Merge pull request #184 from planemo-autoupdate/workflows/epigenetics…

…/cutandrun

Updating workflows/epigenetics/cutandrun from 0.3 to 0.4

workflows/epigenetics/cutandrun/CHANGELOG.md

@@ -1,5 +1,14 @@
 # Changelog
 
+## [0.4] 2023-03-17
+
+### Automatic update
+- `toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/2.18.2.3` was updated to `toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/2.18.2.4`
+- `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.0+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.4+galaxy0`
+
+### Manual update
+- New parameter to get normalized profile
+
 ## [0.3] 2022-12-17
 
 ### Automatic update

workflows/epigenetics/cutandrun/README.md

@@ -9,6 +9,7 @@
 - adapter sequences: this depends on the library preparation. Usually CUT&RUN is Truseq and CUT&TAG is Nextera. If you don't know, use FastQC to determine if it is Truseq or Nextera
 - reference_genome: this field will be adapted to the genomes available for bowtie2
 - effective_genome_size: this is used by macs2 and may be entered manually (indications are provided for heavily used genomes)
+- normalize_profile: Whether you want to have a profile normalized as Signal to Million Reads.
 
 ## Processing
 
@@ -17,10 +18,6 @@
 - The BAM is filtered to keep only MAPQ30 and concordant pairs
 - The PCR duplicates are removed with Picard
 - The BAM is converted to BED to enable macs2 to take both pairs into account
-- The peaks are called with macs2 which at the same time generates a coverage file.
+- The peaks are called with macs2 which at the same time generates a coverage file (normalized or not).
 - The coverage file is converted to bigwig
 - A multiQC is run to have an overview of the QC
-
-### Warning
-
-- The coverage output is not normalized.

workflows/epigenetics/cutandrun/cutandrun-tests.yml

@@ -20,6 +20,7 @@
     adapter_reverse: 'GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT'
     reference_genome: 'hg38canon'
     effective_genome_size: 2700000000
+    normalize_profile: false
   outputs:
     Mapping stats:
       element_tests:
@@ -82,6 +83,7 @@
     adapter_reverse: 'GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT'
     reference_genome: 'dm6'
     effective_genome_size: 120000000
+    normalize_profile: true
   outputs:
     Mapping stats:
       element_tests: