diff --git a/workflows/VGP-assembly-v2/Assembly-Hifi-Trio-phasing-VGP5/Assembly-Hifi-Trio-phasing-VGP5-tests.yml b/workflows/VGP-assembly-v2/Assembly-Hifi-Trio-phasing-VGP5/Assembly-Hifi-Trio-phasing-VGP5-tests.yml index b1300b91d..e1f5b4595 100644 --- a/workflows/VGP-assembly-v2/Assembly-Hifi-Trio-phasing-VGP5/Assembly-Hifi-Trio-phasing-VGP5-tests.yml +++ b/workflows/VGP-assembly-v2/Assembly-Hifi-Trio-phasing-VGP5/Assembly-Hifi-Trio-phasing-VGP5-tests.yml @@ -52,24 +52,21 @@ Assembly statistics for Hap1 and Hap2: asserts: has_line: - line: "# contigs 86 79" + line: "# contigs 85 49" usable hap1 gfa: asserts: has_n_lines: - n: 177 + n: 175 Hifiasm Trio hap1: asserts: has_n_lines: - n: 172 + n: 170 Busco Summary Hap1: asserts: has_text: - text: "C:1.1%[S:1.1%,D:0.0%],F:0.5%,M:98.4%,n:3354" + text: "C:1.2%[S:1.2%,D:0.0%],F:0.4%,M:98.4%,n:3354" Nx Plot: asserts: has_size: - value : 57000 + value : 65000 delta: 5000 - - - diff --git a/workflows/VGP-assembly-v2/Assembly-Hifi-Trio-phasing-VGP5/Assembly-Hifi-Trio-phasing-VGP5.ga b/workflows/VGP-assembly-v2/Assembly-Hifi-Trio-phasing-VGP5/Assembly-Hifi-Trio-phasing-VGP5.ga index e17d0c9dd..3be5db340 100644 --- a/workflows/VGP-assembly-v2/Assembly-Hifi-Trio-phasing-VGP5/Assembly-Hifi-Trio-phasing-VGP5.ga +++ b/workflows/VGP-assembly-v2/Assembly-Hifi-Trio-phasing-VGP5/Assembly-Hifi-Trio-phasing-VGP5.ga @@ -1,6 +1,7 @@ { "a_galaxy_workflow": "true", "annotation": "", + "comments": [], "creator": [ { "class": "Organization", @@ -14,7 +15,7 @@ ], "format-version": "0.1", "license": "CC-BY-4.0", - "release": "0.1.1", + "release": "0.1.2", "name": "Assembly-Hifi-Trio-phasing-VGP5", "steps": { "0": { @@ -60,7 +61,7 @@ "name": "Input dataset collection", "outputs": [], "position": { - "left": 10.375, + "left": 9.9375, "top": 297.7890625 }, "tool_id": null, @@ -204,7 +205,13 @@ "type": "parameter_input", "uuid": "a5987ed3-6fdb-49c7-92d0-5b2f78a9bbb9", "when": null, - "workflow_outputs": [] + "workflow_outputs": [ + { + "label": null, + "output_name": "output", + "uuid": "2cfefbef-173b-4bb1-944b-d66ecba6c40c" + } + ] }, "7": { "annotation": "", @@ -249,8 +256,8 @@ "name": "Input dataset", "outputs": [], "position": { - "left": 2798.765625, - "top": 1434.8046875 + "left": 2071.6714792235434, + "top": 1180.2756027635871 }, "tool_id": null, "tool_state": "{\"optional\": true, \"tag\": \"\"}", @@ -258,7 +265,13 @@ "type": "data_input", "uuid": "80ff22ac-1a58-4f89-bf52-48f18d8f71f9", "when": null, - "workflow_outputs": [] + "workflow_outputs": [ + { + "label": null, + "output_name": "output", + "uuid": "a949a15c-bc4c-4002-bc94-f3b8d3d2861d" + } + ] }, "9": { "annotation": "", @@ -285,7 +298,13 @@ "type": "parameter_input", "uuid": "c5651e7e-31d4-41b7-a590-e2fadc7f59e9", "when": null, - "workflow_outputs": [] + "workflow_outputs": [ + { + "label": null, + "output_name": "output", + "uuid": "91a2700d-e617-49ed-9c5e-c285d2a0068b" + } + ] }, "10": { "annotation": "", @@ -312,11 +331,17 @@ "type": "parameter_input", "uuid": "1ae103f4-38e9-4414-8e46-b8a763159937", "when": null, - "workflow_outputs": [] + "workflow_outputs": [ + { + "label": null, + "output_name": "output", + "uuid": "5aa55234-4876-4dc4-8a26-0cff1283bb08" + } + ] }, "11": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.0+galaxy1", + "content_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.4+galaxy0", "errors": null, "id": 11, "input_connections": { @@ -325,7 +350,12 @@ "output_name": "output" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Cutadapt", + "name": "library" + } + ], "label": null, "name": "Cutadapt", "outputs": [ @@ -354,15 +384,15 @@ "output_name": "out1" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.0+galaxy1", + "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.4+galaxy0", "tool_shed_repository": { - "changeset_revision": "135b80fb1ac2", + "changeset_revision": "8c0175e03cee", "name": "cutadapt", "owner": "lparsons", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"__job_resource\": {\"__job_resource__select\": \"no\", \"__current_case__\": 0}, \"adapter_options\": {\"action\": \"trim\", \"internal\": \"\", \"error_rate\": \"0.1\", \"no_indels\": false, \"times\": \"1\", \"overlap\": \"35\", \"match_read_wildcards\": \" \", \"revcomp\": true}, \"filter_options\": {\"discard_trimmed\": true, \"discard_untrimmed\": false, \"minimum_length\": null, \"maximum_length\": null, \"length_R2_options\": {\"length_R2_status\": \"False\", \"__current_case__\": 1}, \"max_n\": null, \"pair_filter\": \"any\", \"max_expected_errors\": null, \"discard_cassava\": false}, \"library\": {\"type\": \"single\", \"__current_case__\": 0, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"r1\": {\"adapters\": [], \"front_adapters\": [], \"anywhere_adapters\": [{\"__index__\": 0, \"anywhere_adapter_source\": {\"anywhere_adapter_source_list\": \"user\", \"__current_case__\": 0, \"anywhere_adapter_name\": \"\", \"anywhere_adapter\": \"ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT\"}, \"single_noindels\": false}, {\"__index__\": 1, \"anywhere_adapter_source\": {\"anywhere_adapter_source_list\": \"user\", \"__current_case__\": 0, \"anywhere_adapter_name\": \"\", \"anywhere_adapter\": \"ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT\"}, \"single_noindels\": false}], \"cut\": \"0\"}}, \"output_selector\": null, \"read_mod_options\": {\"quality_cutoff\": \"0\", \"nextseq_trim\": \"0\", \"trim_n\": false, \"strip_suffix\": \"\", \"shorten_options\": {\"shorten_values\": \"False\", \"__current_case__\": 1}, \"length_tag\": \"\", \"rename\": \"\", \"zero_cap\": false}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "4.0+galaxy1", + "tool_state": "{\"__job_resource\": {\"__current_case__\": 0, \"__job_resource__select\": \"no\"}, \"adapter_options\": {\"action\": \"trim\", \"internal\": \"\", \"error_rate\": \"0.1\", \"no_indels\": false, \"times\": \"1\", \"overlap\": \"35\", \"match_read_wildcards\": \" \", \"revcomp\": true}, \"filter_options\": {\"discard_trimmed\": true, \"discard_untrimmed\": false, \"minimum_length\": null, \"maximum_length\": null, \"length_R2_options\": {\"length_R2_status\": \"False\", \"__current_case__\": 1}, \"max_n\": null, \"pair_filter\": \"any\", \"max_expected_errors\": null, \"discard_cassava\": false}, \"library\": {\"type\": \"single\", \"__current_case__\": 0, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"r1\": {\"adapters\": [], \"front_adapters\": [], \"anywhere_adapters\": [{\"__index__\": 0, \"anywhere_adapter_source\": {\"anywhere_adapter_source_list\": \"user\", \"__current_case__\": 0, \"anywhere_adapter_name\": \"\", \"anywhere_adapter\": \"ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT\"}, \"single_noindels\": false}, {\"__index__\": 1, \"anywhere_adapter_source\": {\"anywhere_adapter_source_list\": \"user\", \"__current_case__\": 0, \"anywhere_adapter_name\": \"\", \"anywhere_adapter\": \"ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT\"}, \"single_noindels\": false}], \"cut\": \"0\"}}, \"output_selector\": null, \"read_mod_options\": {\"quality_cutoff\": \"0\", \"nextseq_trim\": \"0\", \"trim_n\": false, \"strip_suffix\": \"\", \"shorten_options\": {\"shorten_values\": \"False\", \"__current_case__\": 1}, \"length_tag\": \"\", \"rename\": \"\", \"zero_cap\": false}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "4.4+galaxy0", "type": "tool", "uuid": "b8770ddb-2ec4-4ef5-8362-6531e559554d", "when": null, @@ -379,7 +409,12 @@ "output_name": "output" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Search in textfiles", + "name": "infile" + } + ], "label": null, "name": "Search in textfiles", "outputs": [ @@ -415,7 +450,7 @@ }, "13": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/hifiasm/hifiasm/0.16.1+galaxy4", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/hifiasm/hifiasm/0.19.8+galaxy0", "errors": null, "id": 13, "input_connections": { @@ -423,27 +458,23 @@ "id": 6, "output_name": "output" }, - "mode|hap1_reads": { + "mode|reads": { + "id": 11, + "output_name": "out1" + }, + "mode|trioinput|hap1_reads": { "id": 1, "output_name": "output" }, - "mode|hap2_reads": { + "mode|trioinput|hap2_reads": { "id": 2, "output_name": "output" - }, - "mode|reads": { - "id": 11, - "output_name": "out1" } }, "inputs": [ { "description": "runtime parameter for tool Hifiasm", - "name": "mode" - }, - { - "description": "runtime parameter for tool Hifiasm", - "name": "mode" + "name": "filter_bits" }, { "description": "runtime parameter for tool Hifiasm", @@ -454,7 +485,7 @@ "name": "Hifiasm", "outputs": [ { - "name": "noseq files", + "name": "noseq_files", "type": "input" }, { @@ -479,8 +510,8 @@ } ], "position": { - "left": 1844.1249912594703, - "top": 410.81925628993656 + "left": 1843.692405931764, + "top": 411.04687749931213 }, "post_job_actions": { "TagDatasetActionhap1_contigs": { @@ -526,15 +557,15 @@ "output_name": "raw_unitigs_trio" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/hifiasm/hifiasm/0.16.1+galaxy4", + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/hifiasm/hifiasm/0.19.8+galaxy0", "tool_shed_repository": { - "changeset_revision": "5f625c63b8bc", + "changeset_revision": "0ee0c3089254", "name": "hifiasm", "owner": "bgruening", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"advanced_options\": {\"advanced_selector\": \"blank\", \"__current_case__\": 0}, \"assembly_options\": {\"assembly_selector\": \"blank\", \"__current_case__\": 0}, \"filter_bits\": {\"__class__\": \"ConnectedValue\"}, \"hic_partition\": {\"hic_partition_selector\": \"blank\", \"__current_case__\": 0}, \"log_out\": true, \"mode\": {\"mode_selector\": \"trio\", \"__current_case__\": 1, \"reads\": {\"__class__\": \"RuntimeValue\"}, \"hap1_reads\": {\"__class__\": \"RuntimeValue\"}, \"hap2_reads\": {\"__class__\": \"RuntimeValue\"}, \"max_kmers\": \"2\", \"min_kmers\": \"5\", \"yak_kmer_length\": \"31\"}, \"purge_options\": {\"purge_selector\": \"blank\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "0.16.1+galaxy4", + "tool_state": "{\"advanced_options\": {\"advanced_selector\": \"blank\", \"__current_case__\": 0}, \"assembly_options\": {\"assembly_selector\": \"blank\", \"__current_case__\": 0}, \"bins_out\": false, \"filter_bits\": {\"__class__\": \"ConnectedValue\"}, \"hic_partition\": {\"hic_partition_selector\": \"blank\", \"__current_case__\": 0}, \"log_out\": true, \"mode\": {\"mode_selector\": \"trio\", \"__current_case__\": 1, \"reads\": {\"__class__\": \"ConnectedValue\"}, \"trioinput\": {\"trio_input_selector\": \"reads\", \"__current_case__\": 0, \"hap1_reads\": {\"__class__\": \"RuntimeValue\"}, \"hap2_reads\": {\"__class__\": \"RuntimeValue\"}}, \"max_kmers\": \"2\", \"min_kmers\": \"5\", \"yak_kmer_length\": \"31\", \"trio_dual\": false}, \"ont_integration\": {\"ont_integration_selector\": \"blank\", \"__current_case__\": 0}, \"purge_options\": {\"purge_selector\": \"blank\", \"__current_case__\": 0}, \"scaffolding_options\": {\"scaffold_selector\": \"blank\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.19.8+galaxy0", "type": "tool", "uuid": "50aee4e7-5172-49a0-a448-4020942301af", "when": null, @@ -551,7 +582,12 @@ "output_name": "output" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Replace Text", + "name": "infile" + } + ], "label": null, "name": "Replace Text", "outputs": [ @@ -594,9 +630,17 @@ "input_file": { "id": 13, "output_name": "hap1_contigs" + }, + "mode_condition|swiss_army_knife": { + "id": 8, + "output_name": "output" } }, "inputs": [ + { + "description": "runtime parameter for tool gfastats", + "name": "input_file" + }, { "description": "runtime parameter for tool gfastats", "name": "mode_condition" @@ -659,9 +703,17 @@ "input_file": { "id": 13, "output_name": "hap2_contigs" + }, + "mode_condition|swiss_army_knife": { + "id": 8, + "output_name": "output" } }, "inputs": [ + { + "description": "runtime parameter for tool gfastats", + "name": "input_file" + }, { "description": "runtime parameter for tool gfastats", "name": "mode_condition" @@ -760,7 +812,7 @@ "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"fontsize\": null, \"height\": \"2000\", \"input_file\": {\"__class__\": \"RuntimeValue\"}, \"lengths\": false, \"names\": false, \"nodewidth\": \"25.0\", \"output_format\": \"png\", \"width\": null, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"fontsize\": null, \"height\": \"2000\", \"input_file\": {\"__class__\": \"ConnectedValue\"}, \"lengths\": false, \"names\": false, \"nodewidth\": \"25.0\", \"output_format\": \"png\", \"width\": null, \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "2022.09+galaxy4", "type": "tool", "uuid": "f9af6aa8-4ee4-4d4d-a54f-653881706285", @@ -782,7 +834,16 @@ "output_name": "output" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool gfastats", + "name": "input_file" + }, + { + "description": "runtime parameter for tool gfastats", + "name": "mode_condition" + } + ], "label": null, "name": "gfastats", "outputs": [ @@ -860,7 +921,16 @@ "output_name": "output" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool gfastats", + "name": "input_file" + }, + { + "description": "runtime parameter for tool gfastats", + "name": "mode_condition" + } + ], "label": null, "name": "gfastats", "outputs": [ @@ -934,7 +1004,12 @@ "output_name": "hap1_contigs" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool gfastats", + "name": "input_file" + } + ], "label": null, "name": "gfastats", "outputs": [ @@ -981,7 +1056,12 @@ "output_name": "hap2_contigs" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool gfastats", + "name": "input_file" + } + ], "label": null, "name": "gfastats", "outputs": [ @@ -1028,7 +1108,12 @@ "output_name": "outfile" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Convert", + "name": "input" + } + ], "label": null, "name": "Convert", "outputs": [ @@ -1058,7 +1143,7 @@ }, "23": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.3.2+galaxy0", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.5.0+galaxy0", "errors": null, "id": 23, "input_connections": { @@ -1067,7 +1152,12 @@ "output_name": "output" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Busco", + "name": "input" + } + ], "label": null, "name": "Busco", "outputs": [ @@ -1122,34 +1212,34 @@ "output_name": "summary_image" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.3.2+galaxy0", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.5.0+galaxy0", "tool_shed_repository": { - "changeset_revision": "41030a6c03b7", + "changeset_revision": "2a5b8b9936bf", "name": "busco", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"adv\": {\"evalue\": \"0.001\", \"limit\": \"3\"}, \"busco_mode\": {\"mode\": \"geno\", \"__current_case__\": 0, \"use_augustus\": {\"use_augustus_selector\": \"no\", \"__current_case__\": 0}}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"lineage\": {\"lineage_mode\": \"select_lineage\", \"__current_case__\": 1, \"lineage_dataset\": \"vertebrata_odb10\"}, \"outputs\": [\"short_summary\", \"missing\", \"image\"], \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "5.3.2+galaxy0", + "tool_state": "{\"adv\": {\"evalue\": \"0.001\", \"limit\": \"3\", \"contig_break\": \"10\"}, \"busco_mode\": {\"mode\": \"geno\", \"__current_case__\": 0, \"miniprot\": false, \"use_augustus\": {\"use_augustus_selector\": \"no\", \"__current_case__\": 0}}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"lineage\": {\"lineage_mode\": \"select_lineage\", \"__current_case__\": 1, \"lineage_dataset\": \"vertebrata_odb10\"}, \"lineage_conditional\": {\"selector\": \"download\", \"__current_case__\": 1}, \"outputs\": [\"short_summary\", \"missing\", \"image\"], \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "5.5.0+galaxy0", "type": "tool", "uuid": "bc06da8e-e5cb-493e-98d1-c974a3e46cff", "when": null, "workflow_outputs": [ - { - "label": "Busco Summary Image Hap1", - "output_name": "summary_image", - "uuid": "783cb816-dead-4035-911f-d4dd7590efbf" - }, { "label": "Busco Summary Hap1", "output_name": "busco_sum", "uuid": "bb3f3b2b-d455-4c53-a4b4-044bd4a90c7a" + }, + { + "label": "Busco Summary Image Hap1", + "output_name": "summary_image", + "uuid": "783cb816-dead-4035-911f-d4dd7590efbf" } ] }, "24": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.3.2+galaxy0", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.5.0+galaxy0", "errors": null, "id": 24, "input_connections": { @@ -1158,7 +1248,12 @@ "output_name": "output" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Busco", + "name": "input" + } + ], "label": null, "name": "Busco", "outputs": [ @@ -1213,15 +1308,15 @@ "output_name": "summary_image" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.3.2+galaxy0", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.5.0+galaxy0", "tool_shed_repository": { - "changeset_revision": "41030a6c03b7", + "changeset_revision": "2a5b8b9936bf", "name": "busco", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"adv\": {\"evalue\": \"0.001\", \"limit\": \"3\"}, \"busco_mode\": {\"mode\": \"geno\", \"__current_case__\": 0, \"use_augustus\": {\"use_augustus_selector\": \"no\", \"__current_case__\": 0}}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"lineage\": {\"lineage_mode\": \"select_lineage\", \"__current_case__\": 1, \"lineage_dataset\": \"vertebrata_odb10\"}, \"outputs\": [\"short_summary\", \"missing\", \"image\"], \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "5.3.2+galaxy0", + "tool_state": "{\"adv\": {\"evalue\": \"0.001\", \"limit\": \"3\", \"contig_break\": \"10\"}, \"busco_mode\": {\"mode\": \"geno\", \"__current_case__\": 0, \"miniprot\": false, \"use_augustus\": {\"use_augustus_selector\": \"no\", \"__current_case__\": 0}}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"lineage\": {\"lineage_mode\": \"select_lineage\", \"__current_case__\": 1, \"lineage_dataset\": \"vertebrata_odb10\"}, \"lineage_conditional\": {\"selector\": \"download\", \"__current_case__\": 1}, \"outputs\": [\"short_summary\", \"missing\", \"image\"], \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "5.5.0+galaxy0", "type": "tool", "uuid": "4931c626-b636-43c3-b19b-3c778199b9a8", "when": null, @@ -1240,7 +1335,7 @@ }, "25": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/merqury/merqury/1.3+galaxy2", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/merqury/merqury/1.3+galaxy3", "errors": null, "id": 25, "input_connections": { @@ -1265,7 +1360,20 @@ "output_name": "output" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Merqury", + "name": "mode" + }, + { + "description": "runtime parameter for tool Merqury", + "name": "mode" + }, + { + "description": "runtime parameter for tool Merqury", + "name": "mode" + } + ], "label": null, "name": "Merqury", "outputs": [ @@ -1351,15 +1459,15 @@ "output_name": "stats_files" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/merqury/merqury/1.3+galaxy2", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/merqury/merqury/1.3+galaxy3", "tool_shed_repository": { - "changeset_revision": "f8113c25bc6b", + "changeset_revision": "09c589057ee8", "name": "merqury", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, "tool_state": "{\"label\": \"output_merqury\", \"mode\": {\"options\": \"trio\", \"__current_case__\": 1, \"meryldb_F1\": {\"__class__\": \"ConnectedValue\"}, \"meryldb_PAT\": {\"__class__\": \"ConnectedValue\"}, \"meryldb_MAT\": {\"__class__\": \"ConnectedValue\"}, \"assembly_options\": {\"number_assemblies\": \"two\", \"__current_case__\": 1, \"assembly_01\": {\"__class__\": \"ConnectedValue\"}, \"assembly_02\": {\"__class__\": \"ConnectedValue\"}}}, \"output_add_headers\": true, \"output_selector\": [\"qv\", \"plots\", \"sizes\", \"stats\", \"bed\", \"wig\", \"log\"], \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "1.3+galaxy2", + "tool_version": "1.3+galaxy3", "type": "tool", "uuid": "25a1c5c3-56b1-490a-b73e-ad8cd94c1c26", "when": null, @@ -1392,6 +1500,7 @@ "subworkflow": { "a_galaxy_workflow": "true", "annotation": "", + "comments": [], "format-version": "0.1", "name": "gfastats_data_prep", "steps": { @@ -1433,7 +1542,12 @@ "output_name": "output" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Sort", + "name": "input" + } + ], "label": null, "name": "Sort", "outputs": [ @@ -1472,7 +1586,12 @@ "output_name": "out_file1" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Text reformatting", + "name": "infile" + } + ], "label": null, "name": "Text reformatting", "outputs": [ @@ -1508,7 +1627,7 @@ }, "3": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.1.0+galaxy2", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.8+galaxy0", "errors": null, "id": 3, "input_connections": { @@ -1517,7 +1636,12 @@ "output_name": "outfile" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Datamash", + "name": "in_file" + } + ], "label": null, "name": "Datamash", "outputs": [ @@ -1537,15 +1661,15 @@ "output_name": "out_file" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.1.0+galaxy2", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.8+galaxy0", "tool_shed_repository": { - "changeset_revision": "746e8e4bf929", + "changeset_revision": "4c07ddedc198", "name": "datamash_ops", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, "tool_state": "{\"grouping\": \"\", \"header_in\": false, \"header_out\": false, \"ignore_case\": false, \"in_file\": {\"__class__\": \"ConnectedValue\"}, \"narm\": false, \"need_sort\": false, \"operations\": [{\"__index__\": 0, \"op_name\": \"absmax\", \"op_column\": \"3\"}], \"print_full_line\": false, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "1.1.0+galaxy2", + "tool_version": "1.8+galaxy0", "type": "tool", "uuid": "5c3447fa-bf5d-42b9-8aab-6b80c8da3dda", "when": null, @@ -1553,7 +1677,7 @@ }, "4": { "annotation": "", - "content_id": "addValue", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1", "errors": null, "id": 4, "input_connections": { @@ -1562,7 +1686,12 @@ "output_name": "outfile" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Add column", + "name": "input" + } + ], "label": null, "name": "Add column", "outputs": [ @@ -1582,9 +1711,15 @@ "output_name": "out_file1" } }, - "tool_id": "addValue", + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1", + "tool_shed_repository": { + "changeset_revision": "023f0a3760b3", + "name": "add_value", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, "tool_state": "{\"exp\": \"1\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"iterate\": \"yes\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "1.0.0", + "tool_version": "1.0.1", "type": "tool", "uuid": "4b662ba7-bc49-4259-a7fa-dfdcf1616dea", "when": null, @@ -1601,7 +1736,12 @@ "output_name": "out_file" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Parse parameter value", + "name": "input1" + } + ], "label": null, "name": "Parse parameter value", "outputs": [ @@ -1723,7 +1863,7 @@ "owner": "devteam", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"avoid_scientific_notation\": false, \"error_handling\": {\"auto_col_types\": true, \"fail_on_non_existent_columns\": true, \"non_computable\": {\"action\": \"--fail-on-non-computable\", \"__current_case__\": 0}}, \"input\": {\"__class__\": \"RuntimeValue\"}, \"ops\": {\"header_lines_select\": \"no\", \"__current_case__\": 0, \"expressions\": [{\"__index__\": 0, \"cond\": {\"__class__\": \"ConnectedValue\"}, \"add_column\": {\"mode\": \"\", \"__current_case__\": 0, \"pos\": \"\"}}, {\"__index__\": 1, \"cond\": \"c2/1000000\", \"add_column\": {\"mode\": \"\", \"__current_case__\": 0, \"pos\": \"\"}}, {\"__index__\": 2, \"cond\": \"c3/1000000\", \"add_column\": {\"mode\": \"\", \"__current_case__\": 0, \"pos\": \"\"}}]}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"avoid_scientific_notation\": false, \"error_handling\": {\"auto_col_types\": true, \"fail_on_non_existent_columns\": true, \"non_computable\": {\"action\": \"--fail-on-non-computable\", \"__current_case__\": 0}}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"ops\": {\"header_lines_select\": \"no\", \"__current_case__\": 0, \"expressions\": [{\"__index__\": 0, \"cond\": {\"__class__\": \"ConnectedValue\"}, \"add_column\": {\"mode\": \"\", \"__current_case__\": 0, \"pos\": \"\"}}, {\"__index__\": 1, \"cond\": \"c2/1000000\", \"add_column\": {\"mode\": \"\", \"__current_case__\": 0, \"pos\": \"\"}}, {\"__index__\": 2, \"cond\": \"c3/1000000\", \"add_column\": {\"mode\": \"\", \"__current_case__\": 0, \"pos\": \"\"}}]}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "2.0", "type": "tool", "uuid": "bc2c5737-d84f-4347-85ec-a1291e21eee7", @@ -1738,7 +1878,7 @@ } }, "tags": "", - "uuid": "d1260f25-be3a-4dbc-9fd2-e53901b13249" + "uuid": "f124d066-c71b-4d2a-8a67-a6fb2c48ccf4" }, "tool_id": null, "type": "subworkflow", @@ -1767,6 +1907,7 @@ "subworkflow": { "a_galaxy_workflow": "true", "annotation": "", + "comments": [], "format-version": "0.1", "name": "gfastats_data_prep", "steps": { @@ -1808,7 +1949,12 @@ "output_name": "output" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Sort", + "name": "input" + } + ], "label": null, "name": "Sort", "outputs": [ @@ -1847,7 +1993,12 @@ "output_name": "out_file1" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Text reformatting", + "name": "infile" + } + ], "label": null, "name": "Text reformatting", "outputs": [ @@ -1883,7 +2034,7 @@ }, "3": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.1.0+galaxy2", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.8+galaxy0", "errors": null, "id": 3, "input_connections": { @@ -1892,7 +2043,12 @@ "output_name": "outfile" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Datamash", + "name": "in_file" + } + ], "label": null, "name": "Datamash", "outputs": [ @@ -1912,15 +2068,15 @@ "output_name": "out_file" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.1.0+galaxy2", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.8+galaxy0", "tool_shed_repository": { - "changeset_revision": "746e8e4bf929", + "changeset_revision": "4c07ddedc198", "name": "datamash_ops", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, "tool_state": "{\"grouping\": \"\", \"header_in\": false, \"header_out\": false, \"ignore_case\": false, \"in_file\": {\"__class__\": \"ConnectedValue\"}, \"narm\": false, \"need_sort\": false, \"operations\": [{\"__index__\": 0, \"op_name\": \"absmax\", \"op_column\": \"3\"}], \"print_full_line\": false, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "1.1.0+galaxy2", + "tool_version": "1.8+galaxy0", "type": "tool", "uuid": "c29a59e2-11d8-415f-989f-756ddfe1bb94", "when": null, @@ -1928,7 +2084,7 @@ }, "4": { "annotation": "", - "content_id": "addValue", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1", "errors": null, "id": 4, "input_connections": { @@ -1937,7 +2093,12 @@ "output_name": "outfile" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Add column", + "name": "input" + } + ], "label": null, "name": "Add column", "outputs": [ @@ -1957,9 +2118,15 @@ "output_name": "out_file1" } }, - "tool_id": "addValue", + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1", + "tool_shed_repository": { + "changeset_revision": "023f0a3760b3", + "name": "add_value", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, "tool_state": "{\"exp\": \"1\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"iterate\": \"yes\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "1.0.0", + "tool_version": "1.0.1", "type": "tool", "uuid": "c455907e-6018-4b6c-8873-76f6ac866ebf", "when": null, @@ -1976,7 +2143,12 @@ "output_name": "out_file" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Parse parameter value", + "name": "input1" + } + ], "label": null, "name": "Parse parameter value", "outputs": [ @@ -2098,7 +2270,7 @@ "owner": "devteam", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"avoid_scientific_notation\": false, \"error_handling\": {\"auto_col_types\": true, \"fail_on_non_existent_columns\": true, \"non_computable\": {\"action\": \"--fail-on-non-computable\", \"__current_case__\": 0}}, \"input\": {\"__class__\": \"RuntimeValue\"}, \"ops\": {\"header_lines_select\": \"no\", \"__current_case__\": 0, \"expressions\": [{\"__index__\": 0, \"cond\": {\"__class__\": \"ConnectedValue\"}, \"add_column\": {\"mode\": \"\", \"__current_case__\": 0, \"pos\": \"\"}}, {\"__index__\": 1, \"cond\": \"c2/1000000\", \"add_column\": {\"mode\": \"\", \"__current_case__\": 0, \"pos\": \"\"}}, {\"__index__\": 2, \"cond\": \"c3/1000000\", \"add_column\": {\"mode\": \"\", \"__current_case__\": 0, \"pos\": \"\"}}]}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"avoid_scientific_notation\": false, \"error_handling\": {\"auto_col_types\": true, \"fail_on_non_existent_columns\": true, \"non_computable\": {\"action\": \"--fail-on-non-computable\", \"__current_case__\": 0}}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"ops\": {\"header_lines_select\": \"no\", \"__current_case__\": 0, \"expressions\": [{\"__index__\": 0, \"cond\": {\"__class__\": \"ConnectedValue\"}, \"add_column\": {\"mode\": \"\", \"__current_case__\": 0, \"pos\": \"\"}}, {\"__index__\": 1, \"cond\": \"c2/1000000\", \"add_column\": {\"mode\": \"\", \"__current_case__\": 0, \"pos\": \"\"}}, {\"__index__\": 2, \"cond\": \"c3/1000000\", \"add_column\": {\"mode\": \"\", \"__current_case__\": 0, \"pos\": \"\"}}]}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "2.0", "type": "tool", "uuid": "28afe0ea-6c13-49a8-99cc-ded6f1feeaca", @@ -2113,7 +2285,7 @@ } }, "tags": "", - "uuid": "7e5279bd-4e21-4f50-8d38-dd6f4e8bfc2b" + "uuid": "08b09014-aaf3-4059-8c6e-1c830ad2e2e3" }, "tool_id": null, "type": "subworkflow", @@ -2132,7 +2304,12 @@ "output_name": "out_file1" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Cut", + "name": "input" + } + ], "label": null, "name": "Cut", "outputs": [ @@ -2196,6 +2373,7 @@ "subworkflow": { "a_galaxy_workflow": "true", "annotation": "", + "comments": [], "creator": [ { "class": "Organization", @@ -2333,7 +2511,7 @@ }, "4": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.0", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1", "errors": null, "id": 4, "input_connections": { @@ -2346,7 +2524,16 @@ "output_name": "output" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Add column", + "name": "exp" + }, + { + "description": "runtime parameter for tool Add column", + "name": "input" + } + ], "label": null, "name": "Add column", "outputs": [ @@ -2366,15 +2553,15 @@ "output_name": "out_file1" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.0", + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1", "tool_shed_repository": { - "changeset_revision": "745871c0b055", + "changeset_revision": "023f0a3760b3", "name": "add_value", "owner": "devteam", "tool_shed": "toolshed.g2.bx.psu.edu" }, "tool_state": "{\"exp\": {\"__class__\": \"ConnectedValue\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"iterate\": \"no\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "1.0.0", + "tool_version": "1.0.1", "type": "tool", "uuid": "a3bec00c-fdd6-4e7e-9335-9a24656fb7c3", "when": null, @@ -2382,7 +2569,7 @@ }, "5": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.0", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1", "errors": null, "id": 5, "input_connections": { @@ -2395,7 +2582,16 @@ "output_name": "output" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Add column", + "name": "exp" + }, + { + "description": "runtime parameter for tool Add column", + "name": "input" + } + ], "label": null, "name": "Add column", "outputs": [ @@ -2415,15 +2611,15 @@ "output_name": "out_file1" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.0", + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1", "tool_shed_repository": { - "changeset_revision": "745871c0b055", + "changeset_revision": "023f0a3760b3", "name": "add_value", "owner": "devteam", "tool_shed": "toolshed.g2.bx.psu.edu" }, "tool_state": "{\"exp\": {\"__class__\": \"ConnectedValue\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"iterate\": \"no\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "1.0.0", + "tool_version": "1.0.1", "type": "tool", "uuid": "0c2f2aaa-f1dd-4272-96b5-99d1d213b079", "when": null, @@ -2444,7 +2640,12 @@ "output_name": "out_file1" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Concatenate datasets", + "name": "inputs" + } + ], "label": null, "name": "Concatenate datasets", "outputs": [ @@ -2489,7 +2690,12 @@ "output_name": "out_file1" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Cut", + "name": "input" + } + ], "label": null, "name": "Cut", "outputs": [ @@ -2528,7 +2734,12 @@ "output_name": "out_file1" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Cut", + "name": "input" + } + ], "label": null, "name": "Cut", "outputs": [ @@ -2558,7 +2769,7 @@ }, "9": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/ggplot2_point/ggplot2_point/3.4.0+galaxy0", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/ggplot2_point/ggplot2_point/3.4.0+galaxy1", "errors": null, "id": 9, "input_connections": { @@ -2601,15 +2812,15 @@ "output_name": "output1" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/ggplot2_point/ggplot2_point/3.4.0+galaxy0", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/ggplot2_point/ggplot2_point/3.4.0+galaxy1", "tool_shed_repository": { - "changeset_revision": "5fe1dc76176e", + "changeset_revision": "3b12bf9b4b87", "name": "ggplot2_point", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"adv\": {\"type_conditional\": {\"type_options\": \"lines\", \"__current_case__\": 2}, \"factor\": {\"factoring\": \"Single\", \"__current_case__\": 1, \"factorcol\": \"1\", \"colors\": \"Set1\", \"colororder\": \"1\"}, \"axis_title_customization\": {\"axis_customization\": \"default\", \"__current_case__\": 0}, \"axis_text_customization\": {\"axis_customization\": \"default\", \"__current_case__\": 0}, \"plot_title_customization\": {\"axis_customization\": \"default\", \"__current_case__\": 0}, \"gridlinecust\": \"default\", \"transform\": \"none\", \"scaling\": {\"plot_scaling\": \"Automatic\", \"__current_case__\": 0}, \"theme\": \"bw\", \"legend\": \"yes\"}, \"input1\": {\"__class__\": \"RuntimeValue\"}, \"out\": {\"unit_output_dim\": \"in\", \"width_output_dim\": \"6.0\", \"height_output_dim\": \"4.0\", \"dpi_output_dim\": \"300.0\", \"additional_output_format\": \"none\"}, \"title\": \"\", \"xlab\": \"x\", \"xplot\": \"2\", \"ylab\": \"Nx (Mb)\", \"yplot\": \"3\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "3.4.0+galaxy0", + "tool_state": "{\"adv\": {\"type_conditional\": {\"type_options\": \"lines\", \"__current_case__\": 2}, \"factor\": {\"factoring\": \"Single\", \"__current_case__\": 1, \"factorcol\": \"1\", \"colors\": \"Set1\", \"colororder\": \"1\"}, \"axis_title_customization\": {\"axis_customization\": \"default\", \"__current_case__\": 0}, \"axis_text_customization\": {\"axis_customization\": \"default\", \"__current_case__\": 0}, \"plot_title_customization\": {\"axis_customization\": \"default\", \"__current_case__\": 0}, \"gridlinecust\": \"default\", \"transform\": \"none\", \"scaling\": {\"plot_scaling\": \"Automatic\", \"__current_case__\": 0}, \"theme\": \"bw\", \"legend\": \"yes\"}, \"input1\": {\"__class__\": \"ConnectedValue\"}, \"out\": {\"unit_output_dim\": \"in\", \"width_output_dim\": \"6.0\", \"height_output_dim\": \"4.0\", \"dpi_output_dim\": \"300.0\", \"additional_output_format\": \"none\"}, \"title\": \"\", \"xlab\": \"x\", \"xplot\": \"2\", \"ylab\": \"Nx (Mb)\", \"yplot\": \"3\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "3.4.0+galaxy1", "type": "tool", "uuid": "79e4b8a2-c9bf-4cf0-b943-7de18ec50ed6", "when": null, @@ -2623,7 +2834,7 @@ }, "10": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/ggplot2_point/ggplot2_point/3.4.0+galaxy0", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/ggplot2_point/ggplot2_point/3.4.0+galaxy1", "errors": null, "id": 10, "input_connections": { @@ -2666,15 +2877,15 @@ "output_name": "output1" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/ggplot2_point/ggplot2_point/3.4.0+galaxy0", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/ggplot2_point/ggplot2_point/3.4.0+galaxy1", "tool_shed_repository": { - "changeset_revision": "5fe1dc76176e", + "changeset_revision": "3b12bf9b4b87", "name": "ggplot2_point", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"adv\": {\"type_conditional\": {\"type_options\": \"lines\", \"__current_case__\": 2}, \"factor\": {\"factoring\": \"Single\", \"__current_case__\": 1, \"factorcol\": \"1\", \"colors\": \"Set1\", \"colororder\": \"1\"}, \"axis_title_customization\": {\"axis_customization\": \"default\", \"__current_case__\": 0}, \"axis_text_customization\": {\"axis_customization\": \"default\", \"__current_case__\": 0}, \"plot_title_customization\": {\"axis_customization\": \"default\", \"__current_case__\": 0}, \"gridlinecust\": \"default\", \"transform\": \"none\", \"scaling\": {\"plot_scaling\": \"Automatic\", \"__current_case__\": 0}, \"theme\": \"bw\", \"legend\": \"yes\"}, \"input1\": {\"__class__\": \"RuntimeValue\"}, \"out\": {\"unit_output_dim\": \"in\", \"width_output_dim\": \"6.0\", \"height_output_dim\": \"4.0\", \"dpi_output_dim\": \"300.0\", \"additional_output_format\": \"none\"}, \"title\": \"\", \"xlab\": \"Scaffold number\", \"xplot\": \"2\", \"ylab\": \"Cumulative Size (Mb)\", \"yplot\": \"3\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "3.4.0+galaxy0", + "tool_state": "{\"adv\": {\"type_conditional\": {\"type_options\": \"lines\", \"__current_case__\": 2}, \"factor\": {\"factoring\": \"Single\", \"__current_case__\": 1, \"factorcol\": \"1\", \"colors\": \"Set1\", \"colororder\": \"1\"}, \"axis_title_customization\": {\"axis_customization\": \"default\", \"__current_case__\": 0}, \"axis_text_customization\": {\"axis_customization\": \"default\", \"__current_case__\": 0}, \"plot_title_customization\": {\"axis_customization\": \"default\", \"__current_case__\": 0}, \"gridlinecust\": \"default\", \"transform\": \"none\", \"scaling\": {\"plot_scaling\": \"Automatic\", \"__current_case__\": 0}, \"theme\": \"bw\", \"legend\": \"yes\"}, \"input1\": {\"__class__\": \"ConnectedValue\"}, \"out\": {\"unit_output_dim\": \"in\", \"width_output_dim\": \"6.0\", \"height_output_dim\": \"4.0\", \"dpi_output_dim\": \"300.0\", \"additional_output_format\": \"none\"}, \"title\": \"\", \"xlab\": \"Scaffold number\", \"xplot\": \"2\", \"ylab\": \"Cumulative Size (Mb)\", \"yplot\": \"3\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "3.4.0+galaxy1", "type": "tool", "uuid": "350f3535-47b5-4870-9f09-1be8f702bc23", "when": null, @@ -2688,22 +2899,32 @@ } }, "tags": "", - "uuid": "5f8e9ab5-422b-4ba3-b229-097d7df19196" + "uuid": "22895536-52d7-4411-9309-962e3ab20456" }, "tool_id": null, "type": "subworkflow", "uuid": "bc14963b-acf4-4064-ad92-fbf7cad3730f", "when": null, "workflow_outputs": [ - { - "label": "Size Plot", - "output_name": "Size Plot", - "uuid": "044f639b-f8f9-44b9-85b0-bbea417e4af7" - }, { "label": "Nx Plot", "output_name": "Nx Plot", "uuid": "4235c91f-2071-483e-b905-bed50bc53b05" + }, + { + "label": null, + "output_name": "3:output", + "uuid": "f7e65b5f-a315-482e-910c-3d41279a3b59" + }, + { + "label": null, + "output_name": "2:output", + "uuid": "2530c4c5-5f68-48a4-9da1-c86696f84a1f" + }, + { + "label": "Size Plot", + "output_name": "Size Plot", + "uuid": "044f639b-f8f9-44b9-85b0-bbea417e4af7" } ] }, @@ -2718,7 +2939,12 @@ "output_name": "out_file1" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Parse parameter value", + "name": "input1" + } + ], "label": "Estimated genome size", "name": "Parse parameter value", "outputs": [ @@ -2776,7 +3002,12 @@ "output_name": "integer_param" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool gfastats", + "name": "input_file" + } + ], "label": null, "name": "gfastats", "outputs": [ @@ -2827,7 +3058,12 @@ "output_name": "integer_param" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool gfastats", + "name": "input_file" + } + ], "label": null, "name": "gfastats", "outputs": [ @@ -2874,7 +3110,12 @@ "output_name": "stats" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Text reformatting", + "name": "infile" + } + ], "label": null, "name": "Text reformatting", "outputs": [ @@ -2919,7 +3160,12 @@ "output_name": "stats" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Text reformatting", + "name": "infile" + } + ], "label": null, "name": "Text reformatting", "outputs": [ @@ -2968,7 +3214,16 @@ "output_name": "outfile" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Join", + "name": "infile1" + }, + { + "description": "runtime parameter for tool Join", + "name": "infile2" + } + ], "label": null, "name": "Join", "outputs": [ @@ -3015,6 +3270,6 @@ "VGP", "Reviewed" ], - "uuid": "40055311-3397-4b47-951a-3c604dae8bd0", + "uuid": "0db51f45-52e7-4f61-a619-11af3d4f5219", "version": 2 -} \ No newline at end of file +} diff --git a/workflows/VGP-assembly-v2/Assembly-Hifi-Trio-phasing-VGP5/CHANGELOG.md b/workflows/VGP-assembly-v2/Assembly-Hifi-Trio-phasing-VGP5/CHANGELOG.md index bf58ef431..639095cf8 100644 --- a/workflows/VGP-assembly-v2/Assembly-Hifi-Trio-phasing-VGP5/CHANGELOG.md +++ b/workflows/VGP-assembly-v2/Assembly-Hifi-Trio-phasing-VGP5/CHANGELOG.md @@ -1,9 +1,23 @@ # Changelog + + +## [0.1.2] 2023-11-14 + +### Automatic update +- `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.0+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.4+galaxy0` +- `toolshed.g2.bx.psu.edu/repos/bgruening/hifiasm/hifiasm/0.16.1+galaxy4` was updated to `toolshed.g2.bx.psu.edu/repos/bgruening/hifiasm/hifiasm/0.19.8+galaxy0` +- `toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.3.2+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.4.6+galaxy0` +- `toolshed.g2.bx.psu.edu/repos/iuc/merqury/merqury/1.3+galaxy2` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/merqury/merqury/1.3+galaxy3` +- `toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.1.0+galaxy2` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.8+galaxy0` +- `toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.0` was updated to `toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1` +- `toolshed.g2.bx.psu.edu/repos/iuc/ggplot2_point/ggplot2_point/3.4.0+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/ggplot2_point/ggplot2_point/3.4.0+galaxy1` + ## [0.1.1] 2023-11-20 - Fix author in dockstore + ## [0.1] - 2023-09-27 Creation of workflow for Trio assembly.