50, 60, 67, 68, 70, 71, 74], "convers": 30, "converst": 65, "convert": [2, 8, 10, 24, 30, 36, 58, 61, 62, 64, 65, 67, 74], "convinc": [68, 71], "cook": 16, "cookiecutt": [26, 29, 72], "cool": [29, 38, 45, 51, 53, 58, 65, 68, 69], "cool_project": 51, "coordin": [2, 8, 34], "copi": [65, 68, 73], "copyfil": 62, "copyright": 68, "core": [9, 12, 14, 15, 16, 19, 21, 35, 51, 60, 61, 62, 68, 69], "core_metr": 35, "core_metrics_phylogenet": 15, "correct": [15, 50, 53], "correctli": [53, 66], "correspond": [32, 34, 39, 60, 64, 67, 68, 74], "corrupt": 11, "cost": [16, 53], "costli": 53, "could": [10, 15, 16, 27, 31, 32, 34, 39, 45, 46, 50, 53, 58, 60, 66, 67, 68, 69, 71, 74], "couldn": [15, 53], "count": [31, 34, 66], "counter": 68, "counterpart": 16, "counterproduct": 53, "coupl": [8, 33, 53, 65, 67, 68], "courier": 66, "cours": [16, 33, 48, 68, 70], "cover": [7, 26, 46, 50], "cpu": 60, "cpu_count": 18, "crash": [41, 53], "creat": [4, 7, 9, 11, 12, 15, 16, 18, 19, 26, 29, 31, 32, 33, 38, 39, 42, 43, 44, 45, 46, 47, 50, 51, 52, 53, 55, 58, 59, 60, 61, 64, 65, 66, 67, 68, 71, 72, 74, 75], "create_pool": 19, "creation": [10, 15, 69], "creator": 67, "credit": 71, "criteria": [48, 64], "critic": [2, 70], "cron": 33, "cross": [7, 15, 53], "crude": 66, "cryptosporangium": 74, "csvdirformat": 58, "csvformat": 58, "ctx": [35, 55, 57, 58, 69, 70], "curiou": 50, "current": [4, 9, 11, 12, 15, 16, 21, 26, 32, 33, 38, 39, 43, 45, 47, 50, 62, 64], "curti": 35, "custom": [4, 15, 18, 21, 33, 73], "custom_ax": 15, "cut": 16, "cutadapt": [44, 51], "cutleri": 16, "cycl": 39, "czi": 26, "d": [0, 5, 26, 29, 33, 34, 43, 46, 66, 67, 68, 70, 71, 73], "d_001": 11, "dada2": [15, 44], "daf": 26, "daf2019": 26, "dag": 15, "dai": 26, "daniel": [0, 75], "darn": 38, "dash": [8, 46], "data": [2, 7, 8, 11, 12, 13, 16, 20, 21, 28, 30, 34, 36, 45, 51, 52, 53, 58, 59, 60, 61, 62, 64, 66, 67, 68, 69, 73, 75], "databas": 69, "datafram": [31, 51, 53, 58, 60, 61, 64, 69, 70, 74], "dataset": [7, 34], "date": [26, 33], "datetim": 15, "david": 0, "de": 32, "deal": [7, 16, 65], "debug": 33, "decemb": 53, "decentr": [10, 13, 20, 21], "decid": [8, 53, 60, 68, 70], "decis": [10, 16, 31, 69], "declar": [11, 31], "decor": [14, 16, 36, 58, 67], "decoupl": 8, "decreas": 69, "dedic": 50, "deep": [12, 15, 16], "def": [11, 30, 32, 34, 35, 36, 37, 50, 51, 53, 58, 61, 65, 66, 67, 68, 69, 70, 71, 74], "default": [15, 18, 19, 29, 33, 34, 38, 39, 51, 54, 58, 59, 61, 64, 67, 68, 69, 70, 71, 73], "default_missing_schem": 64, "defer": [8, 61], "defin": [2, 5, 8, 10, 11, 15, 18, 21, 24, 27, 29, 30, 31, 32, 33, 34, 35, 36, 37, 39, 42, 43, 47, 51, 52, 53, 58, 59, 60, 61, 64, 66, 70, 74, 75], "definit": [11, 16, 27, 32, 37, 50, 59, 67, 68, 69, 71], "defunct": 58, "degre": 34, "delai": 31, "delet": [65, 68, 73], "deliber": 59, "deliv": 10, "demonstr": [10, 58, 61, 68, 73], "demultiplex": [11, 31], "demultiplexed_seq": 21, "demutiplex": 67, "demux": 51, "denot": [2, 8], "depend": [2, 8, 9, 15, 18, 19, 21, 31, 33, 38, 39, 43, 46, 47, 50, 51, 67, 69, 70], "deploi": [44, 71], "deploy": [2, 31, 43, 44, 65, 70, 73], "deprec": [26, 58, 60], "depth": 27, "deriv": [2, 26, 68], "descend": 69, "describ": [2, 4, 8, 9, 10, 11, 15, 16, 18, 21, 29, 31, 33, 34, 35, 37, 46, 47, 50, 53, 61, 64, 65, 66, 67, 68, 69, 70, 71], "descript": [8, 9, 10, 15, 32, 34, 35, 37, 46, 53, 58, 64, 65, 66, 67, 68, 70, 74], "descriptor": [14, 16, 44, 62], "design": [9, 10, 30, 33, 64, 65, 69, 70], "desir": 61, "destin": [10, 30, 32, 62], "destroi": 12, "destruct": 12, "destructor": 12, "detail": [2, 4, 9, 10, 15, 16, 18, 21, 32, 34, 36, 40, 46, 50, 51, 57, 64, 67, 68, 69], "detect": [31, 67], "determin": [9, 10, 15, 16, 29, 30, 34, 51, 64, 66, 68, 69], "dev": [26, 29, 33, 47, 50, 66, 67, 68, 70, 74], "dev0": 47, "develop": [2, 7, 8, 10, 11, 15, 21, 25, 29, 31, 33, 36, 38, 39, 40, 41, 42, 43, 44, 45, 46, 48, 50, 51, 58, 59, 63, 64, 65, 66, 68, 69, 70, 71, 72, 73, 74, 75], "devic": 66, "df": [51, 61, 67], "diagram": 21, "dialog": [16, 53], "diataxi": [0, 71], "dict": [24, 32, 54, 58, 60, 61, 64, 68, 69, 70], "dict_of_int": 61, "dictat": [60, 61], "dictionari": [18, 24, 32, 34, 46, 50, 58, 60, 69, 70, 71, 74], "did": [65, 67, 68, 69, 70, 74], "didn": [2, 16, 41, 66, 68], "diff": 67, "differ": [2, 7, 9, 10, 11, 15, 16, 18, 19, 21, 24, 26, 31, 33, 34, 37, 39, 42, 46, 47, 52, 53, 61, 64, 65, 66, 67, 68, 69, 70, 71, 73], "differec": 53, "differenti": [11, 16, 21, 69, 74], "difficult": [10, 12, 31, 39], "digress": 67, "dillon": 0, "dimens": 34, "dine": 16, "dir": [59, 68, 73], "direct": [8, 15, 16, 33, 48, 75], "directli": [8, 10, 12, 15, 18, 21, 24, 29, 30, 31, 32, 34, 36, 50, 51, 60, 65, 67, 68, 70, 74], "directori": [2, 9, 10, 12, 13, 15, 18, 20, 21, 29, 31, 32, 33, 38, 39, 47, 50, 58, 61, 66, 68, 70, 71, 73], "directory_format": [14, 58], "directoryformat": [2, 11, 56, 58, 67], "disabl": 67, "disambigu": 31, "disassoci": 15, "discontinu": 60, "discourag": 9, "discours": 48, "discov": [15, 31, 33, 38, 45, 68, 71], "discoveri": [31, 53], "discret": 2, "discuss": [4, 7, 10, 15, 16, 26, 29, 31, 33, 40, 43, 53, 67, 68, 71, 72], "disk": [2, 10, 11, 31, 32, 61, 64, 67], "dispatch": [9, 16, 18, 21], "displai": [15, 29, 46, 50, 61, 66, 68, 73], "disregard": 50, "dissemin": 71, "distanc": [34, 35, 51, 67], "distance_matrix": [30, 34, 35], "distancematrix": [30, 34, 35, 36, 67], "distinct": [15, 16, 35, 58, 60, 68, 74], "distinguish": [2, 10, 16, 60], "distribut": [2, 7, 15, 18, 26, 33, 42, 46, 51, 52, 53, 68, 69, 73], "dive": [15, 16], "divers": [15, 27, 34, 35, 37, 44, 46, 50, 70], "diversity_lib": 50, "divid": 69, "di\u00e1taxi": [0, 26, 75], "dm": 35, "dna": [2, 11, 66, 67, 68, 69, 70, 71], "dnafastaformat": [11, 68], "dnaiter": [21, 67, 68, 69], "dnasequencesdirectoryformat": [11, 21], "do": [7, 10, 15, 16, 18, 19, 21, 26, 29, 30, 32, 34, 35, 36, 37, 38, 41, 43, 46, 48, 50, 51, 53, 58, 60, 61, 65, 66, 67, 68, 69, 70, 71, 72, 74, 75], "doc": [7, 26, 61, 64, 71], "docstr": [64, 68], "doctyp": 66, "document": [0, 6, 8, 10, 15, 16, 18, 19, 20, 21, 26, 29, 31, 32, 38, 42, 43, 46, 48, 49, 50, 53, 58, 61, 62, 64, 68, 71, 73, 75], "documentat": 71, "docx": 10, "doe": [2, 8, 9, 10, 12, 15, 16, 19, 26, 27, 29, 32, 34, 37, 45, 50, 58, 59, 60, 62, 64, 67, 68, 69, 70, 71], "doen": 9, "doesn": [11, 15, 16, 29, 31, 34, 43, 45, 47, 49, 64, 66, 67, 68, 69, 70, 71], "doi": [26, 45], "domain": [8, 16, 44, 58, 60], "don": [2, 4, 7, 10, 16, 19, 29, 33, 36, 38, 39, 45, 50, 53, 65, 66, 67, 68, 70, 71, 72, 73, 74], "done": [7, 8, 15, 18, 31, 33, 34, 38, 43, 46, 54, 61, 67, 68, 69, 70, 71, 74], "dot": 8, "doubl": 60, "doubt": 45, "down": [15, 16, 18, 67], "download": [15, 47, 53, 61, 73], "downstream": [33, 53, 74], "dozen": 16, "dr": 2, "draft": 43, "drill": 15, "driven": [2, 68], "driver": [7, 50, 58, 61, 71], "drop": 64, "drop_all_miss": 64, "drop_all_uniqu": 64, "drop_missing_valu": [51, 64], "drop_zero_vari": 64, "dropdown": 16, "dry": [2, 70, 74], "dst": 62, "dtype": 64, "due": [10, 32, 33, 69], "dull": 16, "dull_par": 16, "dummi": 53, "dummy_output": 53, "dummy_plugin": [32, 61], "dump": 16, "duplic": [9, 15, 19, 62, 71, 73, 74], "duplicate_t": [31, 68], "durat": 15, "dure": [7, 15, 19, 38, 46, 50, 53, 58, 61, 67, 68, 70], "dwq2": [4, 26, 31, 39, 46, 65, 66, 67, 68, 69, 70, 71, 73, 74], "dwq2_action": 71, "dynam": [8, 12], "e": [0, 2, 7, 9, 10, 11, 12, 15, 19, 21, 24, 26, 29, 31, 32, 33, 34, 35, 37, 38, 39, 43, 44, 45, 46, 50, 51, 53, 54, 58, 60, 61, 62, 64, 66, 67, 68, 69, 70, 71, 73, 75], "e072706": 21, "e1011676": 0, "e168": 15, "e5c5": 15, "each": [8, 9, 10, 15, 16, 21, 26, 29, 31, 33, 34, 35, 39, 43, 50, 51, 58, 60, 61, 64, 66, 67, 68, 70, 71, 75], "earli": [4, 75], "earlier": [16, 32, 67, 68, 70], "eas": [10, 15], "easi": [9, 16, 50, 67, 68, 70], "easier": [15, 16, 21, 38, 39, 43, 65, 67, 68], "easiest": [39, 50, 72, 73], "easili": [15, 18, 29, 31, 71], "eat": 16, "ebb5968ebafb": 15, "ecosystem": [33, 48, 67], "ed": 60, "ed5d": 15, "edg": 68, "edit": [0, 7, 29, 41, 53, 67, 68], "editor": 29, "effect": [8, 15, 60, 69], "effici": [31, 67], "effort": [8, 15, 53], "eigendecomposit": 34, "eigenvalu": 34, "eigenvector": 34, "eigh": 34, "either": [2, 8, 16, 19, 31, 33, 38, 43, 53, 60, 64, 67, 68, 69, 70, 73], "element": [15, 16, 18, 46, 51, 60, 61], "elev": 51, "elig": [48, 51], "elizabeth": 0, "els": [10, 29, 31, 32, 50, 67, 70], "elsevi": 68, "elsewher": [18, 53, 70], "email": [15, 48], "emp": 51, "emperor": [15, 35, 46], "emperor_plot": 35, "emploi": [44, 66], "emppairedenddirfmt": 11, "empti": [29, 32, 53, 58, 60], "en": 66, "enabl": [2, 9, 10, 15, 19, 29, 38, 41, 45, 50, 51, 65, 66, 67, 68, 69, 70, 71, 74], "enclos": 39, "encod": [9, 10, 64], "encode_miss": 64, "encount": [43, 67, 69], "encourag": [48, 58, 74], "end": [8, 15, 32, 45, 46, 60, 66, 67, 68, 70, 72, 73, 75], "endnot": 68, "energi": 69, "enforc": [16, 60, 64], "engin": [2, 53, 68, 70], "enough": [9, 16, 50, 69], "ensur": [9, 11, 12, 18, 33, 47, 50, 51, 53, 59, 66, 67, 68, 69, 71], "entir": [8, 9, 11, 12, 16, 39, 51, 58, 66, 70], "entireti": [67, 69], "entiti": [5, 10, 67], "entri": [2, 8, 29, 53, 54, 58, 60], "entry_point": [29, 46], "enumer": [8, 11, 32, 60, 69], "env": [33, 39, 47, 68], "environ": [2, 7, 10, 18, 21, 33, 38, 39, 42, 43, 50, 52, 67, 68, 71, 73, 74], "environment": 68, "epeat": 70, "epoch": [33, 39, 61], "epub": 10, "equal": [11, 16, 69], "equenc": 68, "equival": [7, 24, 60, 70], "erron": 70, "error": [10, 11, 31, 53, 61, 64, 67, 68, 74], "especi": [31, 73], "essenti": [16, 32, 46, 53, 58, 60, 67], "establish": 44, "etc": [11, 15, 16, 18, 21, 34, 46, 51], "euclidean": 51, "eval": 14, "evalu": [16, 18, 61], "evan": [0, 5, 16, 26], "evelop": 26, "even": [10, 15, 16, 29, 31, 35, 43, 50, 53, 66, 67, 68, 69], "evenness_vector": 35, "event": [15, 33, 60, 61, 68], "eventu": 41, "ever": [15, 16, 29, 37, 60, 65, 74], "everi": [9, 10, 11, 15, 37, 58, 60, 64, 68, 70, 71, 75], "everyon": [16, 45, 53], "everyth": [31, 47, 50, 53, 57, 65, 66, 67, 68, 69, 73], "everywher": 14, "evid": 69, "evil": 11, "evolut": 68, "evolv": [9, 21], "exact": 34, "exactli": [2, 10, 15, 27, 37, 50, 64, 65, 67, 68, 74], "examin": 30, "exampl": [2, 4, 7, 8, 9, 11, 12, 16, 21, 26, 27, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 41, 42, 44, 45, 46, 47, 51, 52, 53, 57, 58, 59, 60, 62, 63, 64, 65, 66, 67, 68, 69, 70, 72, 73, 75], "example1": 58, "example2": 58, "example_funct": 32, "example_function_variant1": 58, "example_function_variant2": 58, "excacerb": 12, "except": [11, 12, 15, 16, 35, 37, 42, 45, 52, 60, 66, 67, 68, 70], "excit": [51, 71], "exclud": [16, 29, 46, 60], "exclus": [44, 50, 59, 60, 70], "execut": [2, 8, 18, 19, 34, 50, 58, 59, 61, 68, 69, 70, 71, 73, 75], "execute_exampl": [50, 59, 71], "executionusag": 50, "executionusagevari": 61, "executor": 18, "executor_map": 18, "exemplifi": 31, "exercis": 69, "exist": [2, 4, 10, 11, 15, 16, 18, 19, 29, 31, 32, 34, 38, 41, 42, 44, 48, 51, 52, 53, 58, 60, 61, 62, 67, 68, 69, 73], "exit": [12, 24, 31, 41, 68, 73], "exp": 50, "exp_format": 59, "expand": [4, 7, 15, 18, 58, 66, 75], "expect": [7, 10, 11, 16, 18, 24, 26, 31, 32, 34, 37, 43, 45, 47, 50, 53, 59, 65, 66, 67, 68, 69, 71, 73], "expected_hit": 69, "expens": 70, "experi": [15, 45, 47, 69, 71], "experienc": [29, 43], "expert": 48, "expertis": [53, 71], "explain": 16, "explan": [20, 26, 29, 31, 40, 52, 67], "explanatori": 67, "explicit": 74, "explicitli": [16, 29, 32, 41, 53, 60], "explor": [26, 37, 46, 66, 70, 71], "export": [7, 51, 66, 68, 71], "expos": [11, 50, 51, 70], "express": [15, 16, 24, 50, 58, 60, 61, 71], "ext": 61, "extend": [2, 10, 32, 59, 68], "extens": [5, 33, 37, 40, 61, 67], "extension": 16, "extent": 45, "extern": [53, 58, 70], "extol": 16, "extra": [11, 16, 53, 59, 68, 74], "extract": [9, 10, 15], "extrem": 67, "f": [0, 11, 39, 50, 54, 61, 67, 74], "f1000": 45, "f6105891": 21, "f95f324": 21, "face": [50, 67, 71], "facet": 10, "facilit": [0, 7, 10, 33, 42, 43, 52, 68, 73, 74], "fact": [32, 43, 68], "facto": 32, "factori": [11, 16, 24, 60, 61, 65, 71], "factory1": 61, "factory2": 61, "fail": [8, 19, 31, 33, 53, 59, 66, 67], "failur": [31, 33, 53, 67, 68], "fair": [10, 68], "fairli": [39, 69], "faith_pd": 21, "fall": 68, "fallen": 33, "fals": [15, 36, 58, 59, 60, 64, 67, 68, 69], "familar": 74, "famili": 66, "familiar": [31, 39, 46, 50, 51, 67], "fanci": 16, "far": [16, 34, 74], "fast": 34, "fasta": [10, 11, 31, 67, 68], "faster": [7, 8, 18], "fastq": [10, 11, 31, 67], "fastqgzformat": 11, "favorit": 68, "featur": [2, 10, 27, 31, 35, 39, 50, 51, 53, 58, 60, 64, 67, 69, 71, 73, 74], "feature_data": [21, 68], "feature_t": [35, 50, 53], "feature_table1": 50, "feature_table2": 50, "feature_table3": 50, "feature_table_merge_exampl": 50, "feature_table_merge_three_tables_exampl": 50, "featuredata": [53, 66, 67, 68, 69, 70, 74], "featuret": [9, 30, 31, 34, 35, 50, 53, 73], "feb": 15, "feedback": [4, 5, 29, 72], "feel": [15, 33, 43, 45, 53, 67, 69, 71, 73], "few": [15, 16, 30, 31, 33, 35, 37, 44, 48, 49, 59, 66, 67, 70, 74, 75], "fewer": 69, "ff": [36, 58, 61, 65, 67, 71], "ff427b50aaa1": 15, "fh": [11, 36, 58, 59, 66, 67, 69, 74], "field": [15, 16, 24, 53, 54, 60, 61, 67, 68], "field_memb": [16, 60], "field_nam": [16, 60], "fifteen": 15, "fig": [9, 15, 21], "figur": [2, 8, 37, 53, 66, 67, 69], "file": [2, 8, 10, 13, 16, 20, 21, 27, 28, 29, 32, 33, 34, 36, 37, 38, 39, 46, 47, 50, 52, 53, 54, 58, 59, 61, 62, 64, 65, 66, 68, 69, 70, 71, 73, 74], "file1": 61, "file2": 61, "filecollect": 11, "fileformat": 11, "filehandl": 54, "filenam": [10, 11, 15, 21, 29, 33, 59, 67], "filepath": [18, 29, 54, 59, 60, 64, 67], "filesystem": [12, 60], "fill": 39, "fillet": 16, "filter": [7, 64, 69, 74], "filter_column": [51, 64], "filter_id": 64, "final": [8, 15, 16, 18, 37, 43, 46, 50, 51, 60, 67, 68, 69, 70, 71, 74, 75], "find": [15, 16, 18, 26, 29, 31, 35, 37, 39, 42, 45, 46, 53, 58, 60, 62, 65, 68, 69, 70, 71, 73, 74, 75], "fine": [15, 38, 43, 47, 53], "finish": 8, "first": [7, 8, 11, 16, 18, 19, 26, 29, 30, 33, 35, 37, 38, 39, 42, 43, 50, 52, 53, 55, 58, 60, 65, 67, 69, 71, 72, 73, 74], "first_memb": 61, "fish": 16, "fit": 60, "five": 15, "fix": [10, 16, 33, 53, 60, 67], "flag": [18, 19], "flake8": 47, "flavor": 27, "flexibl": [43, 66, 67, 71, 74], "flexilib": 50, "float": [16, 60, 64, 67, 68, 70], "flow": 69, "flower": 16, "fly": 11, "fn": 67, "focu": [11, 15, 26, 43, 47, 50, 67], "focus": [48, 64, 68], "fold": 74, "folk": 71, "follow": [2, 9, 10, 16, 18, 19, 21, 29, 32, 33, 34, 35, 37, 38, 39, 41, 43, 46, 47, 50, 58, 64, 65, 66, 67, 68, 69, 70, 71, 73, 74], "font": 66, "foo": [32, 58, 60, 61], "forg": [15, 33, 39], "forget": [15, 16, 68, 72], "fork": [7, 16], "form": [2, 8, 15, 16, 32, 53, 67, 68], "formal": [16, 69, 70], "format": [2, 8, 9, 10, 13, 15, 16, 20, 28, 29, 30, 33, 34, 36, 42, 43, 44, 46, 49, 50, 51, 52, 57, 58, 59, 61, 63, 64, 65, 66, 68, 69, 71, 74, 75], "format_inst": 11, "format_str": 24, "former": 43, "formerli": 2, "fortun": [12, 32], "forum": [32, 43, 46, 48, 53, 58, 67, 68, 71, 72], "forward": [11, 33, 38, 68, 70, 71, 75], "found": [5, 8, 15, 18, 21, 33, 59, 60, 65, 66, 67, 68, 69, 73, 74], "foundat": [26, 43], "four": [8, 68], "fp": 67, "fr": 0, "fraction": 69, "fragil": 66, "fragment": [21, 58, 60, 69], "framework": [0, 2, 8, 9, 11, 14, 15, 16, 21, 26, 30, 40, 44, 46, 47, 50, 51, 53, 59, 61, 68, 71], "free": [2, 15, 29, 45, 46, 48, 53, 67, 68, 69, 73], "freedom": [16, 67], "frequenc": [9, 30, 31, 33, 34, 35, 50, 53, 73], "frequent": [31, 71], "fridai": 31, "friendli": [16, 46, 68, 69], "from": [2, 4, 5, 7, 8, 9, 10, 11, 12, 15, 16, 18, 19, 21, 24, 26, 29, 30, 31, 32, 33, 34, 35, 36, 38, 39, 41, 43, 44, 45, 46, 47, 48, 50, 52, 53, 54, 55, 58, 59, 60, 61, 64, 66, 67, 68, 69, 70, 71, 72, 74, 75], "from_typ": [59, 62, 68], "front": 29, "frost": 16, "fruit": 16, "frustrat": [31, 53, 69], "fsvd": 34, "ft": 50, "ft1_factori": 50, "ft2_factori": 50, "full": [15, 18, 21, 26, 49, 66, 68, 69, 70, 71], "fulli": [7, 15, 18, 53, 70], "fun": 71, "function": [2, 4, 8, 9, 11, 15, 16, 29, 30, 31, 32, 33, 36, 40, 43, 46, 47, 50, 51, 53, 55, 58, 59, 61, 65, 67, 69, 70, 71, 74, 75], "fundament": [16, 68, 75], "funder": 26, "further": [8, 12, 15, 16, 18, 60, 64], "futur": [7, 10, 11, 18, 19, 26, 32, 41, 53, 60, 70, 71], "fuzzi": 16, "g": [9, 10, 11, 12, 15, 21, 24, 26, 29, 31, 33, 35, 37, 38, 39, 43, 44, 45, 46, 50, 51, 53, 54, 61, 64, 67, 69, 70, 71, 73, 75], "g1827eab": 47, "g7cf7a7a": 47, "g8ac7e3": 47, "gain": 64, "galaxi": [2, 53, 68, 71, 75], "game": 68, "gap": [66, 68], "gap_extend_penalti": [67, 68, 69, 70], "gap_open_penalti": [67, 68, 69, 70], "garbag": [13, 20, 53], "gatekeep": 4, "gave": 32, "gehret": 0, "gene": 69, "gener": [0, 2, 4, 7, 8, 9, 10, 11, 15, 16, 18, 19, 24, 26, 27, 29, 30, 31, 33, 34, 37, 38, 39, 44, 45, 48, 50, 53, 58, 60, 61, 65, 66, 67, 68, 69, 70, 71, 72, 74, 75], "genera": 31, "genom": 68, "genu": 74, "get": [8, 10, 15, 16, 18, 29, 32, 36, 38, 45, 46, 47, 50, 53, 59, 66, 67, 68, 69, 70, 71, 73, 74, 75], "get_act": [35, 55, 69, 70], "get_artifact_collection_memb": 61, "get_available_cor": 62, "get_column": [60, 64], "get_config_from_fil": 18, "get_data_path": [59, 67, 68], "get_id": [51, 64], "get_index_path": 69, "get_metadata_column": 61, "get_miss": 64, "get_sequence_id": 67, "get_transform": [59, 65], "get_valu": 64, "ggcctttttttt": [66, 68], "gh": [38, 73], "gish": 0, "git": [7, 33, 38, 39, 47, 68], "github": [4, 5, 7, 15, 21, 26, 39, 42, 43, 46, 47, 48, 52, 67, 71, 73], "githubusercont": [39, 47], "give": [8, 15, 16, 46, 50, 67, 70, 71], "given": [2, 10, 15, 16, 24, 31, 50, 55, 58, 60, 61, 66, 67, 68, 69], "glanc": [8, 10], "global": [15, 44, 58, 68, 70], "global_pairwise_align_nucleotid": [67, 68, 70], "glossari": 3, "go": [7, 16, 29, 33, 38, 45, 50, 53, 66, 67, 68, 69, 70, 71, 72, 73], "goal": [8, 16, 26, 31, 42, 45, 53, 65, 66, 68, 69, 70, 71, 74], "goe": [11, 15], "golden": [68, 73], "gone": 53, "good": [16, 29, 33, 46, 51, 61, 66, 67, 68, 69, 71, 72, 73], "googl": 68, "gotcha": 11, "grab": 47, "grai": 8, "grain": 15, "grammar": 16, "grant": 26, "granular": 16, "grape": 16, "graph": 15, "graphic": [2, 10, 16, 37, 53, 68], "grasp": 16, "great": [16, 50, 67, 71], "greater": [21, 60, 68], "greg": [5, 26, 45, 68], "gregcaporaso": 47, "gregori": 0, "gross": 16, "ground": 18, "groundwork": 5, "group": [2, 8, 16, 37, 69, 71], "grow": 29, "grumpi": 38, "gttt": 68, "guarante": [19, 53], "guid": [20, 26, 29, 33, 39, 40, 47, 50, 52, 71], "guidanc": [43, 75], "guidelin": [39, 71], "gz": 11, "gzip": 11, "ha": [8, 9, 10, 11, 15, 16, 21, 26, 29, 31, 33, 35, 38, 41, 43, 46, 50, 51, 53, 60, 64, 66, 67, 68, 69, 70, 73, 74, 75], "habit": 46, "hack": [47, 50], "had": [9, 16, 31, 45, 58, 66, 67, 70], "hadn": 9, "halfwai": 8, "halko2011": 34, "hand": [8, 15, 16, 31, 51, 53, 67, 74], "handl": [12, 15, 30, 32, 42, 51, 52, 53, 64, 65, 69], "happen": [15, 16, 29, 31, 34, 61, 67, 69], "happi": [16, 71, 72], "har": [49, 59], "hard": [15, 16, 31, 44, 67], "harder": 16, "hardwar": 15, "has_missing_valu": [51, 64], "hash": 16, "hassl": 33, "have": [2, 5, 8, 9, 10, 11, 12, 15, 16, 18, 21, 26, 30, 31, 32, 33, 34, 35, 38, 39, 41, 43, 44, 45, 47, 48, 50, 51, 53, 59, 60, 61, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75], "haven": [10, 16, 33, 53, 67, 68, 69], "head": [16, 59, 66], "header": 64, "hear": [5, 12, 31], "hello": [60, 61], "help": [4, 7, 10, 15, 16, 29, 31, 33, 37, 38, 39, 43, 46, 47, 48, 50, 53, 58, 61, 67, 68, 70, 71, 72, 73, 74], "helper": [59, 65, 67, 69, 71], "here": [2, 4, 7, 8, 11, 15, 16, 19, 21, 26, 29, 30, 31, 33, 34, 35, 36, 37, 38, 39, 45, 46, 47, 49, 50, 51, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74], "herman": 0, "heurist": 34, "hide": 15, "hierarchi": 16, "high": [8, 15, 46, 67, 68, 69, 70], "highest": [8, 69], "highli": [11, 53, 68, 71], "highlight": 10, "highthroughputexecutor": 18, "hint": [66, 67, 68, 71], "histor": [9, 21, 29], "histori": [2, 10, 15, 21], "hit": [69, 74], "hoc": [11, 60], "hold": [15, 16], "home": [16, 18], "homebrew": 29, "homologi": [69, 74], "honor": 71, "hood": [65, 69, 71], "hook": [14, 59, 66], "hope": [31, 45, 69], "hopefulli": [33, 67], "host": [2, 7, 15, 26, 39, 73], "hour": 31, "hous": [15, 39, 74], "how": [2, 4, 7, 8, 9, 11, 13, 15, 16, 18, 20, 26, 29, 31, 33, 34, 36, 38, 40, 43, 46, 47, 50, 52, 53, 60, 61, 64, 66, 67, 68, 69, 70, 71, 73, 74, 75], "howev": [2, 5, 8, 10, 16, 19, 39, 43, 51, 53, 67, 74], "htex": 18, "html": [7, 9, 37, 66, 69, 74], "http": [0, 7, 15, 21, 26, 33, 39, 46, 47, 61, 64, 68], "huge": [9, 31, 68], "human": [21, 34, 58, 60, 66, 67, 68, 69], "hunt": [0, 2], "hurt": 45, "hyphen": 58, "hypothes": 68, "hypothesi": [2, 68], "i": [2, 4, 5, 7, 8, 9, 11, 12, 13, 14, 16, 18, 19, 20, 21, 24, 26, 27, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 43, 44, 45, 46, 47, 49, 50, 51, 53, 54, 55, 57, 58, 59, 60, 61, 62, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75], "i_tabl": 50, "icon": [15, 21], "id": [2, 50, 51, 58, 60, 61, 64, 65, 67, 69, 71, 74], "id_count": 64, "id_head": 64, "idea": [2, 4, 7, 8, 9, 10, 16, 29, 31, 33, 45, 67, 68, 71, 74], "ideal": [7, 16, 43, 45, 58, 67, 68, 71], "ident": [2, 9, 21, 67, 68, 70], "identfii": 67, "identif": 0, "identifi": [2, 8, 15, 30, 33, 50, 51, 53, 58, 60, 61, 64, 67, 68, 69, 74], "identity_with_metadata_column_get_mdc": 50, "ids_to_keep": 64, "idx": 11, "ignor": [9, 10, 29, 53, 58, 60, 64, 68], "ignore_missing_sampl": 15, "ignore_pcoa_featur": 15, "iim": 26, "illumina": 11, "illustr": [8, 9, 16, 21, 30, 38, 43, 68, 70], "imagin": [16, 32, 50], "immedi": [45, 75], "immutablemetadata": 51, "impact": [10, 15, 31, 34, 60, 68, 69], "imped": 16, "implement": [9, 16, 32, 33, 39, 50, 53, 61, 64, 67, 68, 69, 70, 74, 75], "implementationerror": 24, "impli": [9, 18, 67, 68, 70], "implic": 68, "implicit": 60, "import": [7, 8, 10, 14, 15, 16, 18, 19, 21, 29, 31, 33, 34, 36, 44, 45, 46, 50, 53, 58, 60, 65, 66, 68, 69, 70, 71, 74], "import_data": [35, 50, 61, 65, 69, 71], "import_from_format": 61, "import_modul": 67, "importantli": [8, 15, 68, 71, 74], "importlib": 67, "imposs": [15, 31], "improv": [4, 45], "in_": 65, "inaccur": [15, 26], "inact": 8, "inadvertantli": 15, "inappropri": 31, "incident": 71, "includ": [2, 7, 9, 10, 11, 15, 16, 26, 29, 33, 34, 35, 37, 39, 45, 46, 50, 51, 53, 58, 60, 61, 64, 67, 68, 69, 70, 71, 73, 74, 75], "include_suffix": 64, "inclus": 60, "inclusive_end": [16, 60, 68], "inclusive_start": [60, 68], "incompat": [32, 75], "incomplet": [15, 53, 70], "incomprehens": 15, "inconveni": 10, "incorpor": 27, "incorrect": 31, "increas": [68, 69], "incredibli": 10, "increment": [45, 60], "incur": 68, "indent": 16, "independ": [31, 60, 67], "index": [3, 9, 37, 60, 61, 64, 66, 69, 74], "index_fp": 69, "indic": [5, 8, 15, 18, 31, 32, 34, 38, 43, 46, 47, 50, 59, 60, 64, 66, 67, 68, 69, 70, 74], "indistinct": 16, "individu": [2, 15, 29, 46, 50, 54, 64, 68, 69], "ineffect": 53, "inequ": 16, "inf": 53, "infer": [50, 51, 64, 68, 74], "infin": 60, "influenc": 34, "info": 47, "inforamt": 29, "inform": [2, 8, 9, 10, 11, 12, 14, 15, 16, 18, 21, 26, 29, 31, 33, 34, 36, 43, 45, 46, 48, 51, 58, 66, 67, 68, 69, 73, 74], "informat": 26, "infrastructur": 69, "infrequ": 65, "inher": 67, "inherit": [21, 68], "ini": 9, "init_artifact": [50, 61, 71], "init_artifact_collect": 61, "init_artifact_from_url": 61, "init_format": 61, "init_metadata": 61, "init_metadata_from_url": 61, "initi": [11, 19, 26, 29, 31, 33, 38, 50, 66, 67, 68, 75], "inject": 50, "inner": [15, 64, 74], "inplac": [69, 74], "input": [2, 8, 9, 11, 12, 15, 16, 19, 21, 27, 30, 31, 34, 35, 36, 37, 42, 50, 51, 52, 58, 59, 60, 61, 66, 67, 68, 70, 73], "input_descript": [34, 35, 37, 53, 58, 66, 68, 70], "inputtypea": 60, "inputtypeb": 60, "insdc": 64, "insert": [21, 66, 68], "insid": [10, 16, 18, 21, 34, 50, 67, 69, 74], "insight": 45, "inspect": 16, "inspir": 61, "instal": [2, 7, 10, 29, 33, 42, 43, 44, 45, 46, 50, 52, 65, 67, 71, 74], "instanc": [2, 16, 32, 34, 46, 50, 51, 58, 59, 67, 68, 70], "instanti": [18, 24, 29, 32, 34, 51, 58, 61, 67, 68, 71], "instead": [8, 12, 16, 24, 31, 35, 46, 53, 54, 58, 60, 64, 66, 68, 69, 70], "institut": 26, "instruct": [7, 10, 18, 26, 29, 33, 34, 39, 42, 43, 47, 71, 73, 75], "int": [11, 16, 32, 34, 35, 58, 60, 61, 62, 64, 69], "int_collect": 61, "int_collection6": 61, "int_collection7": 61, "int_dict": 32, "int_list": 32, "int_seq_collect": 61, "integ": [9, 11, 16, 32, 58, 60, 64], "integr": [15, 29, 41, 43, 50, 52, 69, 75], "intellig": 16, "intend": [2, 8, 24, 26, 31, 38, 47, 50, 51, 67, 68, 69, 71, 75], "intent": [2, 8, 31, 60], "intention": [9, 66], "inter": [8, 16, 68], "interact": [2, 8, 9, 16, 24, 32, 46, 51, 53, 68, 70], "interest": [11, 15, 16, 26, 29, 39, 45, 51, 58, 60, 69, 72], "interestingdataformat": 51, "interfac": [2, 4, 7, 8, 10, 11, 15, 21, 25, 26, 27, 29, 34, 38, 46, 47, 50, 51, 53, 58, 60, 61, 67, 68, 75], "intermedi": [15, 19, 27, 67], "intern": [10, 18, 31, 32, 51, 58, 61, 67, 70, 71], "interoper": 43, "interpret": [2, 9, 15, 21, 27, 45, 53, 60, 64, 69, 71], "interrupt": 69, "intersect": 60, "intervent": 7, "intial": 61, "introduc": [4, 21, 31, 38], "introduct": [0, 2, 50, 68, 69, 74], "introspect": 8, "intsequence1": [58, 61], "intsequence2": 58, "intsequenceformat": [11, 61], "intuit": [16, 68], "invalid": [11, 31, 53, 64, 67, 68], "invent": 10, "invers": 60, "invert": 16, "invest": 45, "investig": 15, "invoc": 16, "invok": [8, 12, 50, 55, 59, 61], "involv": [10, 16], "io": [54, 67], "ipython": [68, 71], "iq": 31, "is_semantic_typ": 60, "isn": [7, 11, 16, 29, 45, 59, 61, 67, 68, 69, 71, 74], "iso": 15, "issu": [12, 15, 31, 33, 43, 46, 48, 50, 67, 72], "itcr": 33, "item": [32, 68], "iter": [7, 32, 45, 54, 60, 61, 64, 68, 69], "ith": 26, "its": [2, 7, 8, 10, 11, 15, 16, 19, 21, 29, 30, 31, 32, 34, 37, 40, 46, 50, 51, 55, 58, 61, 64, 66, 67, 68, 69, 70, 71, 73, 74], "itself": [8, 9, 10, 15, 18, 32, 60, 67, 68], "iupac": 67, "j": 0, "jaccard": 35, "jaccard_distance_matrix": 35, "jaccard_emperor": 35, "jaccard_pcoa_result": 35, "januari": [7, 53], "jargon": 67, "jewel": 0, "job": [18, 31, 33, 60, 69], "join": [64, 66, 69, 72, 74], "journal": [45, 68], "journei": [0, 68], "json": [16, 24], "jsonp": 21, "juggl": 12, "jupyt": [2, 26, 71], "just": [8, 14, 15, 16, 18, 26, 29, 31, 32, 43, 45, 47, 50, 51, 53, 60, 65, 66, 67, 68, 69, 71, 73, 74], "k": 58, "keef": 0, "keep": [11, 15, 16, 29, 33, 35, 44, 66, 69], "kei": [8, 15, 21, 32, 34, 46, 50, 53, 54, 58, 60, 61, 68, 71], "kept": 74, "key1": 60, "key2": 60, "keyerror": 74, "keyword": 50, "kind": [2, 8, 11, 16, 31, 51, 67], "kishitanii": 74, "kit": 8, "kitchen": 16, "knife": 16, "knive": 16, "know": [9, 11, 16, 26, 29, 31, 38, 45, 50, 53, 66, 67, 68, 69, 71, 73, 74], "knowledg": [8, 48, 68, 70], "known": [10, 12, 16, 31, 34, 60], "kruskal1952us": 37, "kwarg": 61, "la": [69, 74], "lab": [26, 39, 43, 65, 66, 67, 68, 69, 70, 71, 73, 74], "label": [8, 16, 18, 50], "lack": 16, "lai": 5, "lane_numb": 11, "lang": 66, "languag": [10, 14, 15, 16, 31], "laptop": [69, 71], "larg": [9, 15, 31, 34, 45, 58, 67, 68, 75], "larger": [8, 60, 69], "las_act": 69, "las_result": 69, "last": [14, 16, 38, 53, 66, 67, 69, 73], "latebindingattribut": 14, "later": [8, 10, 67, 68, 73], "latest": [33, 50, 73], "latter": 43, "launch": 7, "layer": 8, "layout": [2, 10], "lead": [29, 31, 41, 53, 67], "learn": [10, 26, 29, 30, 45, 49, 68, 70, 71, 73, 75], "least": [2, 11, 18, 31, 32, 37, 53, 64, 67], "leav": [16, 29, 31, 33, 39, 66], "left": [31, 64, 74], "left_on": 74, "legal": 60, "legendrelegendr": 34, "len": [67, 74], "length": [69, 74], "lengthi": 16, "less": [8, 26, 31, 62, 67], "lesson": [66, 68], "let": [15, 16, 18, 26, 29, 35, 38, 50, 53, 60, 65, 66, 67, 68, 69, 70, 71, 73, 74, 75], "level": [8, 11, 15, 18, 29, 33, 38, 39, 42, 46, 51, 52, 53, 58, 64, 66, 67, 68, 70, 71, 73], "lib": [33, 68], "librari": [18, 33, 34, 43, 46, 50, 67, 68], "licens": 68, "life": 30, "lifetim": 12, "lift": 10, "lightli": 29, "lignment": 68, "like": [2, 7, 8, 9, 10, 11, 15, 16, 18, 19, 21, 26, 29, 31, 32, 33, 34, 35, 37, 38, 39, 41, 42, 43, 44, 46, 47, 48, 50, 51, 53, 58, 60, 61, 62, 65, 66, 67, 68, 69, 70, 71, 73, 74], "limit": [11, 15, 16, 39, 43, 44, 60], "line": [2, 7, 11, 15, 16, 21, 30, 31, 34, 38, 46, 47, 53, 58, 61, 66, 67, 68, 74], "linear": 9, "link": [5, 15, 37, 50, 62, 64, 67, 68, 69, 70], "linkcod": 5, "linux": [18, 38, 47], "lipman": 0, "list": [3, 7, 11, 14, 15, 16, 18, 21, 31, 32, 34, 35, 37, 39, 43, 46, 47, 50, 54, 58, 59, 60, 61, 67, 68, 69, 70, 72, 74], "liter": [18, 50, 58, 61], "littl": [7, 16, 46, 66, 67, 68, 73], "live": [15, 29, 43, 46, 67], "ll": [15, 16, 26, 29, 31, 33, 38, 39, 42, 47, 50, 53, 65, 66, 67, 68, 69, 70, 71, 73, 74, 75], "llm": 15, "load": [8, 11, 18, 21, 29, 31, 34, 46, 50, 51, 53, 54, 58, 59, 64, 66, 67, 68, 71, 73], "local": [0, 7, 38, 47, 50, 59, 68, 70, 73, 74], "local_alignment_search": 69, "local_pairwise_align_nucleotid": [68, 70], "localalignmentsearchresult": [69, 74], "localalignmentsearchresultsformat": 74, "localhost": 7, "localprovid": 18, "locat": [8, 12, 18, 39, 53], "log": [15, 35, 38], "logic": [9, 11, 60, 62], "login": 38, "long": [2, 8, 10, 11, 30, 31, 34, 39, 43, 58, 60, 66, 67, 68, 69], "longer": [58, 66, 67, 68, 69], "longitudin": 51, "look": [8, 9, 11, 16, 18, 21, 29, 31, 32, 33, 35, 37, 39, 41, 42, 46, 50, 51, 59, 60, 65, 66, 67, 68, 69, 70, 71, 73, 74, 75], "lookup": [61, 68], "loop": 69, "loss": 34, "lot": [16, 29, 31, 33, 45, 46, 48, 50, 53, 65, 66, 67, 69, 71, 74], "loudli": 31, "love": [5, 12, 43, 45], "lower": 64, "lsmat": 36, "lsmatformat": 36, "luck": 45, "luckili": 66, "m": [0, 7, 29, 50, 66, 67, 68, 69, 70, 71, 73], "m3": 69, "macbook": 69, "machin": [15, 16, 53, 67], "machineri": [38, 59, 67], "maco": [18, 47], "macosx": 15, "made": [10, 18, 21, 26, 31, 41, 50, 51, 61, 67, 68, 73], "magic": [29, 69], "magnitud": 34, "mai": [2, 4, 7, 8, 10, 15, 16, 18, 19, 21, 26, 29, 31, 32, 33, 34, 42, 43, 50, 51, 53, 55, 58, 60, 61, 64, 67, 68, 69, 70, 71, 73, 75], "mail": 46, "main": [16, 33, 39, 41, 64, 66, 67], "maintain": [10, 29, 33, 39, 43, 48, 50, 70, 74], "mainten": [15, 33], "major": [53, 66, 67], "make": [4, 7, 9, 10, 11, 15, 16, 18, 21, 29, 31, 32, 33, 34, 37, 38, 39, 43, 44, 45, 47, 50, 53, 58, 60, 64, 65, 66, 68, 69, 70, 71, 73, 74, 75], "make_artifact": [35, 55, 70], "makefil": 38, "manag": [2, 9, 12, 15, 18, 19, 29, 47, 53, 55, 59, 61, 62, 67, 68, 69, 70, 73], "mani": [5, 9, 10, 11, 15, 16, 21, 29, 31, 34, 37, 44, 45, 50, 51, 67, 68, 69, 70, 74], "manipul": [8, 9, 10, 60, 61, 64], "manner": [34, 51], "manual": [15, 32, 33, 50, 67], "manuscript": [2, 15, 45], "map": [18, 24, 34, 60, 61, 64, 68, 69, 71], "mapping_1": 61, "mapping_2": 61, "mappingproxytyp": 64, "march": [0, 2, 11], "mari": 0, "markdown": 26, "market": 45, "massiv": 15, "masteri": [0, 68], "match": [16, 21, 44, 46, 47, 55, 58, 60, 61, 64, 66, 68, 69, 74], "match_scor": [67, 68, 69, 70], "materi": [7, 51, 59, 61, 71], "matric": 34, "matrix": [34, 35, 67], "matter": [16, 34, 60], "matthew": 0, "max": [11, 18, 58, 67], "max_thread": 18, "max_work": 18, "maxim": [42, 52, 67], "mayb": [66, 70], "md": [21, 38, 43, 51, 60, 61, 73], "md1": 61, "md2": 61, "md3": 61, "md5": 21, "md5sum": 21, "md_for_column": 61, "me": [16, 29, 53, 66, 67, 68, 70, 71, 73], "mean": [5, 8, 9, 10, 12, 15, 16, 18, 26, 31, 39, 44, 46, 60, 67, 68, 69, 73], "meaning": [50, 53], "meaningless": 53, "meant": [2, 60], "meantim": 67, "mechan": [16, 38, 43, 53, 58], "medic": 68, "meet": [50, 64, 71], "member": [11, 16, 24, 60, 61], "memori": [2, 10, 12, 31, 64, 69], "mention": [38, 66, 67, 68, 70, 71], "menu": 16, "merg": [9, 50, 61, 64, 74], "merge_metadata": 61, "merged_t": 50, "messag": [31, 53, 58, 64, 68, 73, 74], "meta": [29, 47, 66], "metaclass": 14, "metadata": [2, 15, 16, 21, 27, 29, 35, 37, 42, 46, 50, 52, 57, 63, 65, 66, 67, 69, 71, 75], "metadata_column": 74, "metadata_index": 74, "metadatacolumn": [16, 51, 60, 64], "metadatafileerror": 64, "metagenom": [2, 33, 39, 43], "metapackag": [2, 33, 43], "metaprogram": [13, 20], "method": [0, 2, 11, 14, 15, 16, 21, 24, 27, 29, 30, 32, 35, 37, 39, 42, 44, 50, 51, 52, 53, 55, 58, 59, 61, 64, 66, 67, 70, 71, 72, 73, 74, 75], "methodnam": 59, "metric": [15, 30, 34, 35, 46], "mi": 15, "microbiom": [2, 7], "microsecond": 15, "mid": 69, "middl": 18, "might": [10, 11, 16, 31, 32, 39, 46, 47, 50, 51, 59, 61, 67, 68, 69], "migrat": 58, "miller": 0, "min": [11, 58, 67], "mind": [15, 16, 43, 44, 67, 71], "mine": [16, 67, 69, 71], "mini": 48, "miniconda": 47, "miniconda3": [47, 68], "minim": [11, 40, 41, 47, 53, 67], "minimum": 66, "minor": [41, 68], "minut": [14, 31, 65, 66, 67, 68, 69], "mirror": 15, "miscellan": [68, 73], "misdiagnos": 53, "misialq": 26, "misinform": 53, "misinterpret": 31, "mismatch": [16, 66, 68], "mismatch_scor": [67, 68, 69, 70], "miss": [31, 43, 51, 53, 64, 69, 74], "missing_id": 74, "missing_schem": [60, 64], "mission": 16, "mistak": 67, "misus": 10, "mix": [16, 75], "mode": [7, 8, 11, 47, 56, 67], "model": [11, 14, 15, 16, 53, 67], "moder": 48, "modestli": 71, "modif": [41, 67], "modifi": [21, 68, 69], "modul": [2, 5, 16, 29, 57, 58, 60, 66, 67, 68, 70, 71], "modulo": 16, "mol": 0, "molecular": [0, 68], "moment": [5, 7, 18, 49, 68], "mondai": 31, "monitor": [46, 48, 69], "monospac": 66, "month": 48, "more": [2, 4, 8, 9, 10, 11, 12, 15, 16, 18, 19, 21, 26, 27, 29, 31, 33, 34, 35, 38, 39, 40, 42, 43, 45, 46, 48, 49, 50, 51, 53, 58, 60, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75], "morn": 31, "most": [7, 8, 10, 15, 16, 26, 31, 33, 41, 44, 45, 51, 53, 58, 60, 66, 67, 68, 69, 70, 71, 75], "mostli": 67, "motiv": [10, 31], "mouth": [16, 45], "move": [7, 8, 9, 10, 18, 19, 32, 33, 47, 61, 65, 67, 68, 69, 70, 75], "mroe": 29, "msa": [66, 67, 68, 70, 71], "msa_summari": 70, "much": [8, 10, 11, 16, 31, 32, 47, 50, 61, 67, 68], "multi": [7, 69, 70], "multiindex": 74, "multipl": [7, 8, 10, 11, 15, 16, 18, 21, 24, 26, 31, 32, 39, 53, 58, 59, 60, 61, 66, 67, 68, 69, 75], "multiprocess": 12, "must": [2, 8, 11, 15, 16, 18, 21, 30, 32, 34, 35, 37, 41, 46, 50, 58, 59, 60, 61, 62, 64, 67, 68, 69, 70], "mutual": 59, "mv": 2, "my": [29, 31, 45, 50, 53, 58, 65, 66, 67, 68, 69, 70, 71, 73, 74, 75], "my_act": [53, 61], "my_artifact": 61, "my_column": 61, "my_int": 61, "my_metadata": 61, "my_method": 58, "my_pipelin": 58, "my_plugin": 61, "my_visu": 58, "my_viz": 51, "myer": 0, "mynewformat": 53, "mypi": 34, "myself": 71, "myst": 26, "n": [11, 39, 47, 69], "n_char": 67, "n_job": 35, "n_jobs_or_thread": 15, "n_less": 62, "name": [2, 8, 9, 10, 11, 15, 16, 18, 19, 21, 24, 29, 32, 33, 34, 35, 36, 37, 39, 44, 46, 47, 50, 53, 56, 58, 59, 60, 61, 64, 66, 67, 68, 69, 70, 71, 74], "namedtupl": [24, 54], "namespac": [24, 44], "nan": [59, 64], "narrow": [8, 60], "nation": 26, "nativ": 2, "natur": [60, 64, 71, 75], "navig": [38, 60], "nc": 26, "nd": 26, "nearli": 68, "neat": 29, "necessari": [10, 11, 16, 51, 57, 69], "necessarili": [8, 16, 19, 31, 48, 58], "necessit": [33, 75], "need": [4, 7, 8, 9, 10, 11, 16, 18, 24, 26, 29, 31, 32, 33, 35, 38, 39, 43, 45, 46, 47, 50, 51, 53, 58, 60, 61, 62, 65, 66, 67, 68, 69, 70, 71, 72, 74], "needleman": [0, 68, 70], "needleman1970": [68, 71], "needleman1970gener": 68, "neg": [53, 60, 68], "neither": [15, 16], "nest": [2, 8, 15, 16, 29], "network": 33, "never": [8, 16, 33, 36, 42, 53, 67, 68, 70], "new": [2, 4, 7, 9, 10, 11, 12, 15, 16, 18, 19, 21, 26, 31, 32, 33, 34, 38, 39, 40, 43, 44, 45, 46, 47, 52, 53, 55, 60, 62, 64, 66, 69, 70, 71, 72, 74, 75], "newick": [10, 31, 67], "next": [15, 18, 33, 37, 38, 45, 46, 48, 53, 67, 68, 69, 70, 71, 72, 73, 74, 75], "nexu": 67, "nice": [16, 42, 52, 71], "nicer": 66, "nih": 26, "node": [15, 67, 69], "nois": 58, "nomenclatur": 16, "non": [8, 10, 15, 18, 24, 34, 35, 50, 51, 60, 61, 67, 68], "non_definite_chars_count": 67, "none": [8, 11, 18, 24, 34, 35, 37, 50, 51, 54, 55, 56, 58, 59, 60, 61, 62, 64, 66, 67, 68, 74], "nonetheless": 16, "nonsens": 60, "nor": 15, "normal": [12, 15, 16, 35, 60, 64, 67, 68], "notabl": [10, 15], "note": [8, 15, 18, 32, 33, 38, 39, 49, 50, 58, 60, 62, 64, 65, 67, 68, 69], "notebook": [2, 15], "noth": [15, 29, 58, 60, 61, 62, 64], "notic": [11, 18, 31, 34, 48, 67, 69, 70], "notif": [31, 48, 75], "notion": 15, "noun": 2, "novemb": 0, "now": [8, 10, 11, 16, 18, 21, 26, 33, 38, 41, 43, 45, 47, 50, 60, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74], "np": [50, 64], "nucleotid": [66, 68], "null": [9, 15], "num": 60, "num1": 58, "num2": 58, "num_split": 69, "number": [8, 11, 15, 16, 18, 29, 30, 34, 46, 47, 51, 58, 60, 61, 62, 64, 68, 73, 74], "number_of_dimens": 34, "numer": [16, 60, 64], "numeric_md_col": 51, "numericmetadatacolumn": [51, 64], "numpi": 50, "nw": [66, 68, 70], "nw_align": [66, 67, 68, 71], "nw_align_act": 70, "nw_align_example_1": 71, "nwaligntest": 68, "o": [15, 32, 50, 54, 60, 62, 66, 68, 71, 73, 74], "o1": 50, "o2": 50, "ob": 59, "object": [2, 8, 12, 14, 15, 16, 18, 29, 30, 34, 35, 36, 37, 51, 52, 54, 58, 59, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 74], "obs_feat_vector": 50, "obscur": [53, 65, 67], "observ": [8, 11, 16, 35, 43, 53, 65, 66, 67, 68, 69], "observed_featur": 50, "observed_features_exampl": 50, "observed_hit": 69, "observed_index": 69, "observed_otu": 35, "observed_otus_vector": 35, "observed_viz": 69, "obtain": [51, 61, 64, 69], "obviou": 16, "obvious": [16, 45], "occur": [8, 11, 12, 15, 50, 68], "occurr": 33, "octob": [0, 21, 33], "odd": 68, "off": [12, 16, 33, 39, 45, 53, 67, 70], "offend": 44, "offens": 67, "offer": [12, 21, 48, 51], "offici": [33, 39], "often": [10, 15, 16, 29, 31, 36, 39, 53, 66, 68, 69, 71, 75], "ok": [31, 53, 66, 67], "okai": 47, "old": [7, 16, 26], "older": [9, 15, 31, 58, 73], "omiss": 60, "omit": 64, "onc": [8, 10, 11, 16, 18, 33, 34, 45, 50, 60, 65, 67, 69], "one": [2, 8, 9, 10, 11, 15, 16, 18, 21, 27, 29, 31, 32, 33, 34, 35, 36, 37, 38, 39, 41, 43, 44, 46, 49, 50, 51, 53, 58, 60, 64, 66, 67, 68, 69, 70, 71, 73, 74], "oner": 8, "ones": [43, 67, 68], "onion": 8, "onli": [2, 5, 8, 9, 11, 15, 16, 18, 21, 26, 27, 31, 34, 35, 37, 38, 43, 45, 46, 47, 51, 53, 58, 60, 61, 62, 64, 65, 66, 67, 68, 69, 70, 73, 74, 75], "onlin": [33, 45], "opaqu": 67, "open": [4, 7, 10, 11, 15, 36, 47, 51, 53, 58, 66, 67, 68, 69, 71, 74], "oper": [2, 10, 15, 16, 27, 29, 31, 51, 53, 58, 69, 74], "opinion": 11, "opportun": [51, 53, 69, 70], "oppos": [2, 47, 67, 69], "opposit": [60, 69], "opt": [69, 73], "option": [11, 15, 18, 19, 24, 33, 38, 39, 45, 46, 48, 50, 59, 60, 64, 69], "optional1": 58, "optional2": 58, "orang": 60, "orchestr": 2, "order": [10, 11, 15, 16, 18, 32, 33, 50, 58, 60, 61, 64, 68, 69, 74], "ordereddict": 54, "ordinationresult": 34, "org": [0, 7, 15, 21, 26, 33, 39, 47, 61, 64, 68], "organ": [16, 26, 39, 43, 47, 67], "orient": 58, "origin": [2, 9, 10, 21, 32, 34, 35, 37, 59, 64, 69, 74], "osx": 47, "other": [2, 4, 5, 8, 9, 10, 11, 15, 16, 26, 27, 29, 31, 32, 34, 37, 38, 39, 42, 43, 46, 52, 53, 55, 58, 59, 61, 64, 66, 67, 68, 69, 70, 71, 73, 74, 75], "other_plugin": 16, "otherwis": [11, 18, 32, 51, 58, 59, 60, 64, 73, 74], "otu": 35, "our": [4, 7, 10, 15, 16, 18, 26, 31, 39, 43, 45, 50, 53, 65, 66, 67, 70, 71, 72, 73, 74], "ourself": 70, "ourselv": [16, 68], "out": [9, 11, 14, 16, 29, 31, 33, 43, 45, 51, 53, 58, 61, 64, 66, 67, 68, 69, 70, 71, 73, 74], "outcom": [15, 31, 50, 51, 53, 68], "outdat": [15, 26, 31], "outer": 15, "outf": 53, "outlin": [33, 39, 61], "output": [2, 11, 15, 16, 21, 27, 30, 31, 34, 35, 36, 37, 42, 50, 52, 58, 60, 61, 66, 67, 68, 69, 70, 71, 73, 74], "output_descript": [34, 35, 37, 53, 58, 68, 70], "output_dir": [37, 51, 58, 66, 74], "outsid": [29, 41, 60, 68], "outweigh": 69, "over": [7, 8, 9, 11, 15, 16, 21, 31, 35, 45, 46, 54, 61, 67, 68, 69, 70], "overal": [8, 21], "overhead": 69, "overlap": [50, 60, 64], "overlap_method": 50, "overload": 31, "overrid": [18, 59, 61, 64], "overridden": 59, "overriden": 61, "oversel": 45, "oversight": 67, "overview": [13, 20], "overwrit": 62, "own": [2, 4, 7, 11, 15, 16, 18, 30, 33, 42, 43, 48, 50, 53, 55, 65, 68, 71, 72, 73, 74, 75], "owner": [33, 39], "p": [26, 50, 66, 68], "pacakg": 29, "packag": [2, 8, 14, 15, 28, 33, 34, 39, 46, 47, 52, 54, 58, 59, 66, 67, 68, 69, 71, 73], "pad": 66, "page": [5, 7, 12, 29, 38, 45, 46, 53, 61, 66, 68], "pai": [38, 53], "pain": 68, "pair": [2, 10, 30, 35, 51, 54, 60, 68], "pairedendsequenceswithqu": 11, "pairwis": [2, 51, 66, 69, 70], "panda": [31, 37, 51, 60, 61, 64, 69, 70], "paper": [16, 45, 68], "paperpil": 68, "paragraph": 15, "parallel": [7, 8, 17, 20, 29, 42, 52, 70, 75], "parallel_config": [18, 69], "parallelconfig": [18, 69], "paramet": [2, 8, 10, 15, 16, 18, 19, 24, 27, 30, 32, 34, 35, 37, 46, 47, 50, 51, 54, 58, 59, 60, 62, 64, 66, 67, 68, 69, 70, 71, 73, 74], "parameter_descript": [34, 35, 37, 51, 53, 58, 66, 68, 70], "params_only_method": 61, "paranthraci": 74, "pare": 16, "parent": 15, "parenthesi": 8, "pars": [9, 21, 31], "parse_format": 24, "parse_typ": [14, 24], "parsel": 18, "parser": [9, 21], "parsl": [18, 69], "part": [4, 11, 12, 18, 20, 26, 32, 33, 39, 40, 43, 49, 53, 57, 60, 61, 66, 67, 68, 71, 72, 74], "parti": 44, "particular": [2, 8, 9, 10, 18, 39, 51, 60, 61], "particularli": 12, "partit": 51, "pass": [2, 10, 11, 15, 19, 21, 31, 32, 33, 38, 39, 46, 47, 50, 51, 53, 60, 66, 67, 68, 69, 70, 71, 74], "passag": 8, "passthrough": 15, "past": [19, 39, 65, 68], "pastri": 16, "pastrybag": 16, "path": [5, 12, 18, 31, 32, 37, 46, 50, 53, 54, 56, 59, 60, 61, 64, 65, 66, 68, 71, 73, 74], "path_to_config": 18, "pathlib": 59, "pathlik": 54, "pathspec": 56, "pattern": [11, 29, 39, 52, 63, 67], "payload": [2, 9, 10, 11], "pcoa": [15, 34, 35], "pcoa_result": 35, "pcoaresult": [34, 35], "pd": [31, 37, 51, 53, 58, 60, 61, 64, 69, 74], "pdt": 69, "pear": 16, "peek": [61, 68, 71], "peer": 45, "pen": 16, "penalti": 68, "pencil": 16, "pend": [21, 49, 67], "peopl": [16, 29, 45, 70], "per": [10, 11, 15, 18, 31, 60, 66, 69], "percent": [69, 74], "perciev": 67, "perfect": 16, "perform": [2, 8, 9, 10, 11, 15, 16, 31, 33, 38, 40, 51, 53, 54, 61, 64, 65, 66, 67, 68, 69, 70], "permit": [10, 16, 58], "persist": [10, 11, 15], "person": [10, 16, 39, 71], "perspect": 45, "ph": 51, "phone": 53, "photobacterium": 74, "phrase": 31, "phylogenet": [15, 31, 34, 35, 67, 68], "phylogenetic_metr": 30, "phylogeni": [15, 30, 31, 34, 67], "phylum": 74, "pictur": [7, 8, 61], "piec": [2, 9, 10, 16, 70], "pielou": 35, "pielou_": 35, "pip": [7, 33, 38, 39, 43, 50], "pipelin": [2, 17, 18, 20, 21, 24, 27, 30, 42, 52, 57, 58, 63, 74, 75], "pipx": 73, "pivot": 51, "pkg_resourc": 15, "place": [10, 11, 29, 32, 48, 49, 60, 64, 67, 68, 69, 70, 74], "placehold": 49, "plai": [33, 42, 52], "plain": [10, 16], "plan": [15, 21, 31, 33, 48, 50, 53, 67, 72, 73], "platform": [15, 48], "pleas": [15, 26, 43, 45, 48, 50, 53, 67, 68], "plo": 0, "plot": [15, 35, 37], "plu": 11, "plugin": [2, 4, 5, 7, 8, 10, 11, 14, 15, 16, 19, 21, 26, 27, 28, 31, 32, 34, 35, 36, 37, 41, 42, 48, 50, 51, 54, 55, 56, 59, 60, 61, 63, 64, 65, 67, 69, 70, 71, 72, 74], "plugin_act": 19, "plugin_id": [50, 61, 71], "plugin_setup": [36, 46, 50, 66, 67, 69, 70, 71], "pluginmanag": [2, 7, 29, 61], "pluginmethod": 58, "pluginpipelin": 58, "pluginvisu": 58, "png": [15, 37], "point": [8, 9, 15, 19, 29, 37, 38, 43, 58, 60, 64, 65, 67, 68, 69, 70, 74], "poke": [29, 73], "poll": 19, "pool": 19, "popular": [45, 71], "port": [15, 26], "posit": [2, 60, 66, 67, 68], "possess": [16, 60, 61], "possibl": [9, 10, 15, 16, 19, 21, 31, 39, 50, 53, 59, 60, 62, 65, 66, 67, 68, 69, 70, 71], "possibli": [9, 15], "post": 68, "potenti": 31, "pound": 64, "power": [16, 29, 50, 67, 68, 69, 71], "pr": 33, "practic": [16, 53, 61, 66, 67, 73], "pragmat": [0, 68, 70], "pre": [29, 66], "predecessor": 21, "predefin": [2, 74], "predetermin": 16, "predic": 16, "predict": 33, "prefer": [15, 16, 29, 31, 33, 46, 50, 61, 67], "prefix": [50, 59], "prepar": [45, 61, 70, 74], "presenc": [11, 59], "present": [4, 7, 9, 11, 15, 21, 32, 34, 37, 39, 50, 59, 64, 66, 67, 68, 69, 71, 74], "preserv": [61, 64], "presum": [45, 67], "pretend": 50, "pretti": [29, 38, 69], "prevent": [10, 11, 15, 44, 67, 70], "preview": 7, "previou": [11, 15, 39, 46, 65, 66, 67, 68], "previous": [9, 21, 26, 33, 43, 67, 70], "previous_v": 11, "primari": [2, 15], "primarili": [2, 15, 26, 41], "primit": [2, 10, 13, 20, 24, 32, 34, 50, 58, 61, 68, 70], "princip": 34, "principl": [2, 10, 70, 74], "print": [16, 18, 50, 61, 71], "prior": [10, 15, 19, 21, 32, 35, 39, 51], "prioriti": [18, 45, 53], "privat": [29, 60, 67, 68], "privileg": 8, "pro": 69, "probabl": [16, 31, 45, 50, 53, 67, 69], "problem": [9, 10, 31, 33, 53, 67], "problemat": [15, 53, 69], "proce": [39, 69, 74], "proceed": 41, "process": [2, 7, 8, 12, 16, 18, 33, 38, 41, 45, 46, 50, 53, 62, 67, 68, 69, 73], "processor": 69, "procida": [0, 75], "produc": [2, 12, 15, 16, 21, 24, 27, 30, 34, 35, 37, 50, 53, 58, 60, 68, 69, 70, 71], "profession": 0, "program": 31, "programat": 15, "programm": [0, 31, 68, 70], "programmat": 16, "progress": [45, 75], "project": [5, 10, 26, 29, 34, 45, 46, 47, 53], "project_nam": 58, "prolifer": 74, "promis": 53, "promot": [4, 45], "prompt": [68, 73], "prone": 67, "proof": 10, "propag": 29, "properli": 50, "properti": [14, 51, 60, 64, 66, 67], "proport": [16, 60], "prospect": [15, 38], "protein": [0, 2, 67, 68], "protocol": 14, "prototyp": [53, 68], "proud": 45, "proven": [0, 2, 7, 8, 13, 20, 21, 35, 53, 64, 66, 69, 73, 75], "provid": [2, 4, 5, 8, 9, 10, 11, 12, 15, 16, 18, 19, 24, 26, 27, 29, 30, 31, 32, 33, 34, 35, 36, 37, 39, 40, 42, 43, 46, 47, 49, 51, 52, 54, 60, 61, 62, 64, 65, 66, 67, 68, 69, 70, 71, 73, 74, 75], "proxi": [50, 69], "pseudomonadota": 74, "psutil": 18, "public": [4, 9, 11, 24, 42, 43, 50, 52, 53, 57, 67], "publish": [31, 45, 68, 75], "pull": [7, 9, 21, 29, 33], "pull_request": 33, "punctuat": 46, "purpos": [8, 10, 16, 18, 19, 26, 51, 58, 61, 66, 68, 71, 73], "push": [12, 33, 38], "put": [29, 33, 39, 67, 68, 69, 70, 74], "py": [5, 16, 21, 46, 50, 65, 66, 67, 69, 71], "pypi": 46, "pytest": [47, 50], "python": [2, 7, 8, 12, 14, 15, 16, 29, 34, 36, 41, 46, 47, 50, 53, 54, 58, 64, 67, 69, 70, 75], "python3": 68, "q": [26, 69], "q1": 69, "q2": [15, 21, 27, 30, 31, 36, 39, 44, 46, 47, 49, 50, 51, 58, 65, 66, 67, 68, 69, 70, 71, 73, 74], "q2_divers": [30, 34, 35, 37, 46], "q2_dwq2": [66, 67, 68, 69, 70, 71], "q2_feature_t": 50, "q2_type": [21, 34, 68], "q2cli": [2, 15, 47, 50, 67, 71, 75], "q2dev": 47, "q2galaxi": 71, "q2view": 15, "qiim": [0, 2, 4, 5, 7, 9, 11, 12, 13, 15, 16, 17, 20, 21, 24, 28, 30, 31, 32, 33, 34, 35, 37, 38, 40, 41, 42, 44, 48, 50, 51, 52, 53, 54, 57, 58, 59, 60, 61, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74], "qiime2": [2, 5, 7, 9, 11, 12, 14, 15, 16, 18, 19, 21, 24, 26, 29, 33, 34, 37, 39, 46, 47, 49, 50, 51, 53, 54, 56, 57, 58, 59, 60, 61, 62, 64, 65, 66, 67, 68, 69, 70, 71, 73, 74], "qiime2_config": 18, "qual": 31, "qualiti": [31, 68], "quantit": 45, "queri": [51, 64, 69, 74], "query_seq": 69, "query_sequ": 69, "query_sequences_art": 69, "query_split": 69, "question": [8, 9, 11, 38, 43, 46, 48, 50, 51, 67, 73], "quick": [2, 11, 66, 67], "quickli": [11, 31, 45, 67, 71], "quiet": [31, 68, 73], "quietli": 31, "quit": 46, "quot": 75, "qza": [10, 15, 31, 32, 50, 67, 68, 71], "qzv": [7, 10, 15], "r": [0, 7, 11, 16, 34, 53, 61, 66, 67, 69, 70], "r1": 69, "r2": 69, "r3": 69, "race": 45, "raii": 12, "rais": [11, 16, 24, 41, 58, 59, 61, 64, 67, 74], "ram": [31, 69], "ran": [15, 66, 69, 71], "random": 9, "randomli": 2, "rang": [34, 35, 60, 67, 68, 69], "rank": 58, "rare": 60, "rarefi": [27, 35, 67], "rarefied_t": 35, "rather": [7, 15, 16, 18, 31, 33, 44, 45, 53, 66, 67, 68, 71], "raw": [39, 47, 67], "re": [2, 4, 5, 7, 10, 15, 16, 18, 26, 29, 33, 34, 38, 39, 42, 44, 45, 47, 50, 53, 65, 66, 67, 68, 69, 70, 71, 73, 74, 75], "reach": [32, 43, 45, 48, 50, 53, 67], "read": [2, 8, 9, 11, 16, 18, 26, 29, 32, 33, 36, 53, 64, 65, 66, 67, 68, 69, 71, 72, 75], "read_csv": 58, "read_numb": 11, "readabl": [34, 66, 69], "reader": [8, 26, 38, 68], "readi": [7, 8, 34, 38, 45, 65, 67, 68, 69, 71, 73, 74], "readiab": 0, "readm": [38, 43, 73], "real": [15, 16, 26, 50, 52, 61, 69, 73, 74, 75], "realiti": 53, "realiz": [31, 60], "realli": [7, 12, 14, 71, 74], "reason": [10, 15, 31, 41, 53, 67, 70, 73, 74], "reassign": 68, "recal": [65, 67, 74], "receiv": [8, 16, 35, 53, 58, 60, 67, 69, 74, 75], "recent": [7, 10, 16, 31, 33, 38, 67], "reciev": 67, "recip": [29, 47], "recogn": [16, 29, 60, 68], "recommend": [7, 11, 16, 33, 38, 45, 47, 51, 58, 67, 68, 69, 71, 73], "reconsid": 68, "record": [8, 10, 11, 15, 21, 67, 68, 73, 75], "record_map": 11, "recreat": 15, "recur": 53, "recycl": [7, 19, 69], "recycle_": 19, "redesign": 4, "redirect": 62, "redirected_stdio": 62, "reduc": [15, 34, 43, 53, 67, 69], "redund": 15, "ref": [15, 21, 74], "refactor": [65, 69], "refer": [2, 4, 7, 9, 15, 20, 23, 26, 29, 31, 32, 33, 34, 39, 40, 43, 45, 46, 49, 50, 51, 52, 65, 66, 67, 68, 69, 70, 71, 73, 74], "referenc": [18, 29, 32, 39, 68], "reference_metadata": 74, "reference_seq": [69, 74], "reference_sequ": 69, "reference_sequences_art": 69, "referenti": 9, "reflect": [15, 31, 39], "reformat": 9, "refresh": [50, 66, 67, 68, 70, 74], "refus": 16, "regard": [31, 34, 45], "regardless": [15, 31, 39, 45, 64], "regex": 61, "regist": [2, 8, 10, 11, 15, 16, 21, 27, 29, 30, 31, 42, 44, 51, 52, 53, 55, 58, 59, 65, 74], "register_artifact_class": [58, 67], "register_format": [58, 67], "register_funct": [30, 32, 34, 35, 37, 50, 51, 53, 58, 66, 67, 68, 69, 70, 71], "register_semantic_typ": [16, 58, 67], "register_semantic_type_to_format": 58, "register_transform": [36, 51, 58, 65, 67], "register_valid": 58, "register_view": 58, "registr": [11, 15, 30, 32, 46, 49, 50, 51, 52, 57, 60, 63, 68, 69, 70, 71, 74], "regroup": 51, "regular": [60, 61], "regularli": 33, "reimplement": 50, "reindex": 74, "reinstal": 50, "rel": [15, 29, 33, 53, 54, 61, 64, 67, 68, 69, 74], "relat": [2, 8, 9, 10, 15, 16, 18, 29, 38, 48, 67, 68, 75], "relationship": [16, 31], "releas": [7, 21, 32, 33, 39, 43, 47, 50, 73], "relev": [4, 8, 15, 21, 26, 29, 31, 33, 39, 43, 46, 47, 51, 67, 68, 71, 74], "reli": [33, 39], "reliabl": 15, "relianc": 15, "remain": [15, 16, 21, 26, 33, 38, 69], "rememb": [15, 16, 68, 74], "remind": [39, 71], "remot": [33, 53], "remov": [4, 11, 18, 19, 51, 64, 67, 68, 74], "renam": [2, 29], "render": [7, 50, 51, 61, 71], "reorgan": [29, 67], "repair": 15, "repeat": [2, 9, 16], "repercuss": 53, "repetit": 49, "replac": [43, 45, 58, 62, 66, 68, 71], "replai": [0, 2, 7, 15, 53, 75], "replay": 53, "repo": [33, 38], "report": [68, 69], "repositori": [7, 26, 29, 33, 38, 39, 47, 50, 68], "repr": 66, "repres": [2, 9, 10, 11, 15, 16, 21, 24, 31, 51, 58, 60, 61, 64, 67, 68, 69, 74], "represent": [2, 9, 11, 15, 16, 21, 31, 37, 51, 60, 66, 70], "reproduc": [0, 10, 15, 53], "reproduct": 15, "request": [7, 8, 10, 21, 29, 31, 33, 43, 45, 48, 51, 59, 62, 64, 67, 68, 69, 73], "requir": [7, 8, 11, 15, 16, 18, 29, 30, 32, 33, 35, 37, 38, 41, 46, 47, 49, 50, 53, 55, 60, 64, 66, 67, 68, 69, 70, 71, 73], "rerun": 19, "research": [15, 26], "reserv": 16, "reset": 59, "reset_index": 74, "resolut": 60, "resolv": [5, 41, 43], "resourc": [7, 12, 18, 29, 48, 60, 69, 70], "respect": [5, 15, 19, 21, 29, 31, 60, 64, 68, 70], "respons": [2, 8, 9, 12, 43, 45, 48, 53, 73], "rest": [9, 18], "restart": 69, "restrict": [8, 29, 45, 47, 51, 64, 74], "result": [2, 7, 8, 9, 15, 18, 19, 21, 24, 26, 31, 32, 34, 35, 37, 41, 45, 50, 51, 53, 58, 59, 60, 64, 65, 66, 67, 68, 69, 70, 71, 73, 74], "result1": 41, "result2": 41, "result_as_str": 59, "resultcollect": [24, 61], "resulttypea": 60, "resulttypeb": 60, "resumpt": [17, 20], "retain": [59, 64], "retract": [53, 68], "retriev": [61, 64, 70], "retrospect": [2, 10, 13, 20], "return": [2, 8, 11, 16, 21, 24, 31, 34, 35, 36, 37, 38, 41, 50, 51, 53, 54, 55, 58, 59, 60, 61, 62, 64, 65, 66, 67, 68, 69, 70, 71], "reus": [10, 19, 24, 43, 69, 74], "revers": [11, 69], "review": [10, 15, 16, 43, 45, 65, 66, 67, 68, 69, 74], "revis": [29, 68], "rewrit": 14, "rfc": 2, "rich": [8, 10, 16, 71], "right": [8, 16, 43, 50, 53, 64, 67, 68, 75], "right_on": 74, "rightli": 70, "risk": 53, "rm": 68, "rna": [2, 67, 68], "robust": [12, 16], "role": 65, "root": [2, 9, 15, 21, 30, 31, 34, 50, 67], "root_uuid": 21, "rough": 8, "roughli": [10, 29, 69], "round": [8, 65, 69], "roundtripp": 64, "row": [60, 64], "rrna": 67, "rstrip": 11, "rule": [10, 15, 16, 32, 60], "run": [2, 7, 11, 15, 18, 19, 21, 29, 31, 33, 38, 41, 43, 45, 47, 48, 50, 53, 59, 65, 66, 67, 68, 70, 71, 74, 75], "runner": 59, "runtest": 59, "runtim": [9, 14, 15, 67, 69], "s1": [50, 60, 68], "s2": [50, 68], "s3": 50, "s42": 61, "s_": 11, "s_l": 11, "sai": [16, 31, 70], "said": [45, 68], "sake": [47, 69], "same": [8, 10, 15, 16, 18, 21, 24, 31, 32, 33, 35, 37, 39, 44, 45, 46, 50, 53, 60, 64, 65, 66, 67, 69, 70, 71, 73, 74], "sampl": [2, 10, 11, 15, 21, 27, 31, 35, 37, 46, 60, 61, 64, 74], "sample_id": [11, 50], "sampledata": [11, 31, 35, 37, 50], "sampling_depth": [15, 35], "sapienn": 49, "satisfi": 16, "saul": 68, "save": [8, 9, 10, 11, 15, 19, 21, 51, 53, 54, 58, 64, 66, 68, 69, 71], "scale": [18, 66], "scene": 65, "schedul": 33, "schema": 9, "scheme": [9, 15, 19, 64], "scholar": 68, "scienc": [2, 26], "scientif": 53, "scientist": [10, 29, 33], "scikit": [66, 67, 68], "scipi": 34, "scope": [15, 24, 29, 50, 71], "score": [61, 68, 69, 74], "scratch": [26, 38], "script": 15, "sdk": [2, 7, 8, 12, 14, 18, 24, 50, 61, 68, 69, 70], "search": [0, 43, 48, 60, 64, 67, 68], "search_and_summarize_pipelin": 69, "searchabl": 51, "searchandsummarizetest": 69, "second": [15, 16, 18, 35, 39, 52, 58, 60, 66, 67, 69, 71, 75], "section": [10, 15, 16, 18, 21, 26, 53, 57, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74], "see": [2, 8, 9, 10, 11, 15, 16, 21, 26, 29, 30, 31, 34, 35, 37, 38, 43, 45, 46, 47, 48, 49, 50, 58, 60, 62, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74], "seek": [10, 12], "seem": [8, 16, 31, 45, 48, 68], "seen": [8, 9, 11, 61, 73], "select": [7, 15, 16, 38, 53], "self": [9, 10, 11, 15, 16, 53, 65, 66, 67, 68, 69, 71], "sell": 45, "semant": [2, 8, 10, 11, 13, 20, 21, 24, 28, 34, 36, 44, 49, 52, 58, 59, 61, 75], "semantic_express": 58, "semantic_typ": [58, 59, 61], "semantictyp": [16, 32, 60, 67], "semat": [11, 67], "send": [29, 69], "sens": [10, 16, 29, 31, 43, 66, 69, 70], "sentenc": 65, "separ": [15, 34, 46, 74], "seper": 16, "sept": 39, "septemb": 0, "seq": [65, 67, 68, 69, 71], "seq1": [65, 67, 68, 70, 71, 74], "seq1_factori": [65, 71], "seq2": [65, 67, 68, 70, 71, 74], "seq2_factori": [65, 71], "seq3": 74, "seq_num": 67, "sequenc": [0, 2, 8, 10, 11, 31, 65, 66, 67, 70, 71, 74], "sequence1": 68, "sequence2": 68, "sequences_path_mak": 11, "sequenceswithqu": 31, "seri": [26, 37, 38, 60, 64, 71], "serial": [9, 64, 67], "seriou": 68, "serv": [9, 12, 26, 50], "server": [7, 45, 53, 66], "session": 68, "set": [7, 8, 9, 11, 16, 18, 21, 29, 32, 33, 34, 42, 43, 45, 51, 52, 58, 59, 60, 61, 64, 66, 67, 68, 69, 70, 71, 73, 74], "set_index": [69, 74], "set_path_mak": 11, "setup": [18, 46, 59, 69], "setupi": 29, "setuptool": [29, 46], "sever": [2, 18, 37, 44, 46, 59, 60, 69, 74], "sha1": 19, "shannon": 35, "shannon_vector": 35, "shape": 68, "share": [4, 10, 15, 21, 24, 39, 43, 45, 64, 69, 70, 73, 75], "sharp": 16, "sharp_fillet": 16, "sharpen": 16, "shell": 71, "short": [36, 58, 66, 70], "short_descript": [46, 58], "shortcut": 70, "shorthand": 60, "shortli": [68, 75], "shotgun": 2, "should": [8, 10, 11, 12, 15, 16, 18, 19, 24, 26, 29, 31, 33, 34, 35, 37, 38, 39, 43, 45, 46, 47, 48, 50, 51, 53, 58, 60, 61, 64, 66, 67, 68, 70, 71, 73, 74, 75], "shouldn": [11, 29, 31, 67, 68, 74], "show": [14, 16, 21, 45, 50, 68, 73, 74, 75], "shown": [8, 15, 18, 21, 32, 46], "shred": 16, "shutil": 62, "side": [50, 59, 69], "signatur": [14, 24, 34, 37, 61, 67, 68, 69, 70, 74], "signific": [14, 21], "silenc": [68, 73], "silicon": [26, 47], "silli": [16, 67, 73], "silvers1997effect": 58, "similar": [0, 16, 24, 27, 33, 35, 37, 39, 60, 66, 68, 69, 70, 71, 74], "similarli": [26, 31, 67, 68], "simpl": [9, 15, 16, 32, 46, 50, 54, 60, 66, 67, 68, 69, 70, 73, 74], "simpler": [15, 16], "simplest": [11, 69], "simpli": [9, 15, 16, 18, 32, 51, 53, 68, 69], "simplifi": [9, 15, 45, 46, 49, 59, 65, 67, 70], "simultan": [16, 18, 60], "sinc": [16, 29, 31, 37, 44, 48, 53, 58, 65, 66, 67, 68, 69, 74, 75], "singl": [2, 7, 9, 10, 15, 16, 21, 27, 29, 31, 32, 35, 37, 39, 44, 46, 50, 51, 58, 59, 64, 66, 67, 68, 69, 70, 71, 74], "singlednasequ": [31, 65, 67, 70, 71], "singlednasequencetest": 67, "singlednasequencetransformertest": 67, "singlefiledirectoryformat": [11, 56, 58, 67], "singleint": [32, 61], "singlelanepersamplepairedendfastqdirfmt": 21, "singlerecorddnafastadirectoryformat": [65, 67], "singlerecorddnafastaformat": [67, 71], "singlerecorddnafastaformattest": 67, "singleton": [2, 58], "singular": 32, "site": [15, 51, 68, 73], "situat": [9, 11, 16, 19, 58, 61], "size": [15, 68], "skbio": [30, 34, 36, 66, 67, 68, 69, 70, 71], "skd": 14, "skip": [11, 50, 67], "sklearn_n_jobs_descript": 35, "slate": [18, 19, 26], "sleev": 16, "sloan": 26, "slow": [16, 31, 34, 67, 68, 69, 70], "small": [9, 11, 58, 60, 65, 68, 69, 71], "smaller": [16, 60, 69], "smith": [0, 68, 69, 70], "smoke": 50, "sneak": 67, "snif": 11, "so": [7, 10, 11, 15, 16, 21, 27, 29, 31, 32, 33, 34, 36, 37, 38, 44, 45, 46, 50, 51, 53, 58, 59, 60, 61, 65, 66, 67, 68, 69, 70, 71, 73, 74, 75], "softwar": [2, 8, 9, 10, 11, 15, 29, 31, 33, 34, 43, 45, 53, 62, 68, 70, 75], "software_entri": 21, "sole": 64, "solid": 8, "solut": [10, 70], "solv": [10, 31], "some": [2, 4, 8, 9, 10, 11, 14, 15, 16, 18, 19, 21, 26, 27, 29, 31, 34, 35, 37, 38, 39, 43, 44, 45, 46, 49, 50, 51, 53, 58, 61, 65, 66, 67, 68, 69, 70, 71, 73, 74, 75], "some_act": [18, 41], "some_artifact": 61, "some_plugin": 21, "somedai": 16, "someexcept": 41, "someon": [29, 45, 68, 70], "someth": [16, 18, 31, 39, 41, 45, 47, 51, 53, 58, 66, 67, 68, 69, 71, 73, 75], "sometim": [10, 33, 53, 68], "somewher": 53, "soon": 48, "sooner": 33, "sophist": 16, "sorri": 31, "sort": [8, 31, 66, 69, 74], "sort_kei": 16, "sortabl": 51, "soup": 16, "sourc": [2, 7, 15, 21, 24, 30, 34, 35, 37, 44, 47, 53, 54, 55, 56, 58, 59, 60, 61, 62, 64, 68, 75], "source_format": 59, "space": 46, "span": 39, "spars": 7, "spatula": 16, "speak": [53, 57], "spec": 64, "speci": 74, "special": [11, 15, 16, 29, 60, 68, 69], "specif": [2, 5, 7, 8, 10, 15, 16, 18, 19, 21, 26, 29, 33, 34, 38, 39, 42, 46, 47, 50, 51, 58, 64, 67, 68, 69, 71, 73, 74, 75], "specifi": [2, 15, 18, 19, 29, 32, 33, 34, 39, 51, 59, 64, 66, 67, 68, 69], "spend": [45, 66], "split": [26, 31, 41, 50], "split_act": 69, "split_int": 61, "split_siz": 69, "spoon": 16, "spork": 16, "sqlite": 64, "squar": 15, "src": 62, "stabl": 73, "stackoverflow": 46, "stage": [29, 47, 67, 68, 69], "stai": 33, "standalon": 46, "standard": [9, 10, 29, 68], "start": [8, 15, 16, 29, 31, 33, 37, 38, 39, 43, 45, 46, 47, 60, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75], "stat": 66, "state": [7, 8, 10, 12, 70], "statement": [19, 29, 50, 67, 68], "static": [9, 12], "statist": [37, 46], "stderr": [62, 68, 73], "stdin": 16, "stdio": 62, "stdout": [62, 68, 73], "steak": 16, "stem": 68, "step": [7, 8, 10, 15, 18, 26, 29, 38, 39, 41, 42, 46, 52, 59, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74], "still": [2, 5, 10, 16, 19, 26, 31, 32, 39, 48, 65, 66, 68, 69, 72, 73], "stitch": 35, "storag": [8, 67], "store": [9, 11, 13, 19, 20, 21, 29, 31, 33, 58, 59, 60, 61, 64, 66, 67, 68, 69, 70], "stori": 16, "str": [16, 24, 30, 35, 36, 37, 51, 53, 54, 58, 59, 60, 61, 64, 65, 66, 67, 70, 71, 74], "straight": [16, 38, 68, 70, 71], "straightforward": [39, 46], "strategi": [18, 44, 69], "strict": [16, 60], "strictli": [8, 60], "string": [9, 10, 16, 21, 24, 34, 46, 51, 53, 54, 58, 59, 60, 61, 64, 66, 67, 68, 71], "strip": 32, "structur": [2, 9, 10, 12, 15, 16, 21, 28, 31, 33, 34, 39, 52, 60, 71, 73], "struggl": 67, "stuck": [66, 67, 70], "studi": [11, 15, 51, 64], "stuff": [15, 29], "style": 66, "sub": [2, 8, 35, 48, 67], "subclass": [2, 21, 50, 54, 58, 59, 64, 67, 71], "subcommand": 44, "subdir": 47, "subdirectori": [9, 10, 15, 67], "subject": 51, "submit": [7, 29, 45, 60], "submodul": [24, 29, 68], "suboptim": 67, "subsequ": [0, 15, 27, 34, 51, 60, 68, 69, 70], "subset": [11, 60, 69], "substanti": 75, "substitut": 16, "substr": 66, "subsystem": 47, "subtyp": [2, 60], "succe": 19, "succeed": 67, "success": [8, 33, 38, 67, 68, 73], "successfulli": [31, 50, 71, 73], "suffer": 34, "suffic": [16, 66], "suffici": [60, 75], "suggest": [5, 16, 33, 39, 45, 58, 69, 73], "suit": [16, 49, 69, 71], "suitabl": 47, "sum": [50, 67], "summar": [66, 70, 71], "summari": [2, 37, 66, 67, 69, 70], "summarize_align": [66, 70], "summarize_alignment_act": 70, "summarizealignmenttest": 66, "sun": 33, "sup": 2, "super": [58, 69], "supersed": 21, "supertyp": 16, "suppli": [18, 58, 64], "support": [2, 4, 7, 9, 10, 11, 15, 18, 21, 26, 33, 38, 41, 42, 43, 45, 46, 47, 50, 51, 52, 53, 58, 60, 62, 64, 67, 68, 70, 71, 75], "suppos": [16, 66, 68], "sure": [18, 31, 33, 38, 43, 47, 50, 65, 67, 73], "surround": 8, "sw": 68, "swap": [14, 16], "sweet": 66, "switch": [7, 18], "sy": [12, 15, 62], "symbol": [33, 39], "symmetr": 67, "sync": [33, 74], "synchron": 12, "synonym": [10, 16, 31], "syntax": [16, 24, 32, 34, 60, 68], "system": [2, 10, 15, 16, 18, 19, 21, 29, 31, 32, 34, 46, 47, 53, 60, 70], "t": [0, 2, 4, 7, 9, 10, 11, 15, 16, 19, 21, 29, 31, 33, 34, 36, 38, 39, 41, 43, 45, 47, 48, 49, 50, 53, 59, 60, 61, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74], "t_in": 60, "t_out": 60, "t_parama": 60, "t_paramb": 60, "taacacccac": [66, 68], "tab": [15, 33, 66, 73, 74], "tabl": [15, 27, 29, 30, 31, 34, 35, 37, 39, 50, 51, 53, 59, 60, 62, 64, 67, 68, 69, 73, 74], "tabul": [51, 69, 74], "tabular": [60, 64, 69], "tabularmsa": [66, 67, 68, 70], "tabulate_las_result": 69, "tabulate_las_results_act": 74, "tag": [15, 21, 46], "take": [18, 21, 30, 31, 33, 34, 35, 37, 43, 44, 45, 48, 58, 61, 64, 65, 66, 67, 68, 70, 71, 74], "taken": 61, "talk": [16, 29], "tar": 9, "target": [26, 33, 38, 39, 42, 43, 45, 59, 71, 73, 75], "task": [8, 16, 42, 66, 75], "taxa": 44, "taxonom": [69, 74], "taxonomi": [53, 68, 74], "team": [15, 26, 47], "tear": 16, "teardown": 59, "tech": 48, "technic": [4, 15, 42, 45, 46, 52, 66, 68, 70], "technologi": 26, "tediou": 67, "tell": [15, 18, 45, 46, 67, 68], "temp_dir": [11, 66], "tempfil": 71, "templat": [7, 26, 29, 43, 52, 61, 66, 72, 75], "temporari": [29, 59, 68], "temptat": 75, "ten": 15, "tend": [45, 58, 65, 69, 71], "term": [2, 10, 15, 27, 31, 33, 39, 64, 67, 68, 71], "termin": [15, 27, 37, 47, 60, 74], "test": [16, 26, 38, 42, 45, 46, 47, 48, 52, 53, 57, 60, 61, 63, 72, 75], "test_alt_gap_extend_penalti": 68, "test_alt_gap_open_penalti": 68, "test_alt_match_scor": 68, "test_alt_mismatch_scor": 68, "test_dir_prefix": 59, "test_dna_to_single_record_fasta_simple1": 65, "test_dna_to_single_record_fasta_simple2": 65, "test_exampl": 71, "test_invalid_default_valid": 67, "test_invalid_max_valid": 67, "test_invalid_min_valid": 67, "test_method": [67, 68, 69], "test_pipelin": 69, "test_semantic_type_registr": 67, "test_simple1": [66, 67, 68, 69], "test_simple1_parallel": 69, "test_simple1_seri": 69, "test_simple2": [67, 68], "test_single_record_fasta_to_dna_simple1": 67, "test_single_record_fasta_to_dna_simple2": 67, "test_transform": [65, 67], "test_types_and_format": 67, "test_visu": 66, "testcas": 59, "testpluginbas": [49, 50, 59, 66, 67, 68, 69, 71], "text": [8, 9, 10, 15, 29, 33, 35, 37, 46, 53, 60, 61, 64, 65, 66, 68, 70, 71, 73, 74], "textfileformat": [2, 11, 53, 56, 58, 67], "textual": 37, "than": [7, 8, 11, 15, 16, 31, 32, 33, 47, 50, 51, 53, 60, 62, 64, 65, 66, 67, 68, 69, 70, 71, 73], "thank": [26, 72], "thei": [2, 8, 10, 11, 15, 16, 18, 21, 29, 30, 31, 32, 36, 38, 39, 43, 45, 48, 51, 53, 58, 60, 61, 62, 65, 66, 67, 68, 69, 70, 71], "them": [7, 8, 10, 12, 15, 16, 18, 21, 26, 29, 32, 33, 34, 38, 39, 41, 43, 50, 53, 54, 65, 66, 67, 68, 69, 70, 71, 74, 75], "theme": 2, "themselv": [8, 15, 50, 68, 69], "theoret": 15, "theori": 69, "therefor": [2, 9, 15, 29, 39, 64, 67, 68, 69, 71], "therein": 33, "thereof": 61, "thermophili": 67, "thi": [2, 4, 5, 7, 8, 9, 10, 11, 12, 14, 15, 16, 18, 19, 20, 21, 24, 27, 29, 30, 31, 32, 33, 34, 35, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 53, 54, 55, 57, 58, 59, 60, 61, 62, 64, 65, 66, 67, 69, 70, 71, 72, 73, 74, 75], "thing": [7, 11, 15, 16, 29, 31, 33, 45, 50, 53, 58, 61, 66, 67, 68, 69, 70, 71, 74], "think": [12, 16, 31, 51, 65, 67, 68], "third": [31, 69], "thoma": [0, 2], "thorough": 26, "those": [11, 15, 26, 30, 37, 38, 39, 42, 43, 50, 51, 53, 60, 64, 65, 67, 68, 69, 70, 71, 73, 74], "though": [8, 10, 16, 21, 26, 31, 34, 41, 45, 47, 66, 67, 71, 73], "thought": 60, "thread": [18, 41, 60, 70], "threadpoolexecutor": 18, "three": [8, 11, 15, 27, 31, 50, 61, 67, 68], "three_tabl": 50, "through": [2, 11, 15, 26, 29, 31, 32, 33, 37, 38, 39, 43, 46, 47, 48, 50, 53, 66, 67, 68, 69, 70, 71, 73, 74, 75], "throughout": [26, 68], "throw": 74, "thu": [27, 37, 64], "ti": 48, "tie": 12, "time": [7, 8, 9, 10, 15, 18, 21, 29, 30, 31, 32, 33, 39, 43, 44, 45, 47, 51, 53, 58, 61, 65, 66, 67, 68, 70, 71, 75], "timestamp": 15, "tini": [43, 69], "tip": [38, 69], "titl": [15, 58, 66, 68, 74], "tl": 2, "to_ast": [16, 24], "to_datafram": [51, 64, 74], "to_html": 74, "to_import": 61, "to_list": 74, "to_seri": 64, "to_typ": [59, 61, 62, 68], "togeth": [2, 9, 11, 16, 21, 33, 35, 67, 69, 70], "toggl": 70, "toi": [33, 69], "told": 31, "toler": 44, "toml": 18, "tomlkit": 18, "too": [2, 11, 15, 51, 53, 67], "tool": [0, 2, 4, 10, 15, 21, 29, 31, 42, 43, 44, 48, 52, 67, 68, 69, 70, 71], "top": [8, 15, 18, 29, 33, 38, 66, 67, 68, 69, 70, 71, 73], "topic": [7, 26, 40, 45, 68], "total": [35, 43, 62], "touch": [15, 68], "toward": [67, 71], "traceback": 16, "track": [9, 10, 13, 20, 21, 53, 54, 55, 64], "tracker": [46, 48, 72], "trade": 67, "train": 33, "trait": 21, "tranch": 75, "tranform": 59, "transfer": 16, "transform": [2, 15, 21, 28, 42, 44, 49, 51, 52, 58, 59, 61, 62, 68, 69, 70, 75], "transform_format": [59, 67], "transit": [7, 31, 67], "translat": [8, 71], "transpar": 15, "travers": 15, "treat": [29, 31, 60, 64], "treatment": [64, 68], "tree": [9, 24, 29, 31, 67], "treenod": 30, "tri": [41, 53, 67], "trick": 16, "tricker": 66, "trigger": 33, "trip": 65, "trivial": [60, 65], "troubleshoot": [33, 39, 43], "true": [16, 19, 24, 59, 60, 61, 64, 68, 69, 74], "truli": 45, "trust": [10, 67, 68], "try": [11, 16, 19, 41, 45, 48, 60, 61, 65, 66, 67, 69, 70, 71, 73, 74], "tsv": [11, 15, 37, 50, 61, 64, 74], "tt": 68, "ttt": 68, "tupl": [24, 34, 35, 58, 60, 64, 70], "ture": 16, "turn": [8, 32, 68, 71], "tutori": [7, 26, 29, 38, 41, 42, 45, 47, 51, 52, 64, 67, 70, 72, 73], "twice": 9, "two": [0, 8, 11, 15, 16, 18, 31, 33, 36, 37, 39, 44, 50, 51, 53, 60, 61, 65, 67, 68, 69, 70, 71, 73, 74], "tx": 65, "txt": [7, 53, 61], "type": [2, 5, 8, 9, 13, 15, 20, 21, 24, 28, 30, 32, 34, 35, 36, 37, 43, 44, 47, 49, 50, 51, 52, 53, 54, 55, 57, 58, 59, 61, 62, 63, 64, 65, 66, 68, 69, 70, 71, 74, 75], "type_frag": 58, "type_from_ast": 24, "typeerror": [11, 16, 24, 61], "typeexpress": 24, "typemap": 60, "typematch": 60, "typevarexp": 60, "typic": [2, 11, 29, 30, 31, 33, 38, 44, 51, 60, 61, 67, 68, 69, 70], "u": [15, 16, 26, 29, 32, 39, 43, 45, 50, 53, 65, 66, 67, 68, 69, 70, 71], "ubiquit": [9, 69], "ubuntu": 47, "ui": [8, 16], "ultim": [16, 29, 43, 45, 48, 71, 73, 75], "ultipl": 68, "uml": 8, "unabl": [5, 16], "unadorn": 16, "unambigu": [53, 67, 70], "unbound": 60, "uncommon": [15, 53], "under": [18, 21, 26, 29, 33, 39, 45, 47, 48, 53, 61, 65, 68, 69, 71], "underli": [11, 16, 35, 36, 50, 62, 66, 68, 69, 70], "underscor": [29, 46, 50], "understand": [8, 10, 12, 15, 16, 26, 31, 33, 65, 68], "understood": 9, "unexpect": 70, "unfamilar": 16, "unfortun": [33, 45], "unicod": [16, 60], "unifi": 51, "unimport": 58, "uninitializedpluginmanagererror": [24, 61], "uninterest": 16, "union": [58, 60], "uniqu": [2, 9, 35, 44, 45, 50, 51, 60, 64, 67], "unit": [2, 29, 33, 45, 46, 50, 69, 70, 71, 72, 73], "unitl": 40, "unittest": [50, 59], "univers": [2, 31, 65], "unix": 2, "unkown": 12, "unless": [16, 18, 21, 35, 46, 47, 60, 73], "unlik": [11, 15, 16, 26, 46, 58, 62, 67, 70, 74], "unmap": 18, "unnecessari": [67, 69, 74], "unnecessarili": 50, "unpack": [50, 60, 61], "unrecognizedformaterror": 67, "unrel": 16, "unreli": 53, "unroot": [31, 67], "unshred": 16, "unspecifi": [68, 73], "until": [7, 16, 31, 66, 68, 69, 70, 71], "unus": 68, "unusu": 68, "unweighted_unifrac_emperor": 15, "unzip": [10, 15], "up": [9, 12, 16, 18, 21, 29, 32, 33, 42, 48, 50, 51, 52, 59, 65, 66, 67, 69, 70, 74], "upcom": 33, "upda": 50, "updat": [9, 10, 15, 16, 26, 33, 38, 45, 47, 71], "upfront": 53, "upload": 53, "upon": [8, 38], "uppercas": 46, "upstream": [33, 69, 74], "url": [0, 26, 39, 46, 58, 61], "us": [2, 4, 7, 8, 9, 10, 11, 12, 14, 15, 16, 19, 21, 24, 26, 27, 29, 31, 34, 35, 36, 37, 38, 42, 43, 44, 45, 46, 47, 49, 50, 52, 53, 55, 57, 58, 59, 60, 61, 62, 64, 65, 66, 68, 70, 71, 73, 74, 75], "usabl": [19, 33], "usag": [2, 7, 17, 19, 20, 31, 42, 52, 57, 58, 59, 63, 65, 68, 69, 70, 72, 73, 75], "usage_vari": 61, "usageact": [50, 61, 71], "usagedriv": 71, "usageexampletest": 71, "usageinput": [50, 61, 71], "usageoutput": [50, 61], "usageoutputnam": [50, 61, 71], "usagevari": [50, 61], "user": [2, 4, 6, 8, 10, 12, 15, 16, 18, 19, 21, 24, 26, 29, 31, 33, 34, 36, 37, 38, 42, 43, 44, 45, 46, 47, 50, 51, 52, 53, 54, 57, 58, 60, 63, 65, 66, 67, 68, 69, 70, 71, 73, 74, 75], "user_support_text": [46, 58], "usual": [7, 8, 16, 18, 33, 39, 46, 53, 58, 60, 61], "utensil": 16, "utf": 66, "util": [10, 14, 15, 33, 39, 51, 52, 57, 59, 61, 63, 67, 68, 69], "utlit": 51, "uuid": [2, 9, 15, 21, 53, 73], "v": [0, 33, 58, 64], "v0": 21, "v1": [11, 21], "v2": 21, "v4": [15, 21], "v5": 21, "val": [11, 50], "valid": [2, 8, 15, 16, 32, 42, 51, 52, 58, 59, 60, 61, 64, 67, 68, 71], "validate_someth": 58, "validation_level_to_n_char": 67, "validation_seq": 67, "validation_seq_len": 67, "validationerror": [11, 24, 56, 58, 67], "vallei": 26, "valu": [2, 11, 15, 16, 18, 24, 32, 33, 34, 35, 37, 39, 41, 46, 47, 50, 51, 53, 54, 60, 61, 64, 66, 68, 69, 70, 71, 73], "valuabl": 15, "valueerror": [11, 59, 64, 67], "vaniti": 61, "var": 47, "var_typ": 61, "varfield": 16, "vari": [18, 34, 46, 53, 67], "variabl": [16, 18, 21, 24, 29, 58, 60, 61, 66, 68, 69, 70, 71], "variad": 21, "variadic_input_simpl": 50, "varianc": 64, "variant": [16, 31, 58, 60], "variant1": 58, "variant2": 58, "variant_of": [16, 60], "variantfield": 60, "variat": 68, "varieti": 9, "variou": [15, 16, 20, 26, 64], "varriabl": 68, "vastli": 7, "ve": [16, 33, 34, 38, 42, 45, 50, 67, 68, 69, 70, 73, 74], "vector": [35, 37, 50], "vendor": 18, "verb": [2, 44], "verbos": [68, 73], "veri": [8, 9, 11, 16, 18, 26, 31, 32, 33, 34, 35, 37, 45, 46, 58, 66, 67, 68, 69, 70, 71], "verif": 51, "verifi": [36, 66], "version": [2, 7, 8, 9, 10, 15, 20, 22, 33, 39, 45, 46, 50, 53, 58, 67, 68, 73, 74], "versu": 70, "vertic": 8, "via": [2, 5, 8, 34, 38, 46, 50, 51, 54, 58, 59, 65, 69], "video": 31, "view": [2, 7, 10, 12, 15, 29, 31, 32, 35, 51, 53, 55, 58, 59, 60, 61, 65, 66, 67, 68, 69, 71, 73], "view_as_metadata": 61, "view_typ": [35, 55, 61, 65, 69], "viewer": [15, 66, 74], "viewport": 66, "violat": 70, "virtu": 16, "virtual": 15, "visibl": [15, 45], "visit": [47, 58], "visual": [2, 9, 10, 13, 15, 20, 21, 24, 27, 34, 35, 42, 46, 52, 58, 67, 68, 69, 70, 71, 72, 74, 75], "viusal": 66, "vizual": 66, "vm": 15, "vocabulari": [16, 64], "volatil": 51, "volum": 68, "w": [0, 26, 53, 56, 66, 74], "wa": [2, 9, 10, 11, 15, 16, 19, 21, 26, 29, 31, 33, 34, 37, 38, 47, 50, 53, 58, 64, 65, 67, 68, 69, 70, 74], "wai": [4, 7, 10, 11, 12, 15, 16, 18, 24, 29, 31, 32, 33, 38, 39, 43, 45, 47, 50, 53, 60, 61, 64, 66, 67, 68, 69, 70, 71, 72, 73], "wait": [8, 41, 69], "walk": [38, 53, 61, 75], "want": [15, 16, 18, 19, 26, 29, 31, 32, 37, 38, 39, 41, 43, 44, 45, 47, 50, 51, 66, 67, 68, 69, 70, 71, 73, 74, 75], "warn": [12, 32, 67, 68, 70, 71], "wast": 31, "watch": 11, "waterman": [0, 68, 69, 70], "we": [4, 5, 7, 8, 9, 10, 11, 12, 15, 16, 18, 21, 26, 29, 30, 31, 32, 33, 34, 35, 38, 39, 41, 43, 44, 45, 47, 48, 50, 51, 53, 58, 65, 66, 67, 68, 69, 70, 71, 73, 74], "web": [2, 7, 15, 38, 53], "websit": [9, 15, 21, 45, 46, 58, 68], "wednesdai": 33, "weekend": 31, "weird": 53, "welcom": 5, "well": [2, 7, 9, 10, 11, 15, 16, 31, 33, 43, 44, 45, 51, 64, 65, 66, 67, 68, 75], "went": [31, 66], "were": [2, 9, 15, 16, 18, 19, 21, 41, 53, 58, 60, 66, 67, 69, 71, 73, 74], "weren": 67, "weslei": 0, "what": [2, 8, 9, 10, 16, 18, 19, 29, 31, 33, 34, 36, 38, 39, 45, 50, 53, 58, 60, 61, 65, 66, 67, 69, 70, 71, 73, 74], "whatev": [8, 15, 29, 32, 37, 66, 67, 73], "whatsoev": 67, "when": [2, 7, 8, 9, 10, 11, 12, 15, 16, 19, 21, 24, 29, 30, 31, 32, 33, 37, 41, 43, 44, 45, 46, 50, 51, 53, 58, 59, 60, 62, 64, 65, 66, 67, 68, 69, 70, 71, 73, 74, 75], "whenev": [15, 21, 43, 58, 60], "where": [2, 7, 8, 9, 10, 15, 16, 18, 26, 29, 32, 33, 34, 38, 45, 46, 48, 49, 53, 58, 60, 64, 65, 66, 67, 68, 69, 70, 71, 74], "where_values_miss": 64, "wherev": [5, 16], "whether": [16, 31, 58, 60, 64, 67, 68, 70, 73], "which": [2, 7, 8, 9, 10, 11, 12, 14, 15, 16, 18, 21, 26, 29, 30, 31, 32, 34, 35, 38, 39, 45, 46, 47, 50, 51, 53, 58, 60, 61, 64, 66, 67, 68, 69, 70, 71, 73, 74, 75], "whichev": 43, "while": [2, 5, 9, 10, 11, 15, 16, 18, 31, 33, 39, 43, 45, 46, 59, 66, 68, 70, 71, 75], "who": [15, 26, 43, 47, 53, 67, 71, 75], "whole": [21, 43, 53, 68, 69], "whose": [8, 15, 21, 29, 50], "why": [7, 10, 16, 53, 70, 71], "wide": [10, 46], "widespread": 2, "width": 66, "wikipedia": [2, 53], "wild": 21, "window": 47, "winzip": 10, "wise": 60, "wish": [19, 39, 50, 67], "witcombe2006sword": 58, "within": [2, 7, 8, 9, 11, 15, 16, 21, 24, 30, 32, 33, 39, 44, 46, 48, 50, 51, 60, 61, 64, 70], "without": [2, 9, 10, 15, 16, 18, 29, 31, 32, 58, 60, 66, 67, 68, 69, 75], "won": [15, 48, 53, 66, 67, 68, 69, 73], "wonder": 50, "wood": 0, "word": [2, 10, 15, 16, 29, 45, 68], "work": [2, 3, 4, 7, 8, 10, 11, 15, 16, 19, 26, 30, 31, 32, 33, 38, 39, 43, 44, 45, 46, 47, 50, 51, 53, 59, 60, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75], "workaround": 68, "worker": 18, "workflow": [29, 33, 53, 69, 70, 74, 75], "workflow_dispatch": 33, "working_set": 15, "workspac": 16, "world": [16, 60, 75], "worri": [10, 16, 50], "wors": 31, "worst": 69, "worth": [45, 53, 68, 75], "would": [2, 9, 10, 12, 15, 16, 18, 19, 26, 31, 32, 33, 37, 38, 39, 42, 45, 46, 50, 53, 58, 60, 61, 64, 66, 68, 70, 71, 74], "wouldn": [16, 53, 68, 69], "wrap": [15, 34, 35, 44, 74], "wrapper": [32, 61], "write": [2, 4, 7, 8, 11, 16, 18, 21, 26, 31, 36, 37, 38, 42, 46, 52, 65, 67, 69, 70, 72, 73, 74, 75], "write_csv": 58, "written": [18, 21, 32, 37, 44, 46, 53, 64, 66, 67, 71], "wrong": [15, 31, 66, 67, 74], "wrote": [50, 65, 66, 67, 69, 70, 74], "wsl": 47, "wunsch": [0, 68, 70], "x": 60, "x86_64": 15, "xdg": 18, "xopen": 15, "y": [53, 60, 70], "yaml": [10, 21, 29, 33, 38, 47], "year": [10, 45, 68], "yet": [9, 10, 16, 32, 33, 50, 58, 67, 68, 69], "yield": 69, "yml": [29, 33, 39, 47], "you": [4, 5, 7, 9, 10, 12, 15, 16, 18, 19, 24, 26, 29, 30, 31, 32, 33, 34, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 53, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75], "your": [0, 4, 7, 16, 18, 19, 29, 31, 32, 34, 37, 41, 42, 44, 50, 51, 52, 53, 58, 60, 65, 67, 68, 69, 70, 72, 74], "your_qiime2_act": 18, "yourself": [2, 26, 32, 46, 51, 53, 69, 74], "zero": [2, 16, 60, 64, 68], "zip": [10, 15, 16, 50], "zipfil": 9, "zipp": 15, "zuckerberg": 26}, "titles": ["List of works cited", "Index", "Glossary", "Back matter", "Distribution Development", "Developer documentation", "Docs Development", "User documentation", "QIIME 2 architecture overview", "Anatomy of an Archive", "How Data is Stored", "File Formats and Directory Formats", "Garbage Collection", "Explanations", "Metaprogramming", "Decentralized retrospective provenance tracking", "Semantic Types, Primitives, and Visualizations", "How-To Guides", "Parallel configuration and usage in QIIME 2", "Pipeline Resumption in QIIME 2", "Framework Development", "Archive versions", "References", "Interface Development", "Interface developer API reference", "References", "Developing with QIIME 2", "Types of QIIME 2 Actions", "Explanations", "The structure of QIIME 2 plugin packages", "Transformers", "Semantic types, data types, file formats, and artifact classes", "Use Artifact Collections as Action inputs or outputs", "Automate testing of your plugin", "Create and register a Method", "Create and register a pipeline", "Creating and registering a Transformer", "Create and register a visualizer", "Distribute plugins on GitHub", "Facilitating installation of your plugin for users", "Defining different Format validation levels", "Handling exceptions in parallel Pipelines", "How-To Guides", "Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)", "How to play nicely with other plugins", "Publicize your QIIME 2 plugins (or other QIIME 2-based tools)", "Register a QIIME 2 plugin", "Set up your development environment", "Provide technical support for your users", "How to test QIIME 2 plugins", "Writing Usage Examples", "How to use Metadata", "Plugin Development", "Plugin development anti-patterns", "Citations", "Pipeline Context Object", "Formats", "Plugin Development API", "Plugin & Registration", "Testing", "Types", "Usage Examples", "Utilities", "References", "User Metadata API", "Add a second transformer", "Add a first Visualizer", "Add a new Artifact Class", "Add a first (real) Method", "Add a Pipeline with parallel computing support", "Add a first Pipeline", "Add a Usage Example", "Conclusion", "Create your plugin from a template", "Integrate metadata in Actions", "Tutorial: A step-by-step guide to building your first QIIME 2 plugin"], "titleterms": {"": 43, "0": 21, "1": 21, "2": [8, 10, 18, 19, 21, 26, 27, 29, 39, 43, 45, 46, 47, 49, 75], "3": [18, 19, 21, 68, 71], "4": 21, "5": 21, "6": 21, "7": 21, "A": [8, 51, 68, 75], "In": 9, "The": [9, 15, 18, 24, 29, 32, 64, 74], "To": [17, 42], "__init__": 29, "_method": 29, "_pipelin": 70, "_version": 29, "access": 10, "acknowledg": 26, "action": [15, 24, 27, 32, 33, 58, 61, 66, 68, 70, 74], "activ": 47, "add": [65, 66, 67, 68, 69, 70, 71, 74], "addit": [57, 68], "advanc": 51, "agnost": 21, "align": [67, 68, 69, 71], "amplicon": 47, "an": [9, 16, 32, 39, 46, 66, 67, 68, 70, 74], "analogi": 16, "anatomi": 9, "ani": 39, "annot": 61, "anti": 53, "api": [18, 19, 24, 32, 51, 57, 64, 68, 71], "appli": 69, "ar": 30, "architectur": 8, "archiv": [9, 21], "artifact": [31, 32, 51, 67], "assert": 61, "associ": 11, "autom": [33, 71], "avoid": 70, "awai": 15, "back": 3, "base": 45, "basic": 60, "between": 43, "bib": 29, "binari": 11, "block": 15, "build": [47, 75], "call": 68, "can": [50, 51], "captur": 15, "categor": 51, "cfg": 29, "check": 10, "choic": 16, "ci": [29, 33], "citat": [29, 54, 68], "cite": 0, "class": [31, 64, 67], "cli": [18, 19, 32], "collect": [12, 32, 60, 61], "column": [51, 64], "combin": 69, "command": [8, 18, 19, 32, 71], "comment": 50, "commun": 45, "compar": 69, "compat": 43, "compon": 8, "comput": 69, "conclus": 72, "conda": 47, "config": 18, "configur": [18, 33], "content": [26, 75], "context": [50, 55], "continu": 33, "contribut": [7, 26, 45, 47], "cookiecutt": 73, "creat": [34, 35, 36, 37, 69, 70, 73], "current": 7, "custom": 39, "data": [9, 10, 15, 29, 31, 50, 71], "decentr": 15, "defin": [16, 40, 46, 50, 65, 67, 68, 69, 71], "depend": 60, "detail": 8, "develop": [4, 5, 6, 16, 20, 23, 24, 26, 47, 52, 53, 57, 67], "diagram": 8, "differ": 40, "directori": [11, 67], "discov": 67, "displai": 71, "distribut": [4, 38, 39, 43, 47], "dna": 65, "doc": 6, "docstr": 5, "document": [5, 7, 70], "dr": [65, 66, 67, 68, 69, 70, 71, 74], "drop": 51, "duplic": 70, "dure": 73, "dwq2": 29, "each": 69, "empti": 51, "entri": 46, "environ": [15, 26, 47], "exampl": [15, 49, 50, 61, 71, 74], "except": [24, 41, 64], "execut": 15, "exercis": [66, 67, 68, 70, 71], "exist": [39, 43, 47], "expand": 38, "explan": [13, 28], "extend": 16, "extens": 10, "facilit": 39, "factori": 50, "feedback": 43, "few": 68, "file": [9, 11, 15, 18, 31, 51, 67], "filepath": 53, "filter": 51, "find": 5, "first": [47, 66, 68, 70, 75], "fix": 11, "flowchart": 69, "follow": 8, "format": [11, 21, 31, 40, 53, 56, 67], "forum": 45, "framework": 20, "free": 51, "from": [51, 65, 73], "function": [24, 34, 35, 37, 66, 68], "fund": 26, "garbag": 12, "gener": [51, 62], "get": [26, 43], "gha": 33, "git": [29, 73], "github": [29, 33, 38], "gitignor": 29, "glossari": 2, "goal": 10, "goe": 9, "guarante": 21, "guid": [17, 42, 75], "handl": 41, "help": [26, 45, 51], "hint": 70, "how": [10, 17, 30, 42, 44, 45, 49, 51], "i": [10, 15], "id": 15, "identifi": 9, "import": [9, 61, 67], "index": 1, "individu": 57, "inform": 70, "init": 32, "initi": [61, 73], "input": [10, 24, 32, 53, 69, 71, 74], "instal": [38, 39, 47, 73], "instanti": 46, "instruct": 38, "integr": [33, 74], "interfac": [16, 18, 19, 23, 24, 32, 71], "interoper": 10, "intersect": 16, "latest": 47, "layout": 11, "level": 40, "librari": 45, "licens": [26, 29], "line": [18, 19, 32, 71], "list": [0, 57], "load": 32, "local": 69, "make": [51, 67], "makefil": 29, "manifest": 29, "matter": 3, "maxim": 43, "md": 29, "me": 51, "merg": 51, "metadata": [9, 10, 51, 60, 61, 64, 74], "metagenom": 47, "metaprogram": 14, "method": [34, 68, 69], "most": 9, "need": 73, "new": [65, 67, 68, 73], "next": 47, "nice": 44, "normal": 51, "note": 16, "number": 69, "numer": 51, "nw": [67, 71], "nw_align": 70, "object": [24, 31, 32, 46, 55, 57, 61], "option": [66, 67, 68, 70, 71, 73, 74], "other": [44, 45, 47], "our": [68, 69], "out": 50, "output": [24, 32, 51, 53], "overview": [8, 46], "packag": 29, "pairwis": 68, "parallel": [18, 41, 69], "paramet": [53, 61], "pattern": 53, "pipelin": [15, 19, 35, 41, 55, 69, 70], "plai": 44, "plan": 7, "plugin": [29, 30, 33, 38, 39, 43, 44, 45, 46, 47, 49, 52, 53, 57, 58, 62, 66, 68, 73, 75], "plugin_setup": [29, 68, 74], "pluginmanag": 24, "point": 46, "post": 45, "pre": 45, "predic": 60, "prerequisit": 47, "primit": [16, 60], "print": 45, "properti": 16, "proven": [9, 10, 15], "provid": [48, 50, 53], "public": 45, "publicli": 67, "put": 31, "py": [29, 68, 70, 74], "python": [18, 19, 32, 66, 68, 71], "q2": 29, "q2_dwq2": [29, 65], "q2cli": 68, "qiim": [8, 10, 18, 19, 26, 27, 29, 39, 43, 45, 46, 47, 49, 64, 75], "rang": 16, "readm": 29, "real": 68, "recommend": 39, "refactor": 7, "refer": [22, 24, 25, 63], "refin": 16, "regist": [32, 34, 35, 36, 37, 46, 50, 66, 67, 68, 69, 70, 71], "registr": 58, "repositori": 73, "requir": 39, "result": 61, "resultcollect": 32, "resumpt": [19, 69], "retrospect": 15, "return": 32, "rule": 9, "run": [69, 73], "save": 32, "search": [69, 74], "search_and_summar": 69, "second": [65, 68], "semant": [16, 31, 60, 67], "sequenc": [68, 69], "serial": 69, "set": [26, 47], "setup": 29, "share": 38, "should": 69, "singl": 11, "singlerecorddnafastaformat": 65, "site_config_dir": 18, "size": 69, "skbio": 65, "skip": 53, "sourc": 5, "split": 69, "split_sequ": 69, "splitter": 69, "sql": 51, "statu": 26, "step": [47, 75], "storag": 10, "store": 10, "structur": 29, "subtyp": 16, "summar": [69, 74], "summari": 8, "support": [48, 69], "tabl": 75, "tabulate_las_result": 74, "take": [15, 32, 69], "technic": 48, "templat": [38, 73], "test": [29, 33, 49, 50, 59, 65, 66, 67, 68, 69, 70, 71, 73, 74], "test_method": 29, "text": 11, "them": 45, "thi": [26, 68], "through": [8, 18, 19], "time": 69, "tini": [39, 47], "tl": [65, 66, 67, 68, 69, 70, 71, 74], "togeth": 31, "tool": [45, 73], "top": 39, "topic": 57, "track": 15, "transfer": 10, "transfom": 65, "transform": [30, 36, 65, 67], "try": [50, 68], "tsv": 51, "tutori": [71, 75], "type": [10, 11, 16, 27, 31, 60, 67], "understand": 45, "union": 16, "uniqu": 15, "unit": [65, 66, 67, 68, 74], "up": [26, 47, 68], "updat": [67, 69, 70, 74], "us": [18, 30, 32, 33, 39, 51, 67, 69], "usag": [18, 50, 61, 71, 74], "user": [7, 39, 48, 64], "user_config_dir": 18, "util": [24, 62], "valid": [10, 11, 40, 53], "variabl": 11, "version": [21, 29, 47], "versu": 69, "viewabl": 51, "visual": [16, 37, 51, 60, 66], "weekli": 33, "what": [15, 68], "why": [9, 15], "work": 0, "wrap": 68, "wrapper": 68, "write": [50, 66, 68, 71], "yaml": [9, 15], "your": [26, 33, 38, 39, 43, 45, 46, 47, 48, 66, 71, 73, 75], "zip": 9}})
\ No newline at end of file