Updating workflows/VGP-assembly-v2/Assembly-Hifi-Trio-phasing-VGP5 from 0.2 to 0.3 #508

gxydevbot · 2024-08-19T04:18:16Z

Hello! This is an automated update of the following workflow: workflows/VGP-assembly-v2/Assembly-Hifi-Trio-phasing-VGP5. I created this PR because I think one or more of the component tools are out of date, i.e. there is a newer version available on the ToolShed.

By comparing with the latest versions available on the ToolShed, it seems the following tools are outdated:

toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cut_tool/9.3+galaxy1 should be updated to toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cut_tool/9.3+galaxy2

The workflow release number has been updated from 0.2 to 0.3.

gxydevbot · 2024-08-22T15:37:53Z

There are new updates, if you want to integrate them, close the PR and delete branch.

gxydevbot · 2024-08-26T04:17:01Z

There are new updates, if you want to integrate them, close the PR and delete branch.

gxydevbot · 2024-09-02T04:16:56Z

There are new updates, if you want to integrate them, close the PR and delete branch.

gxydevbot · 2024-09-09T04:17:48Z

There are new updates, if you want to integrate them, close the PR and delete branch.

gxydevbot · 2024-09-16T04:17:39Z

There are new updates, if you want to integrate them, close the PR and delete branch.

gxydevbot · 2024-09-23T04:17:58Z

There are new updates, if you want to integrate them, close the PR and delete branch.

gxydevbot · 2024-09-23T13:56:44Z

There are new updates, they have been integrated to the PR, check the file diff.

github-actions · 2024-09-23T15:07:46Z

Test Results (powered by Planemo)

Test Summary

Test State	Count
Total	1
Passed	0
Error	0
Failure	1
Skipped	0

Failed Tests

❌ Assembly-Hifi-Trio-phasing-VGP5.ga_0

Problems:

Output with path /tmp/tmpgflajrrb/Busco on data 40 short summary__b9fa920c-2d58-446e-ad62-233b5474ec75 different than expected
Expected text 'C:1.2%[S:1.2%,D:0.0%],F:0.4%,M:98.4%,n:3354' in output ('# BUSCO version is: 5.7.1 
# The lineage dataset is: vertebrata_odb10 (Creation date: 2021-02-19, number of genomes: 67, number of BUSCOs: 3354)
# Summarized benchmarking in BUSCO notation for file /tmp/tmp_al32c6n/files/c/b/4/dataset_cb49370b-0a27-4735-b190-8e30c8d23783.dat
# BUSCO was run in mode: euk_genome_min
# Gene predictor used: miniprot

	***** Results: *****

	C:1.2%[S:1.2%,D:0.0%],F:0.1%,M:98.7%,n:3354,E:5.0%	   
	40	Complete BUSCOs (C)	(of which 2 contain internal stop codons)		   
	39	Complete and single-copy BUSCOs (S)	   
	1	Complete and duplicated BUSCOs (D)	   
	4	Fragmented BUSCOs (F)			   
	3310	Missing BUSCOs (M)			   
	3354	Total BUSCO groups searched		   

Assembly Statistics:
	85	Number of scaffolds
	85	Number of contigs
	2065905	Total length
	0.000%	Percent gaps
	22 KB	Scaffold N50
	22 KB	Contigs N50


Dependencies and versions:
	hmmsearch: 3.1
	bbtools: None
	miniprot_index: 0.13-r248
	miniprot_align: 0.13-r248
	python: sys.version_info(major=3, minor=9, micro=19, releaselevel='final', serial=0)
	busco: 5.7.1
')

Workflow invocation details

Invocation Messages

Steps

Step 1: Pacbio Reads Collection : child:
- step_state: scheduled
Step 2: Paternal Illumina reads (hap1):
- step_state: scheduled
Step 11: Genomescope Model Parameters:
- step_state: scheduled
Step 12: Genomescope Summary:
- step_state: scheduled
Step 13: Utilize homology information to correct trio-phasing errors:
- step_state: scheduled
Step 14: SAK input file (Optional):
- step_state: scheduled
Step 15: Name for Haplotype 1:
- step_state: scheduled
Step 16: Name for Haplotype 2:
- step_state: scheduled

Step 17: toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.9+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -f -s '/tmp/tmp_al32c6n/files/e/7/4/dataset_e74a60a7-cee1-4d36-b5a5-cf7f81b9d863.dat' 'yeast_reads_sub1_fastq_gz.fq.gz' &&  cutadapt  -j=${GALAXY_SLOTS:-4}   -b 'ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT'   -b 'ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT'    --error-rate=0.1 --times=1 --overlap=35    --action=trim --rc     --discard-trimmed   --minimum-length=1      --json=stats.json -o 'out1.fq.gz'  'yeast_reads_sub1_fastq_gz.fq.gz'  > report.txt

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"74c13e1c79b911efbd596928d263019d"`
adapter_options	`{"action": "trim", "error_rate": "0.1", "match_read_wildcards": false, "no_indels": false, "no_match_adapter_wildcards": true, "overlap": "35", "revcomp": true, "times": "1"}`
chromInfo	`"/tmp/tmp_al32c6n/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter_options	`{"discard_casava": false, "discard_trimmed": true, "discard_untrimmed": false, "max_average_error_rate": null, "max_expected_errors": null, "max_n": null, "maximum_length": null, "maximum_length2": null, "minimum_length": "1", "minimum_length2": null, "pair_filter": "any"}`
library	{"__current_case__": 0, "input_1": {"values": [{"id": 1, "src": "dce"}]}, "r1": {"adapters": [], "anywhere_adapters": [{"__index__": 0, "adapter_source": {"__current_case__": 0, "adapter": "ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT", "adapter_name": "", "adapter_source_list": "user"}, "single_noindels": false}, {"__index__": 1, "adapter_source": {"__current_case__": 0, "adapter": "ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT", "adapter_name": "", "adapter_source_list": "user"}, "single_noindels": false}], "front_adapters": []}, "type": "single"}
other_trimming_options	`{"cut": "0", "cut2": "0", "nextseq_trim": "0", "poly_a": false, "quality_cutoff": "0", "quality_cutoff2": "", "shorten_options": {"__current_case__": 1, "shorten_values": "False"}, "shorten_options_r2": {"__current_case__": 1, "shorten_values_r2": "False"}, "trim_n": false}`
output_selector	`["json_stats", "report"]`
read_mod_options	`{"length_tag": "", "rename": "", "strip_suffix": "", "zero_cap": false}`

Step 18: toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types float,float,float,float,float,int  --file '/tmp/tmp_al32c6n/job_working_directory/000/12/configs/tmpt4ikxo5x' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmp_al32c6n/files/4/e/9/dataset_4e9ace96-99b5-4fec-bf2c-c8b731139334.dat' '/tmp/tmp_al32c6n/job_working_directory/000/12/outputs/dataset_7692b241-60ce-4030-9a59-8605d148725e.dat'

Exit Code:

```
0
```

Standard Output:

c3*2
Computing 1 new columns with instructions ['c3*2;;']
Computed new column values for 100.00% of 1 lines written.

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"74c13e1c79b911efbd596928d263019d"`
avoid_scientific_notation	`false`
chromInfo	`"/tmp/tmp_al32c6n/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
error_handling	`{"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}}`
ops	`{"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3*2"}], "header_lines_select": "no"}`

Step 19: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

grep -G -A 0 -B 0 --no-group-separator  -i -- 'Haploid' '/tmp/tmp_al32c6n/files/d/c/1/dataset_dc113fea-9a0a-4f02-84f0-10c8b1685c3f.dat' > '/tmp/tmp_al32c6n/job_working_directory/000/13/outputs/dataset_57af9833-85dd-4283-9ed8-d5e992978172.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"74c13e1c79b911efbd596928d263019d"`
case_sensitive	`"-i"`
chromInfo	`"/tmp/tmp_al32c6n/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
color	`"NOCOLOR"`
dbkey	`"?"`
invert	`""`
lines_after	`"0"`
lines_before	`"0"`
regex_type	`"-G"`
url_paste	`"Haploid"`

Step 20: toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

die() { echo "$@" 1>&2 ; exit 1; } &&  mkdir multiqc_WDir &&   mkdir multiqc_WDir/cutadapt_0 &&     ln -s '/tmp/tmp_al32c6n/files/3/e/6/dataset_3e6ddfce-1f22-4211-8409-9155c64a397f.dat' 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' && sed -i.old 's/You are running/This is/' 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' && grep -q "This is cutadapt" 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' || die "'This is cutadapt' or 'You are running cutadapt' not found in the file" &&   multiqc multiqc_WDir --filename 'report'       && mkdir -p ./plots && ls -l ./report_data/ && cp ./report_data/*plot*.txt ./plots/ | true

Exit Code:

```
0
```

Standard Error:

/// MultiQC 🔍 v1.24.1

     version_check | MultiQC Version v1.25 now available!
       file_search | Search path: /tmp/tmp_al32c6n/job_working_directory/000/14/working/multiqc_WDir

          cutadapt | Found 1 reports

     write_results | Data        : report_data
     write_results | Report      : report.html
           multiqc | MultiQC complete

Standard Output:

total 72
-rw-r--r-- 1 1001 127    93 Sep 23 14:39 cutadapt_filtered_reads_plot.txt
-rw-r--r-- 1 1001 127    66 Sep 23 14:39 cutadapt_trimmed_sequences_plot_default_Counts.txt
-rw-r--r-- 1 1001 127    70 Sep 23 14:39 cutadapt_trimmed_sequences_plot_default_Obs_Exp.txt
-rw-r--r-- 1 1001 127   124 Sep 23 14:39 multiqc_citations.txt
-rw-r--r-- 1 1001 127   222 Sep 23 14:39 multiqc_cutadapt.txt
-rw-r--r-- 1 1001 127 39110 Sep 23 14:39 multiqc_data.json
-rw-r--r-- 1 1001 127   105 Sep 23 14:39 multiqc_general_stats.txt
-rw-r--r-- 1 1001 127    29 Sep 23 14:39 multiqc_software_versions.txt
-rw-r--r-- 1 1001 127   190 Sep 23 14:39 multiqc_sources.txt

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"74c13e1c79b911efbd596928d263019d"`
chromInfo	`"/tmp/tmp_al32c6n/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
comment	`""`
dbkey	`"?"`
export	`false`
flat	`false`
results	`[{"__index__": 0, "software_cond": {"__current_case__": 5, "input": {"values": [{"id": 5, "src": "hdca"}]}, "software": "cutadapt"}}]`
saveLog	`"false"`
title	`""`

Step 3: Maternal Illumina reads (hap2):
- step_state: scheduled

Step 21: Cut1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl '/tmp/tmp_al32c6n/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmp_al32c6n/files/7/6/9/dataset_7692b241-60ce-4030-9a59-8605d148725e.dat' 'c7' T '/tmp/tmp_al32c6n/job_working_directory/000/15/outputs/dataset_b471f5af-9bbd-4e90-b4b9-a14efdbbeba5.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"74c13e1c79b911efbd596928d263019d"`
chromInfo	`"/tmp/tmp_al32c6n/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
columnList	`"c7"`
dbkey	`"?"`
delimiter	`"T"`

Step 22: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

sed -r --sandbox -e 's/bp//g' -e 's/,//g' -e 's/([a-z])\s+([A-Z])/\1_\2/g' '/tmp/tmp_al32c6n/files/5/7/a/dataset_57af9833-85dd-4283-9ed8-d5e992978172.dat' > '/tmp/tmp_al32c6n/job_working_directory/000/16/outputs/dataset_027ebeaa-f022-491c-b59d-e337f1c4f2e6.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"74c13e1c79b911efbd596928d263019d"`
chromInfo	`"/tmp/tmp_al32c6n/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
replacements	`[{"__index__": 0, "find_pattern": "bp", "replace_pattern": ""}, {"__index__": 1, "find_pattern": ",", "replace_pattern": ""}, {"__index__": 2, "find_pattern": "([a-z])\\s+([A-Z])", "replace_pattern": "\\1_\\2"}]`

Step 23: param_value_from_file:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"74c13e1c79b911efbd596928d263019d"`
chromInfo	`"/tmp/tmp_al32c6n/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
param_type	`"integer"`
remove_newlines	`true`

Step 24: Convert characters1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python /tmp/tmp_al32c6n/galaxy-dev/tools/filters/convert_characters.py --strip --condense /tmp/tmp_al32c6n/files/0/2/7/dataset_027ebeaa-f022-491c-b59d-e337f1c4f2e6.dat s /tmp/tmp_al32c6n/job_working_directory/000/18/outputs/dataset_9e22d3fc-1092-44ec-8e74-cf695047214b.dat

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"txt"`
__workflow_invocation_uuid__	`"74c13e1c79b911efbd596928d263019d"`
chromInfo	`"/tmp/tmp_al32c6n/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
condense	`true`
convert_from	`"s"`
dbkey	`"?"`
strip	`true`

Step 25: Homozygous read coverage for Hifiasm:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"74c13e1c79b911efbd596928d263019d"`
chromInfo	`"/tmp/tmp_al32c6n/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
style_cond	`{"__current_case__": 0, "pick_style": "first", "type_cond": {"__current_case__": 1, "param_type": "integer", "pick_from": [{"__index__": 0, "value": null}, {"__index__": 1, "value": "21"}]}}`

Step 26: Cut1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl '/tmp/tmp_al32c6n/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmp_al32c6n/files/9/e/2/dataset_9e22d3fc-1092-44ec-8e74-cf695047214b.dat' 'c3' T '/tmp/tmp_al32c6n/job_working_directory/000/19/outputs/dataset_846a8114-8d03-4099-b6a1-d33f17562a87.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"74c13e1c79b911efbd596928d263019d"`
chromInfo	`"/tmp/tmp_al32c6n/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
columnList	`"c3"`
dbkey	`"?"`
delimiter	`"T"`

Step 27: toolshed.g2.bx.psu.edu/repos/bgruening/hifiasm/hifiasm/0.19.9+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -s '/tmp/tmp_al32c6n/files/d/1/0/dataset_d10b0ed3-bc73-4b59-b46a-0de2ab57d6b7.dat' input_0.fastq.gz &&  ln -s '/tmp/tmp_al32c6n/files/0/4/7/dataset_04743c1c-3f58-465e-b1c8-6c0d253035a0.dat' hap1_input_0.fastqsanger &&  ln -s '/tmp/tmp_al32c6n/files/3/d/f/dataset_3df51451-1cc8-4f36-805d-efc8876e5b29.dat' hap1_input_1.fastqsanger &&  ln -s '/tmp/tmp_al32c6n/files/6/5/e/dataset_65e81b44-3046-45e6-ad54-af9155f7fc43.dat' hap2_input_0.fastqsanger &&  ln -s '/tmp/tmp_al32c6n/files/f/1/0/dataset_f10638ac-f583-4ef3-b4b7-c8ab8f6945dc.dat' hap2_input_1.fastqsanger &&  yak count -k31 -b32 -t${GALAXY_SLOTS:-1} -o hap1.yak hap1_input_0.fastqsanger hap1_input_1.fastqsanger && yak count -k31 -b32 -t${GALAXY_SLOTS:-1} -o hap2.yak hap2_input_0.fastqsanger hap2_input_1.fastqsanger && hifiasm -t ${GALAXY_SLOTS:-1} -o output -f 32 -a 4 -z 0 -m 10000000 -p 100000 -n 3 -x 0.8 -y 0.2   --hom-cov 21 -1 hap1.yak -2 hap2.yak -c 2 -d 5 --trio-dual    --primary input_0.fastq.gz 2> output.log  && mkdir noseq_files && mv *.noseq.gfa noseq_files

Exit Code:

```
0
```

Standard Error:

[M::worker_pipeline::0.287*1.00] processed 10 sequences; 0 distinct k-mers in the hash table
[M::worker_pipeline::0.338*1.00] processed 10 sequences; 0 distinct k-mers in the hash table
[M::main_count] 0 distinct k-mers after shrinking
[M::yak_ch_dump] dumpped the hash table to file 'hap1.yak'.
[M::main] Version: 0.1-r56
[M::main] CMD: yak count -k31 -b32 -t1 -o hap1.yak hap1_input_0.fastqsanger hap1_input_1.fastqsanger
[M::main] Real time: 0.339 sec; CPU: 0.338 sec; Peak RSS: 0.506 GB
[M::worker_pipeline::0.273*1.00] processed 10 sequences; 0 distinct k-mers in the hash table
[M::worker_pipeline::0.329*0.99] processed 10 sequences; 0 distinct k-mers in the hash table
[M::main_count] 0 distinct k-mers after shrinking
[M::yak_ch_dump] dumpped the hash table to file 'hap2.yak'.
[M::main] Version: 0.1-r56
[M::main] CMD: yak count -k31 -b32 -t1 -o hap2.yak hap2_input_0.fastqsanger hap2_input_1.fastqsanger
[M::main] Real time: 0.330 sec; CPU: 0.327 sec; Peak RSS: 0.506 GB

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"fastq.gz"`
__workflow_invocation_uuid__	`"74c13e1c79b911efbd596928d263019d"`
advanced_options	`{"__current_case__": 0, "advanced_selector": "blank"}`
assembly_options	`{"__current_case__": 1, "adapter_length": "0", "assembly_selector": "set", "cleaning_rounds": "4", "disable_post_join": false, "hom_cov": "21", "ignore_error_corrected": false, "max_overlap": "0.8", "min_overlap": "0.2", "pop_contigs": "10000000", "pop_unitigs": "100000", "remove_tips": "3"}`
bins_out	`false`
chromInfo	`"/tmp/tmp_al32c6n/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter_bits	`"32"`
hic_partition	`{"__current_case__": 0, "hic_partition_selector": "blank"}`
log_out	`true`
mode	`{"__current_case__": 1, "max_kmers": "2", "min_kmers": "5", "mode_selector": "trio", "reads": {"values": [{"id": 4, "src": "hdca"}]}, "trio_dual": true, "trioinput": {"__current_case__": 0, "hap1_reads": {"values": [{"id": 2, "src": "hdca"}]}, "hap2_reads": {"values": [{"id": 3, "src": "hdca"}]}, "trio_input_selector": "reads"}, "yak_kmer_length": "31"}`
ont_integration	`{"__current_case__": 0, "ont_integration_selector": "blank"}`
purge_options	`{"__current_case__": 0, "purge_selector": "blank"}`
scaffolding_options	`{"__current_case__": 0, "scaffold_selector": "blank"}`

Step 28: Estimated genome size:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"74c13e1c79b911efbd596928d263019d"`
chromInfo	`"/tmp/tmp_al32c6n/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
param_type	`"integer"`
remove_newlines	`true`

Step 29: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmp_al32c6n/files/8/4/d/dataset_84d62027-d8c4-4513-b362-9e8667ea64ce.dat' --discover-paths -o dataset.gfa --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset

Exit Code:

```
0
```

Standard Output:

+++Assembly summary+++: 
# scaffolds: 85
Total scaffold length: 2065905
Average scaffold length: 24304.76
Scaffold N50: 22121
Scaffold auN: 34217.52
Scaffold L50: 30
Largest scaffold: 132637
Smallest scaffold: 11410
# contigs: 85
Total contig length: 2065905
Average contig length: 24304.76
Contig N50: 22121
Contig auN: 34217.52
Contig L50: 30
Largest contig: 132637
Smallest contig: 11410
# gaps in scaffolds: 0
Total gap length in scaffolds: 0
Average gap length in scaffolds: 0.00
Gap N50 in scaffolds: 0
Gap auN in scaffolds: 0.00
Gap L50 in scaffolds: 0
Largest gap in scaffolds: 0
Smallest gap in scaffolds: 0
Base composition (A:C:G:T): 630683:399587:403407:632228
GC content %: 38.87
# soft-masked bases: 0
# segments: 85
Total segment length: 2065905
Average segment length: 24304.76
# gaps: 0
# paths: 85
# edges: 4
Average degree: 0.05
# connected components: 1
Largest connected component length: 96577
# dead ends: 167
# disconnected components: 82
Total length disconnected components: 1969328
# separated components: 83
# bubbles: 0
# circular segments: 0

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"74c13e1c79b911efbd596928d263019d"`
chromInfo	`"/tmp/tmp_al32c6n/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 4, "out_format": "gfa", "terminal_overlaps_condition": {"__current_case__": 0, "terminal_overlaps_select": "no"}}, "selector": "manipulation", "sort": "", "swiss_army_knife": null}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 30: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmp_al32c6n/files/6/f/0/dataset_6f0544f3-99fb-4d4b-abf5-3e754e8b9956.dat' --discover-paths -o dataset.gfa --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset

Exit Code:

```
0
```

Standard Output:

+++Assembly summary+++: 
# scaffolds: 23
Total scaffold length: 730998
Average scaffold length: 31782.52
Scaffold N50: 25430
Scaffold auN: 54929.70
Scaffold L50: 6
Largest scaffold: 132637
Smallest scaffold: 16240
# contigs: 23
Total contig length: 730998
Average contig length: 31782.52
Contig N50: 25430
Contig auN: 54929.70
Contig L50: 6
Largest contig: 132637
Smallest contig: 16240
# gaps in scaffolds: 0
Total gap length in scaffolds: 0
Average gap length in scaffolds: 0.00
Gap N50 in scaffolds: 0
Gap auN in scaffolds: 0.00
Gap L50 in scaffolds: 0
Largest gap in scaffolds: 0
Smallest gap in scaffolds: 0
Base composition (A:C:G:T): 219106:144177:146357:221358
GC content %: 39.74
# soft-masked bases: 0
# segments: 23
Total segment length: 730998
Average segment length: 31782.52
# gaps: 0
# paths: 23

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"74c13e1c79b911efbd596928d263019d"`
chromInfo	`"/tmp/tmp_al32c6n/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 4, "out_format": "gfa", "terminal_overlaps_condition": {"__current_case__": 0, "terminal_overlaps_select": "no"}}, "selector": "manipulation", "sort": "", "swiss_army_knife": null}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 4: Meryl Database : Child:
- step_state: scheduled

Step 31: Raw Unitig Image:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -s '/tmp/tmp_al32c6n/files/d/5/6/dataset_d56eccc0-9e5f-4acc-903e-beb12192242e.dat' input.gfa &&  export QT_QPA_PLATFORM='offscreen' && Bandage image input.gfa 'out.png' --height '2000' --nodewidth '25.0'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"74c13e1c79b911efbd596928d263019d"`
chromInfo	`"/tmp/tmp_al32c6n/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
fontsize	`None`
height	`"2000"`
lengths	`false`
names	`false`
nodewidth	`"25.0"`
output_format	`"png"`
width	`None`

Step 32: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmp_al32c6n/files/8/4/d/dataset_84d62027-d8c4-4513-b362-9e8667ea64ce.dat' --discover-paths -o dataset.fasta --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset

Exit Code:

```
0
```

Standard Output:

+++Assembly summary+++: 
# scaffolds: 85
Total scaffold length: 2065905
Average scaffold length: 24304.76
Scaffold N50: 22121
Scaffold auN: 34217.52
Scaffold L50: 30
Largest scaffold: 132637
Smallest scaffold: 11410
# contigs: 85
Total contig length: 2065905
Average contig length: 24304.76
Contig N50: 22121
Contig auN: 34217.52
Contig L50: 30
Largest contig: 132637
Smallest contig: 11410
# gaps in scaffolds: 0
Total gap length in scaffolds: 0
Average gap length in scaffolds: 0.00
Gap N50 in scaffolds: 0
Gap auN in scaffolds: 0.00
Gap L50 in scaffolds: 0
Largest gap in scaffolds: 0
Smallest gap in scaffolds: 0
Base composition (A:C:G:T): 630683:399587:403407:632228
GC content %: 38.87
# soft-masked bases: 0
# segments: 85
Total segment length: 2065905
Average segment length: 24304.76
# gaps: 0
# paths: 85
# edges: 4
Average degree: 0.05
# connected components: 1
Largest connected component length: 96577
# dead ends: 167
# disconnected components: 82
Total length disconnected components: 1969328
# separated components: 83
# bubbles: 0
# circular segments: 0

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"74c13e1c79b911efbd596928d263019d"`
chromInfo	`"/tmp/tmp_al32c6n/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 0, "line_length": null, "out_format": "fasta"}, "selector": "manipulation", "sort": "", "swiss_army_knife": null}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 33: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmp_al32c6n/files/6/f/0/dataset_6f0544f3-99fb-4d4b-abf5-3e754e8b9956.dat' --discover-paths -o dataset.fasta --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset

Exit Code:

```
0
```

Standard Output:

+++Assembly summary+++: 
# scaffolds: 23
Total scaffold length: 730998
Average scaffold length: 31782.52
Scaffold N50: 25430
Scaffold auN: 54929.70
Scaffold L50: 6
Largest scaffold: 132637
Smallest scaffold: 16240
# contigs: 23
Total contig length: 730998
Average contig length: 31782.52
Contig N50: 25430
Contig auN: 54929.70
Contig L50: 6
Largest contig: 132637
Smallest contig: 16240
# gaps in scaffolds: 0
Total gap length in scaffolds: 0
Average gap length in scaffolds: 0.00
Gap N50 in scaffolds: 0
Gap auN in scaffolds: 0.00
Gap L50 in scaffolds: 0
Largest gap in scaffolds: 0
Smallest gap in scaffolds: 0
Base composition (A:C:G:T): 219106:144177:146357:221358
GC content %: 39.74
# soft-masked bases: 0
# segments: 23
Total segment length: 730998
Average segment length: 31782.52
# gaps: 0
# paths: 23

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"74c13e1c79b911efbd596928d263019d"`
chromInfo	`"/tmp/tmp_al32c6n/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 0, "line_length": null, "out_format": "fasta"}, "selector": "manipulation", "sort": "", "swiss_army_knife": null}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 34: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmp_al32c6n/files/8/4/d/dataset_84d62027-d8c4-4513-b362-9e8667ea64ce.dat' --out-size c  --discover-paths --tabular > '/tmp/tmp_al32c6n/job_working_directory/000/28/outputs/dataset_15284d98-46a5-40ff-9aa9-8ec30ee03476.dat' --threads ${GALAXY_SLOTS:-8}

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"74c13e1c79b911efbd596928d263019d"`
chromInfo	`"/tmp/tmp_al32c6n/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 1, "discover_paths": true, "locale": false, "selector": "statistics", "statistics_condition": {"__current_case__": 0, "out_size": "c", "selector": "size"}, "tabular": true}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 35: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmp_al32c6n/files/6/f/0/dataset_6f0544f3-99fb-4d4b-abf5-3e754e8b9956.dat' --out-size c  --discover-paths --tabular > '/tmp/tmp_al32c6n/job_working_directory/000/29/outputs/dataset_ccac6521-dc3a-4371-9f28-a250e50c13c2.dat' --threads ${GALAXY_SLOTS:-8}

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"74c13e1c79b911efbd596928d263019d"`
chromInfo	`"/tmp/tmp_al32c6n/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 1, "discover_paths": true, "locale": false, "selector": "statistics", "statistics_condition": {"__current_case__": 0, "out_size": "c", "selector": "size"}, "tabular": true}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 36: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmp_al32c6n/files/6/f/0/dataset_6f0544f3-99fb-4d4b-abf5-3e754e8b9956.dat' 2288021 --nstar-report --locale en_US.UTF-8 --discover-paths --tabular > '/tmp/tmp_al32c6n/job_working_directory/000/30/outputs/dataset_6aa0cc61-0369-46ad-ad1a-6b678e82556f.dat' --threads ${GALAXY_SLOTS:-8}

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"74c13e1c79b911efbd596928d263019d"`
chromInfo	`"/tmp/tmp_al32c6n/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 1, "discover_paths": true, "locale": true, "selector": "statistics", "statistics_condition": {"__current_case__": 2, "expected_genomesize": "2288021", "selector": "assembly"}, "tabular": true}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 37: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmp_al32c6n/files/8/4/d/dataset_84d62027-d8c4-4513-b362-9e8667ea64ce.dat' 2288021 --nstar-report --locale en_US.UTF-8 --discover-paths --tabular > '/tmp/tmp_al32c6n/job_working_directory/000/31/outputs/dataset_814a6122-ba97-4383-8c9f-aaf07c18b1aa.dat' --threads ${GALAXY_SLOTS:-8}

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"74c13e1c79b911efbd596928d263019d"`
chromInfo	`"/tmp/tmp_al32c6n/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 1, "discover_paths": true, "locale": true, "selector": "statistics", "statistics_condition": {"__current_case__": 2, "expected_genomesize": "2288021", "selector": "assembly"}, "tabular": true}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 38: toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.7.1+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

busco --in '/tmp/tmp_al32c6n/files/c/b/4/dataset_cb49370b-0a27-4735-b190-8e30c8d23783.dat' --mode 'geno' --out busco_galaxy --cpu ${GALAXY_SLOTS:-4} --evalue 0.001 --limit 3 --contig_break 10  --offline --download_path /cvmfs/data.galaxyproject.org/byhand/busco/v5  --lineage_dataset 'vertebrata_odb10'  --miniprot  && mkdir BUSCO_summaries && ls -l busco_galaxy/run_*/ && cp busco_galaxy/short_summary.*.txt BUSCO_summaries/ && generate_plot.py -wd BUSCO_summaries -rt specific  && echo "##gff-version 3" > busco_output.gff && cat busco_galaxy/run_*/busco_sequences/*busco_sequences/*.gff >> busco_output.gff 2> /dev/null || true

Exit Code:

```
0
```

Standard Error:

2024-09-23 15:04:36 ERROR:	Something went wrong. Results not recorded.
2024-09-23 15:04:36 ERROR:	BUSCO analysis failed!
2024-09-23 15:04:36 ERROR:	Check the logs, read the user guide (https://busco.ezlab.org/busco_userguide.html), and check the BUSCO issue board on https://gitlab.com/ezlab/busco/issues

Standard Output:

2024-09-23 14:45:42 INFO:	***** Start a BUSCO v5.7.1 analysis, current time: 09/23/2024 14:45:42 *****
2024-09-23 14:45:42 INFO:	Configuring BUSCO with local environment
2024-09-23 14:45:42 INFO:	Running genome mode
2024-09-23 14:45:45 INFO:	Input file is /tmp/tmp_al32c6n/files/c/b/4/dataset_cb49370b-0a27-4735-b190-8e30c8d23783.dat
2024-09-23 14:45:45 WARNING:	Option evalue was provided but is not used in the selected run mode, euk_genome_min
2024-09-23 14:45:45 WARNING:	Option limit was provided but is not used in the selected run mode, euk_genome_min
2024-09-23 14:45:45 INFO:	Running BUSCO using lineage dataset vertebrata_odb10 (eukaryota, 2021-02-19)
2024-09-23 14:45:45 INFO:	Running 1 job(s) on bbtools, starting at 09/23/2024 14:45:45
2024-09-23 14:45:47 INFO:	[bbtools]	1 of 1 task(s) completed
2024-09-23 14:45:47 INFO:	Running 1 job(s) on miniprot_index, starting at 09/23/2024 14:45:47
2024-09-23 14:45:48 INFO:	[miniprot_index]	1 of 1 task(s) completed
2024-09-23 14:45:48 INFO:	Running 1 job(s) on miniprot_align, starting at 09/23/2024 14:45:48
2024-09-23 15:03:37 INFO:	[miniprot_align]	1 of 1 task(s) completed
2024-09-23 15:03:43 INFO:	***** Run HMMER on gene sequences *****
2024-09-23 15:03:44 INFO:	Running 621 job(s) on hmmsearch, starting at 09/23/2024 15:03:44
2024-09-23 15:03:51 INFO:	[hmmsearch]	63 of 621 task(s) completed
2024-09-23 15:03:56 INFO:	[hmmsearch]	125 of 621 task(s) completed
2024-09-23 15:04:01 INFO:	[hmmsearch]	187 of 621 task(s) completed
2024-09-23 15:04:06 INFO:	[hmmsearch]	249 of 621 task(s) completed
2024-09-23 15:04:11 INFO:	[hmmsearch]	311 of 621 task(s) completed
2024-09-23 15:04:16 INFO:	[hmmsearch]	373 of 621 task(s) completed
2024-09-23 15:04:22 INFO:	[hmmsearch]	435 of 621 task(s) completed
2024-09-23 15:04:26 INFO:	[hmmsearch]	497 of 621 task(s) completed
2024-09-23 15:04:31 INFO:	[hmmsearch]	559 of 621 task(s) completed
2024-09-23 15:04:36 INFO:	[hmmsearch]	621 of 621 task(s) completed
2024-09-23 15:04:36 INFO:	51 exons in total
2024-09-23 15:04:36 WARNING:	2 of 40 Complete matches (5.0%) contain internal stop codons in Miniprot gene predictions
2024-09-23 15:04:36 WARNING:	BUSCO gene predictions from Miniprot have low average identity (0.46000000834465027). You may want to repeat the analysis using the Metaeuk pipeline.

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"74c13e1c79b911efbd596928d263019d"`
adv	`{"contig_break": "10", "evalue": "0.001", "limit": "3"}`
busco_mode	`{"__current_case__": 0, "mode": "geno", "use_augustus": {"__current_case__": 1, "use_augustus_selector": "miniprot"}}`
chromInfo	`"/tmp/tmp_al32c6n/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
lineage	`{"__current_case__": 1, "lineage_dataset": "vertebrata_odb10", "lineage_mode": "select_lineage"}`
lineage_conditional	`{"__current_case__": 0, "cached_db": "v5", "selector": "cached"}`
outputs	`["short_summary", "missing", "image", "gff"]`

Step 39: toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.7.1+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

busco --in '/tmp/tmp_al32c6n/files/4/4/7/dataset_447112d1-c45a-4f8b-acfe-8680e2bb38c2.dat' --mode 'geno' --out busco_galaxy --cpu ${GALAXY_SLOTS:-4} --evalue 0.001 --limit 3 --contig_break 10  --offline --download_path /cvmfs/data.galaxyproject.org/byhand/busco/v5  --lineage_dataset 'vertebrata_odb10'  --miniprot  && mkdir BUSCO_summaries && ls -l busco_galaxy/run_*/ && cp busco_galaxy/short_summary.*.txt BUSCO_summaries/ && generate_plot.py -wd BUSCO_summaries -rt specific  && echo "##gff-version 3" > busco_output.gff && cat busco_galaxy/run_*/busco_sequences/*busco_sequences/*.gff >> busco_output.gff 2> /dev/null || true

Exit Code:

```
0
```

Standard Error:

2024-09-23 14:56:05 ERROR:	Something went wrong. Results not recorded.
2024-09-23 14:56:05 ERROR:	BUSCO analysis failed!
2024-09-23 14:56:05 ERROR:	Check the logs, read the user guide (https://busco.ezlab.org/busco_userguide.html), and check the BUSCO issue board on https://gitlab.com/ezlab/busco/issues

Standard Output:

2024-09-23 14:45:41 INFO:	***** Start a BUSCO v5.7.1 analysis, current time: 09/23/2024 14:45:41 *****
2024-09-23 14:45:41 INFO:	Configuring BUSCO with local environment
2024-09-23 14:45:41 INFO:	Running genome mode
2024-09-23 14:45:45 INFO:	Input file is /tmp/tmp_al32c6n/files/4/4/7/dataset_447112d1-c45a-4f8b-acfe-8680e2bb38c2.dat
2024-09-23 14:45:45 WARNING:	Option evalue was provided but is not used in the selected run mode, euk_genome_min
2024-09-23 14:45:45 WARNING:	Option limit was provided but is not used in the selected run mode, euk_genome_min
2024-09-23 14:45:45 INFO:	Running BUSCO using lineage dataset vertebrata_odb10 (eukaryota, 2021-02-19)
2024-09-23 14:45:45 INFO:	Running 1 job(s) on bbtools, starting at 09/23/2024 14:45:45
2024-09-23 14:45:47 INFO:	[bbtools]	1 of 1 task(s) completed
2024-09-23 14:45:47 INFO:	Running 1 job(s) on miniprot_index, starting at 09/23/2024 14:45:47
2024-09-23 14:45:48 INFO:	[miniprot_index]	1 of 1 task(s) completed
2024-09-23 14:45:48 INFO:	Running 1 job(s) on miniprot_align, starting at 09/23/2024 14:45:48
2024-09-23 14:55:11 INFO:	[miniprot_align]	1 of 1 task(s) completed
2024-09-23 14:55:13 INFO:	***** Run HMMER on gene sequences *****
2024-09-23 14:55:14 INFO:	Running 347 job(s) on hmmsearch, starting at 09/23/2024 14:55:14
2024-09-23 14:55:20 INFO:	[hmmsearch]	35 of 347 task(s) completed
2024-09-23 14:55:25 INFO:	[hmmsearch]	70 of 347 task(s) completed
2024-09-23 14:55:30 INFO:	[hmmsearch]	105 of 347 task(s) completed
2024-09-23 14:55:35 INFO:	[hmmsearch]	139 of 347 task(s) completed
2024-09-23 14:55:40 INFO:	[hmmsearch]	174 of 347 task(s) completed
2024-09-23 14:55:45 INFO:	[hmmsearch]	209 of 347 task(s) completed
2024-09-23 14:55:50 INFO:	[hmmsearch]	243 of 347 task(s) completed
2024-09-23 14:55:54 INFO:	[hmmsearch]	278 of 347 task(s) completed
2024-09-23 14:56:00 INFO:	[hmmsearch]	313 of 347 task(s) completed
2024-09-23 14:56:05 INFO:	[hmmsearch]	347 of 347 task(s) completed
2024-09-23 14:56:05 INFO:	12 exons in total
2024-09-23 14:56:05 WARNING:	1 of 9 Complete matches (11.1%) contain internal stop codons in Miniprot gene predictions

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"74c13e1c79b911efbd596928d263019d"`
adv	`{"contig_break": "10", "evalue": "0.001", "limit": "3"}`
busco_mode	`{"__current_case__": 0, "mode": "geno", "use_augustus": {"__current_case__": 1, "use_augustus_selector": "miniprot"}}`
chromInfo	`"/tmp/tmp_al32c6n/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
lineage	`{"__current_case__": 1, "lineage_dataset": "vertebrata_odb10", "lineage_mode": "select_lineage"}`
lineage_conditional	`{"__current_case__": 0, "cached_db": "v5", "selector": "cached"}`
outputs	`["short_summary", "missing", "image", "gff"]`

Step 40: toolshed.g2.bx.psu.edu/repos/iuc/merqury/merqury/1.3+galaxy4:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

mkdir -p output_files && mkdir -p read-db.meryl pat.meryl mat.meryl && tar -zxf /tmp/tmp_al32c6n/files/3/5/1/dataset_35133195-e0b6-4cae-8309-cc300d6c7877.dat -C read-db.meryl --strip-components=1 && tar -zxf /tmp/tmp_al32c6n/files/c/1/d/dataset_c1d0b09e-6b65-47b9-b41b-0e08952b2459.dat -C pat.meryl --strip-components=1 && tar -zxf /tmp/tmp_al32c6n/files/3/c/c/dataset_3cca7f24-0a44-4279-8fee-0cd52022c762.dat -C mat.meryl --strip-components=1 && ln -s '/tmp/tmp_al32c6n/files/c/b/4/dataset_cb49370b-0a27-4735-b190-8e30c8d23783.dat' assembly_01.fasta && ln -s '/tmp/tmp_al32c6n/files/4/4/7/dataset_447112d1-c45a-4f8b-acfe-8680e2bb38c2.dat' assembly_02.fasta && merqury.sh read-db.meryl pat.meryl mat.meryl assembly_01.fasta assembly_02.fasta output_merqury &> /tmp/tmp_al32c6n/job_working_directory/000/34/outputs/dataset_a32fa201-0efc-4911-9805-b31e062741eb.dat && mv output_merqury* output_files && find . -maxdepth 1 -name 'assembly_only*' -type f -print0 | xargs -0r mv -t output_files  && sed -i '1s/^/assembly\tk-mer set\tsolid k-mers in assembly\tsolid k-mers in reads\tcompleteness %\n/' 'output_files/output_merqury.completeness.stats' && sed -i '1s/^/assembly\tunique k-mers\tcommon k-mers\tQV\terror rate\n/' 'output_files/output_merqury.qv'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"74c13e1c79b911efbd596928d263019d"`
chromInfo	`"/tmp/tmp_al32c6n/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
label	`"output_merqury"`
mode	`{"__current_case__": 1, "assembly_options": {"__current_case__": 1, "assembly_01": {"values": [{"id": 33, "src": "hda"}]}, "assembly_02": {"values": [{"id": 34, "src": "hda"}]}, "number_assemblies": "two"}, "meryldb_F1": {"values": [{"id": 1, "src": "hda"}]}, "meryldb_MAT": {"values": [{"id": 3, "src": "hda"}]}, "meryldb_PAT": {"values": [{"id": 2, "src": "hda"}]}, "options": "trio"}`
output_add_headers	`true`
output_selector	`["qv", "plots", "sizes", "stats", "bed", "wig", "log", "hist"]`

Step 5: Hapmer Database : Paternal:
- step_state: scheduled

Step 41: Data prep Hap1:

step_state: scheduled

Subworkflow Steps

Step 1: gfa_stats:
- step_state: scheduled

Step 2: sort1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/tmp_al32c6n/galaxy-dev/tools/filters/sorter.py'  --input='/tmp/tmp_al32c6n/files/1/5/2/dataset_15284d98-46a5-40ff-9aa9-8ec30ee03476.dat' --output='/tmp/tmp_al32c6n/job_working_directory/000/35/outputs/dataset_a7088db8-bd1e-4984-9e25-a77cd24e9e6b.dat'    --key=2,2nr   --header 0

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"74c13e1d79b911efbd596928d263019d"`
chromInfo	`"/tmp/tmp_al32c6n/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
column	`"2"`
column_set	`[]`
dbkey	`"?"`
header_lines	`"0"`
order	`"DESC"`
style	`"num"`

Step 3: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmp_al32c6n/job_working_directory/000/36/configs/tmpfdxl_jd8' '/tmp/tmp_al32c6n/files/a/7/0/dataset_a7088db8-bd1e-4984-9e25-a77cd24e9e6b.dat' > '/tmp/tmp_al32c6n/job_working_directory/000/36/outputs/dataset_3f2cd7bb-10b1-4a9c-b04f-537bd88bdc3a.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"74c13e1d79b911efbd596928d263019d"`
chromInfo	`"/tmp/tmp_al32c6n/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
code	`"{total += $2; $3 = total}1"`
dbkey	`"?"`

Step 4: toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.8+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

datamash         absmax 3 < /tmp/tmp_al32c6n/files/3/f/2/dataset_3f2cd7bb-10b1-4a9c-b04f-537bd88bdc3a.dat > '/tmp/tmp_al32c6n/job_working_directory/000/37/outputs/dataset_282405f7-272b-4c1a-afa4-a5689a380548.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"74c13e1d79b911efbd596928d263019d"`
chromInfo	`"/tmp/tmp_al32c6n/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
grouping	`""`
header_in	`false`
header_out	`false`
ignore_case	`false`
narm	`false`
need_sort	`false`
operations	`[{"__index__": 0, "op_column": "3", "op_name": "absmax"}]`
print_full_line	`false`

Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmp_al32c6n/files/3/f/2/dataset_3f2cd7bb-10b1-4a9c-b04f-537bd88bdc3a.dat" "/tmp/tmp_al32c6n/job_working_directory/000/38/outputs/dataset_837ee226-8c4c-4fb5-bb59-7ab980c419cc.dat" "1" "yes"

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"74c13e1d79b911efbd596928d263019d"`
chromInfo	`"/tmp/tmp_al32c6n/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
exp	`"1"`
iterate	`"yes"`

Step 6: param_value_from_file:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"74c13e1d79b911efbd596928d263019d"`
chromInfo	`"/tmp/tmp_al32c6n/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
param_type	`"integer"`
remove_newlines	`true`

Step 7: toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"74c13e1d79b911efbd596928d263019d"`
chromInfo	`"/tmp/tmp_al32c6n/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
components	`[{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "c3/", "select_param_type": "text"}}, {"__index__": 1, "param_type": {"__current_case__": 1, "component_value": "2065905", "select_param_type": "integer"}}]`
dbkey	`"?"`

Step 8: toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types str,int,int,int  --file '/tmp/tmp_al32c6n/job_working_directory/000/59/configs/tmp85efmlfn' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmp_al32c6n/files/8/3/7/dataset_837ee226-8c4c-4fb5-bb59-7ab980c419cc.dat' '/tmp/tmp_al32c6n/job_working_directory/000/59/outputs/dataset_4e121e18-1ab4-4b21-ba1b-99d547176d44.dat'

Exit Code:

```
0
```

Standard Output:

c3/2065905
c2/1000000
c3/1000000
Computing 3 new columns with instructions ['c3/2065905;;', 'c2/1000000;;', 'c3/1000000;;']
Computed new column values for 100.00% of 85 lines written.

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"74c13e1d79b911efbd596928d263019d"`
avoid_scientific_notation	`false`
chromInfo	`"/tmp/tmp_al32c6n/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
error_handling	`{"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}}`
ops	`{"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/2065905"}, {"__index__": 1, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c2/1000000"}, {"__index__": 2, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1000000"}], "header_lines_select": "no"}`

Step 42: Data Prep Hap2:

step_state: scheduled

Subworkflow Steps

Step 1: gfa_stats:
- step_state: scheduled

Step 2: sort1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/tmp_al32c6n/galaxy-dev/tools/filters/sorter.py'  --input='/tmp/tmp_al32c6n/files/c/c/a/dataset_ccac6521-dc3a-4371-9f28-a250e50c13c2.dat' --output='/tmp/tmp_al32c6n/job_working_directory/000/40/outputs/dataset_9593ccdf-c690-4201-bb80-643855affc1e.dat'    --key=2,2nr   --header 0

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"74c13e1e79b911efbd596928d263019d"`
chromInfo	`"/tmp/tmp_al32c6n/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
column	`"2"`
column_set	`[]`
dbkey	`"?"`
header_lines	`"0"`
order	`"DESC"`
style	`"num"`

Step 3: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmp_al32c6n/job_working_directory/000/41/configs/tmpo9gb0clv' '/tmp/tmp_al32c6n/files/9/5/9/dataset_9593ccdf-c690-4201-bb80-643855affc1e.dat' > '/tmp/tmp_al32c6n/job_working_directory/000/41/outputs/dataset_e837cc88-9f4d-4ff0-a179-f5d8b7e54b96.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"74c13e1e79b911efbd596928d263019d"`
chromInfo	`"/tmp/tmp_al32c6n/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
code	`"{total += $2; $3 = total}1"`
dbkey	`"?"`

Step 4: toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.8+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

datamash         absmax 3 < /tmp/tmp_al32c6n/files/e/8/3/dataset_e837cc88-9f4d-4ff0-a179-f5d8b7e54b96.dat > '/tmp/tmp_al32c6n/job_working_directory/000/42/outputs/dataset_ab7fb9ee-44fd-4494-b66f-4e7cd44c9a8f.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"74c13e1e79b911efbd596928d263019d"`
chromInfo	`"/tmp/tmp_al32c6n/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
grouping	`""`
header_in	`false`
header_out	`false`
ignore_case	`false`
narm	`false`
need_sort	`false`
operations	`[{"__index__": 0, "op_column": "3", "op_name": "absmax"}]`
print_full_line	`false`

Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmp_al32c6n/files/e/8/3/dataset_e837cc88-9f4d-4ff0-a179-f5d8b7e54b96.dat" "/tmp/tmp_al32c6n/job_working_directory/000/43/outputs/dataset_5a385307-519b-4836-b60a-b8778c39bae7.dat" "1" "yes"

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"74c13e1e79b911efbd596928d263019d"`
chromInfo	`"/tmp/tmp_al32c6n/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
exp	`"1"`
iterate	`"yes"`

Step 6: param_value_from_file:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"74c13e1e79b911efbd596928d263019d"`
chromInfo	`"/tmp/tmp_al32c6n/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
param_type	`"integer"`
remove_newlines	`true`

Step 7: toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"74c13e1e79b911efbd596928d263019d"`
chromInfo	`"/tmp/tmp_al32c6n/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
components	`[{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "c3/", "select_param_type": "text"}}, {"__index__": 1, "param_type": {"__current_case__": 1, "component_value": "730998", "select_param_type": "integer"}}]`
dbkey	`"?"`

Step 8: toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types str,int,int,int  --file '/tmp/tmp_al32c6n/job_working_directory/000/58/configs/tmpsooiit53' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmp_al32c6n/files/5/a/3/dataset_5a385307-519b-4836-b60a-b8778c39bae7.dat' '/tmp/tmp_al32c6n/job_working_directory/000/58/outputs/dataset_c66a4b1a-181f-438f-a59e-148130f40bf9.dat'

Exit Code:

```
0
```

Standard Output:

c3/730998
c2/1000000
c3/1000000
Computing 3 new columns with instructions ['c3/730998;;', 'c2/1000000;;', 'c3/1000000;;']
Computed new column values for 100.00% of 23 lines written.

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"74c13e1e79b911efbd596928d263019d"`
avoid_scientific_notation	`false`
chromInfo	`"/tmp/tmp_al32c6n/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
error_handling	`{"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}}`
ops	`{"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/730998"}, {"__index__": 1, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c2/1000000"}, {"__index__": 2, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1000000"}], "header_lines_select": "no"}`

Step 43: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmp_al32c6n/job_working_directory/000/45/configs/tmpx2z35jka' '/tmp/tmp_al32c6n/files/6/a/a/dataset_6aa0cc61-0369-46ad-ad1a-6b678e82556f.dat' > '/tmp/tmp_al32c6n/job_working_directory/000/45/outputs/dataset_7209c963-114b-4a51-ae80-130ab7cbbe3b.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"74c13e1c79b911efbd596928d263019d"`
chromInfo	`"/tmp/tmp_al32c6n/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
code	`"BEGIN{print \"Metric\\thap2-Maternal\"}; {print}; "`
dbkey	`"?"`

Step 44: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmp_al32c6n/job_working_directory/000/46/configs/tmp76y_hk0f' '/tmp/tmp_al32c6n/files/8/1/4/dataset_814a6122-ba97-4383-8c9f-aaf07c18b1aa.dat' > '/tmp/tmp_al32c6n/job_working_directory/000/46/outputs/dataset_46aecee6-2dfd-4d5a-a55f-32907119953b.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"74c13e1c79b911efbd596928d263019d"`
chromInfo	`"/tmp/tmp_al32c6n/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
code	`"BEGIN{print \"Metric\\thap1-Paternal\"}; {print}; "`
dbkey	`"?"`

Step 45: merqury_qv:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"74c13e1c79b911efbd596928d263019d"`
input	`{"values": [{"id": 10, "src": "hdca"}]}`
which	`{"__current_case__": 1, "identifier": "output_merqury", "which_dataset": "by_identifier"}`

Step 46: output_merqury.spectra-cn.fl:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"74c13e1c79b911efbd596928d263019d"`
input	`{"values": [{"id": 11, "src": "hdca"}]}`
which	`{"__current_case__": 1, "identifier": "output_merqury.spectra-cn.fl", "which_dataset": "by_identifier"}`

Step 47: output_merqury.spectra-asm.fl:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"74c13e1c79b911efbd596928d263019d"`
input	`{"values": [{"id": 11, "src": "hdca"}]}`
which	`{"__current_case__": 1, "identifier": "output_merqury.spectra-asm.fl", "which_dataset": "by_identifier"}`

Step 48: output_merqury.assembly_01.spectra-cn.fl:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"74c13e1c79b911efbd596928d263019d"`
input	`{"values": [{"id": 11, "src": "hdca"}]}`
which	`{"__current_case__": 1, "identifier": "output_merqury.assembly_01.spectra-cn.fl", "which_dataset": "by_identifier"}`

Step 49: output_merqury.assembly_02.spectra-cn.fl:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"74c13e1c79b911efbd596928d263019d"`
input	`{"values": [{"id": 11, "src": "hdca"}]}`
which	`{"__current_case__": 1, "identifier": "output_merqury.assembly_02.spectra-cn.fl", "which_dataset": "by_identifier"}`

Step 50: merqury_stats:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"74c13e1c79b911efbd596928d263019d"`
input	`{"values": [{"id": 13, "src": "hdca"}]}`
which	`{"__current_case__": 1, "identifier": "output_merqury.completeness", "which_dataset": "by_identifier"}`

Step 6: Hapmer Database : Maternal:
- step_state: scheduled

Step 51: Plots:

step_state: scheduled

Subworkflow Steps

Step 1: Primary data:
- step_state: scheduled
Step 2: Alternate data:
- step_state: scheduled

Step 11: Size Plot:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

cat '/tmp/tmp_al32c6n/job_working_directory/000/66/configs/tmp2eq_puem' && Rscript '/tmp/tmp_al32c6n/job_working_directory/000/66/configs/tmp2eq_puem'

Exit Code:

```
0
```

Standard Error:

Warning message:
In Sys.setlocale("LC_MESSAGES", "en_US.UTF-8") :
  OS reports request to set locale to "en_US.UTF-8" cannot be honored
Warning message:
package ‘ggplot2’ was built under R version 4.1.3 
Warning message:
Using `size` aesthetic for lines was deprecated in ggplot2 3.4.0.
ℹ Please use `linewidth` instead.

Standard Output:

        options(show.error.messages=F, error=function(){cat(geterrmessage(), file=stderr()); q("no",1,F)})

        loc <- Sys.setlocale("LC_MESSAGES", "en_US.UTF-8")
    

library(ggplot2)


        #Choose between automatically scaled x and y axis or user defined
            gg_scalex = NULL
            gg_scaley = NULL
    


            gg_theme = theme_bw()
    


            gg_legend = theme(legend.position="right")
    

input <- read.csv('/tmp/tmp_al32c6n/files/7/7/5/dataset_775b34d6-6444-48cb-8ce0-71f53d85f0ea.dat', sep='\t', header=TRUE)

names(input)[2] <- "xcol"
names(input)[3] <- "ycol"

    gg_facet = NULL
    gg_factor = aes(colour=factor(factor))

        gg_line = geom_line(size=1, alpha=1, gg_factor)

        color_scale = scale_color_brewer(palette='Set1', direction='1')

    names(input)[1] <- "factor"


    

    gg_axistitle = theme(axis.title = element_text(color = NULL, size = NULL, face = NULL))

    gg_axistext = theme(axis.text = element_text(color = NULL, size = NULL, face = NULL))

    gg_plottitle = theme(plot.title = element_text(color = NULL, size = NULL, face = NULL))

    gg_gridline = NULL

    gg_point = NULL

#this is the actual ggplot command to make the final plot(s)
plot_out <- ggplot(input, aes(xcol, ycol)) + gg_point + gg_line + gg_facet +
    gg_theme + gg_scalex + gg_scaley + color_scale + gg_legend + ggtitle('') + xlab('Scaffold number') + ylab('Cumulative Size (Mb)')+
    gg_axistitle + gg_axistext + gg_plottitle + gg_gridline


        gg_width <- as.double('6.0')
        gg_height <- as.double('4.0')
        gg_unit <- 'in'
        gg_dpi <- as.double('300.0')
        gg_add_device <- 'none'
        output1 <- '/tmp/tmp_al32c6n/job_working_directory/000/66/outputs/dataset_84ace089-fbff-4ac5-ad57-b660f7205768.dat'
        output2 <- 'XXXX'

        ggsave(filename = output1, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = "png")
        if(gg_add_device != "none"){
          ggsave(filename = output2, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = gg_add_device)
        }

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"74c13e1f79b911efbd596928d263019d"`
adv	{"axis_text_customization": {"__current_case__": 0, "axis_customization": "default"}, "axis_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "factor": {"__current_case__": 1, "colororder": "1", "colors": "Set1", "factorcol": "1", "factoring": "Single"}, "gridlinecust": "default", "legend": "yes", "plot_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "scaling": {"__current_case__": 0, "plot_scaling": "Automatic"}, "theme": "bw", "transform": "none", "type_conditional": {"__current_case__": 2, "type_options": "lines"}}
chromInfo	`"/tmp/tmp_al32c6n/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
out	`{"additional_output_format": "none", "dpi_output_dim": "300.0", "height_output_dim": "4.0", "unit_output_dim": "in", "width_output_dim": "6.0"}`
title	`""`
xlab	`"Scaffold number"`
xplot	`"2"`
ylab	`"Cumulative Size (Mb)"`
yplot	`"3"`

Step 3: Name of primary assembly:
- step_state: scheduled
Step 4: Name of alternate assembly:
- step_state: scheduled

Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmp_al32c6n/files/4/e/1/dataset_4e121e18-1ab4-4b21-ba1b-99d547176d44.dat" "/tmp/tmp_al32c6n/job_working_directory/000/60/outputs/dataset_e0edcaaa-23ac-43c7-9a1b-5d87c611f2aa.dat" "Hap1" "no"

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"74c13e1f79b911efbd596928d263019d"`
chromInfo	`"/tmp/tmp_al32c6n/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
exp	`"Hap1"`
iterate	`"no"`

Step 6: toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmp_al32c6n/files/c/6/6/dataset_c66a4b1a-181f-438f-a59e-148130f40bf9.dat" "/tmp/tmp_al32c6n/job_working_directory/000/61/outputs/dataset_22c380b7-238f-4c52-87d6-847a793e4caa.dat" "Hap2" "no"

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"74c13e1f79b911efbd596928d263019d"`
chromInfo	`"/tmp/tmp_al32c6n/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
exp	`"Hap2"`
iterate	`"no"`

Step 7: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cat/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

cat '/tmp/tmp_al32c6n/files/e/0/e/dataset_e0edcaaa-23ac-43c7-9a1b-5d87c611f2aa.dat' >> '/tmp/tmp_al32c6n/job_working_directory/000/62/outputs/dataset_96f48082-cf5d-4aff-8670-10008f8f3121.dat' && cat '/tmp/tmp_al32c6n/files/2/2/c/dataset_22c380b7-238f-4c52-87d6-847a793e4caa.dat' >> '/tmp/tmp_al32c6n/job_working_directory/000/62/outputs/dataset_96f48082-cf5d-4aff-8670-10008f8f3121.dat' && exit 0

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"74c13e1f79b911efbd596928d263019d"`
chromInfo	`"/tmp/tmp_al32c6n/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
queries	`[{"__index__": 0, "inputs2": {"values": [{"id": 143, "src": "hda"}]}}]`

Step 8: Cut1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl '/tmp/tmp_al32c6n/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmp_al32c6n/files/9/6/f/dataset_96f48082-cf5d-4aff-8670-10008f8f3121.dat' 'c8,c5,c6' T '/tmp/tmp_al32c6n/job_working_directory/000/63/outputs/dataset_3be73ed5-8adc-4c25-bd7e-ebdb32dddf81.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"74c13e1f79b911efbd596928d263019d"`
chromInfo	`"/tmp/tmp_al32c6n/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
columnList	`"c8,c5,c6"`
dbkey	`"?"`
delimiter	`"T"`

Step 9: Cut1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl '/tmp/tmp_al32c6n/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmp_al32c6n/files/9/6/f/dataset_96f48082-cf5d-4aff-8670-10008f8f3121.dat' 'c8,c4,c7' T '/tmp/tmp_al32c6n/job_working_directory/000/64/outputs/dataset_775b34d6-6444-48cb-8ce0-71f53d85f0ea.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"74c13e1f79b911efbd596928d263019d"`
chromInfo	`"/tmp/tmp_al32c6n/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
columnList	`"c8,c4,c7"`
dbkey	`"?"`
delimiter	`"T"`

Step 10: Nx Plot:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

cat '/tmp/tmp_al32c6n/job_working_directory/000/65/configs/tmpwuvc00j7' && Rscript '/tmp/tmp_al32c6n/job_working_directory/000/65/configs/tmpwuvc00j7'

Exit Code:

```
0
```

Standard Error:

Warning message:
In Sys.setlocale("LC_MESSAGES", "en_US.UTF-8") :
  OS reports request to set locale to "en_US.UTF-8" cannot be honored
Warning message:
package ‘ggplot2’ was built under R version 4.1.3 
Warning message:
Using `size` aesthetic for lines was deprecated in ggplot2 3.4.0.
ℹ Please use `linewidth` instead.

Standard Output:

        options(show.error.messages=F, error=function(){cat(geterrmessage(), file=stderr()); q("no",1,F)})

        loc <- Sys.setlocale("LC_MESSAGES", "en_US.UTF-8")
    

library(ggplot2)


        #Choose between automatically scaled x and y axis or user defined
            gg_scalex = NULL
            gg_scaley = NULL
    


            gg_theme = theme_bw()
    


            gg_legend = theme(legend.position="right")
    

input <- read.csv('/tmp/tmp_al32c6n/files/3/b/e/dataset_3be73ed5-8adc-4c25-bd7e-ebdb32dddf81.dat', sep='\t', header=TRUE)

names(input)[2] <- "xcol"
names(input)[3] <- "ycol"

    gg_facet = NULL
    gg_factor = aes(colour=factor(factor))

        gg_line = geom_line(size=1, alpha=1, gg_factor)

        color_scale = scale_color_brewer(palette='Set1', direction='1')

    names(input)[1] <- "factor"


    

    gg_axistitle = theme(axis.title = element_text(color = NULL, size = NULL, face = NULL))

    gg_axistext = theme(axis.text = element_text(color = NULL, size = NULL, face = NULL))

    gg_plottitle = theme(plot.title = element_text(color = NULL, size = NULL, face = NULL))

    gg_gridline = NULL

    gg_point = NULL

#this is the actual ggplot command to make the final plot(s)
plot_out <- ggplot(input, aes(xcol, ycol)) + gg_point + gg_line + gg_facet +
    gg_theme + gg_scalex + gg_scaley + color_scale + gg_legend + ggtitle('') + xlab('x') + ylab('Nx (Mb)')+
    gg_axistitle + gg_axistext + gg_plottitle + gg_gridline


        gg_width <- as.double('6.0')
        gg_height <- as.double('4.0')
        gg_unit <- 'in'
        gg_dpi <- as.double('300.0')
        gg_add_device <- 'none'
        output1 <- '/tmp/tmp_al32c6n/job_working_directory/000/65/outputs/dataset_f977d3ff-52de-4f62-807c-a73563d404a7.dat'
        output2 <- 'XXXX'

        ggsave(filename = output1, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = "png")
        if(gg_add_device != "none"){
          ggsave(filename = output2, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = gg_add_device)
        }

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"74c13e1f79b911efbd596928d263019d"`
adv	{"axis_text_customization": {"__current_case__": 0, "axis_customization": "default"}, "axis_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "factor": {"__current_case__": 1, "colororder": "1", "colors": "Set1", "factorcol": "1", "factoring": "Single"}, "gridlinecust": "default", "legend": "yes", "plot_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "scaling": {"__current_case__": 0, "plot_scaling": "Automatic"}, "theme": "bw", "transform": "none", "type_conditional": {"__current_case__": 2, "type_options": "lines"}}
chromInfo	`"/tmp/tmp_al32c6n/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
out	`{"additional_output_format": "none", "dpi_output_dim": "300.0", "height_output_dim": "4.0", "unit_output_dim": "in", "width_output_dim": "6.0"}`
title	`""`
xlab	`"x"`
xplot	`"2"`
ylab	`"Nx (Mb)"`
yplot	`"3"`

Step 52: join1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/tmp_al32c6n/galaxy-dev/tools/filters/join.py' '/tmp/tmp_al32c6n/files/4/6/a/dataset_46aecee6-2dfd-4d5a-a55f-32907119953b.dat' '/tmp/tmp_al32c6n/files/7/2/0/dataset_7209c963-114b-4a51-ae80-130ab7cbbe3b.dat' 1 1 '/tmp/tmp_al32c6n/job_working_directory/000/47/outputs/dataset_43615325-ba4f-489b-bf3f-f78cf7ace6fb.dat' -u -p --index_depth=3 --buffer=50000000 --fill_options_file=/tmp/tmp_al32c6n/job_working_directory/000/47/configs/tmpm56x_ui_

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"74c13e1c79b911efbd596928d263019d"`
chromInfo	`"/tmp/tmp_al32c6n/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
field1	`"1"`
field2	`"1"`
fill_empty_columns	`{"__current_case__": 1, "do_fill_empty_columns": {"__current_case__": 0, "column_fill_type": "single_fill_value", "fill_value": "."}, "fill_columns_by": "fill_unjoined_only", "fill_empty_columns_switch": "fill_empty"}`
header	`""`
partial	`"-p"`
unmatched	`"-u"`

Step 53: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cut_tool/9.3+galaxy2:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

cut --complement -f '3' '/tmp/tmp_al32c6n/files/4/3/6/dataset_43615325-ba4f-489b-bf3f-f78cf7ace6fb.dat' > '/tmp/tmp_al32c6n/job_working_directory/000/48/outputs/dataset_e459af97-6c35-4850-85b2-4b0f03e6dad4.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"74c13e1c79b911efbd596928d263019d"`
chromInfo	`"/tmp/tmp_al32c6n/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
complement	`"--complement"`
cut_type_options	`{"__current_case__": 0, "colnames_option": {"__current_case__": 1, "header": "N", "list": ["3"]}, "cut_element": "-f", "delimiter": ""}`
dbkey	`"?"`

Step 54: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_find_and_replace/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/86755160afbf/text_processing/find_and_replace' -o '/tmp/tmp_al32c6n/job_working_directory/000/49/outputs/dataset_3c50ba29-d96f-4603-875b-8bcab1669061.dat' -g     '#' 'Number of' '/tmp/tmp_al32c6n/files/e/4/5/dataset_e459af97-6c35-4850-85b2-4b0f03e6dad4.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"74c13e1c79b911efbd596928d263019d"`
chromInfo	`"/tmp/tmp_al32c6n/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
find_and_replace	`[{"__index__": 0, "caseinsensitive": false, "find_pattern": "#", "global": true, "is_regex": false, "replace_pattern": "Number of", "searchwhere": {"__current_case__": 0, "searchwhere_select": "line"}, "skip_first_line": false, "wholewords": false}]`

Step 7: Bits for bloom filter:
- step_state: scheduled
Step 8: Database for Busco Lineage:
- step_state: scheduled
Step 9: Lineage:
- step_state: scheduled
Step 10: Homozygous Read Coverage:
- step_state: scheduled

Other invocation details
- history_id
  - 722d58993e29df77
- history_state
  - ok
- invocation_id
  - 722d58993e29df77
- invocation_state
  - scheduled
- workflow_id
  - 3d32206de1b324b8

gxydevbot · 2024-09-24T13:32:33Z

There are new updates, they have been integrated to the PR, check the file diff.

github-actions · 2024-09-24T14:07:31Z

Test Results (powered by Planemo)

Test Summary

Test State	Count
Total	1
Passed	0
Error	0
Failure	1
Skipped	0

Failed Tests

❌ Assembly-Hifi-Trio-phasing-VGP5.ga_0

Problems:

Output with path /tmp/tmphgc_hv2v/Busco on data 40 short summary__3d1c75cd-6a9e-4757-846e-81acbb7e426a different than expected
Expected text 'C:1.2%[S:1.2%,D:0.0%],F:0.4%,M:98.4%,n:3354' in output ('# BUSCO version is: 5.7.1 
# The lineage dataset is: vertebrata_odb10 (Creation date: 2021-02-19, number of genomes: 67, number of BUSCOs: 3354)
# Summarized benchmarking in BUSCO notation for file /tmp/tmpu2ie1xq6/files/d/2/7/dataset_d27e0996-0dd2-4464-9740-a52b4e83873c.dat
# BUSCO was run in mode: euk_genome_min
# Gene predictor used: miniprot

	***** Results: *****

	C:1.2%[S:1.2%,D:0.0%],F:0.1%,M:98.7%,n:3354,E:5.0%	   
	40	Complete BUSCOs (C)	(of which 2 contain internal stop codons)		   
	39	Complete and single-copy BUSCOs (S)	   
	1	Complete and duplicated BUSCOs (D)	   
	4	Fragmented BUSCOs (F)			   
	3310	Missing BUSCOs (M)			   
	3354	Total BUSCO groups searched		   

Assembly Statistics:
	85	Number of scaffolds
	85	Number of contigs
	2065905	Total length
	0.000%	Percent gaps
	22 KB	Scaffold N50
	22 KB	Contigs N50


Dependencies and versions:
	hmmsearch: 3.1
	bbtools: None
	miniprot_index: 0.13-r248
	miniprot_align: 0.13-r248
	python: sys.version_info(major=3, minor=9, micro=19, releaselevel='final', serial=0)
	busco: 5.7.1
')

Workflow invocation details

Invocation Messages

Steps

Step 1: Pacbio Reads Collection : child:
- step_state: scheduled
Step 2: Paternal Illumina reads (hap1):
- step_state: scheduled
Step 11: Genomescope Model Parameters:
- step_state: scheduled
Step 12: Genomescope Summary:
- step_state: scheduled
Step 13: Utilize homology information to correct trio-phasing errors:
- step_state: scheduled
Step 14: SAK input file (Optional):
- step_state: scheduled
Step 15: Name for Haplotype 1:
- step_state: scheduled
Step 16: Name for Haplotype 2:
- step_state: scheduled

Step 17: toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.9+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -f -s '/tmp/tmpu2ie1xq6/files/2/3/6/dataset_2366e89a-bd57-4d56-8c1d-71c9378d45b1.dat' 'yeast_reads_sub1_fastq_gz.fq.gz' &&  cutadapt  -j=${GALAXY_SLOTS:-4}   -b 'ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT'   -b 'ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT'    --error-rate=0.1 --times=1 --overlap=35    --action=trim --rc     --discard-trimmed   --minimum-length=1      --json=stats.json -o 'out1.fq.gz'  'yeast_reads_sub1_fastq_gz.fq.gz'  > report.txt

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"9187e9807a7a11ef9cf9b9ec166fac27"`
adapter_options	`{"action": "trim", "error_rate": "0.1", "match_read_wildcards": false, "no_indels": false, "no_match_adapter_wildcards": true, "overlap": "35", "revcomp": true, "times": "1"}`
chromInfo	`"/tmp/tmpu2ie1xq6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter_options	`{"discard_casava": false, "discard_trimmed": true, "discard_untrimmed": false, "max_average_error_rate": null, "max_expected_errors": null, "max_n": null, "maximum_length": null, "maximum_length2": null, "minimum_length": "1", "minimum_length2": null, "pair_filter": "any"}`
library	{"__current_case__": 0, "input_1": {"values": [{"id": 1, "src": "dce"}]}, "r1": {"adapters": [], "anywhere_adapters": [{"__index__": 0, "adapter_source": {"__current_case__": 0, "adapter": "ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT", "adapter_name": "", "adapter_source_list": "user"}, "single_noindels": false}, {"__index__": 1, "adapter_source": {"__current_case__": 0, "adapter": "ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT", "adapter_name": "", "adapter_source_list": "user"}, "single_noindels": false}], "front_adapters": []}, "type": "single"}
other_trimming_options	`{"cut": "0", "cut2": "0", "nextseq_trim": "0", "poly_a": false, "quality_cutoff": "0", "quality_cutoff2": "", "shorten_options": {"__current_case__": 1, "shorten_values": "False"}, "shorten_options_r2": {"__current_case__": 1, "shorten_values_r2": "False"}, "trim_n": false}`
output_selector	`["json_stats", "report"]`
read_mod_options	`{"length_tag": "", "rename": "", "strip_suffix": "", "zero_cap": false}`

Step 18: toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types float,float,float,float,float,int  --file '/tmp/tmpu2ie1xq6/job_working_directory/000/12/configs/tmp4bif5afr' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmpu2ie1xq6/files/2/1/8/dataset_218fd303-b4b9-4e68-a83e-ec4293bfc968.dat' '/tmp/tmpu2ie1xq6/job_working_directory/000/12/outputs/dataset_c63f91e7-30c0-4325-9ec2-1b0bc7ee41ce.dat'

Exit Code:

```
0
```

Standard Output:

c3*2
Computing 1 new columns with instructions ['c3*2;;']
Computed new column values for 100.00% of 1 lines written.

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"9187e9807a7a11ef9cf9b9ec166fac27"`
avoid_scientific_notation	`false`
chromInfo	`"/tmp/tmpu2ie1xq6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
error_handling	`{"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}}`
ops	`{"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3*2"}], "header_lines_select": "no"}`

Step 19: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

grep -G -A 0 -B 0 --no-group-separator  -i -- 'Haploid' '/tmp/tmpu2ie1xq6/files/3/d/e/dataset_3de43bf7-51dc-4174-be91-3509ef3345e5.dat' > '/tmp/tmpu2ie1xq6/job_working_directory/000/13/outputs/dataset_db02bfe1-dcf8-4fb1-b8a9-ce80b374b90b.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"9187e9807a7a11ef9cf9b9ec166fac27"`
case_sensitive	`"-i"`
chromInfo	`"/tmp/tmpu2ie1xq6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
color	`"NOCOLOR"`
dbkey	`"?"`
invert	`""`
lines_after	`"0"`
lines_before	`"0"`
regex_type	`"-G"`
url_paste	`"Haploid"`

Step 20: toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

die() { echo "$@" 1>&2 ; exit 1; } &&  mkdir multiqc_WDir &&   mkdir multiqc_WDir/cutadapt_0 &&     ln -s '/tmp/tmpu2ie1xq6/files/7/5/8/dataset_758aa7e4-ad74-4463-bfa7-44c6d284cfa4.dat' 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' && sed -i.old 's/You are running/This is/' 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' && grep -q "This is cutadapt" 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' || die "'This is cutadapt' or 'You are running cutadapt' not found in the file" &&   multiqc multiqc_WDir --filename 'report'       && mkdir -p ./plots && ls -l ./report_data/ && cp ./report_data/*plot*.txt ./plots/ | true

Exit Code:

```
0
```

Standard Error:

/// MultiQC 🔍 v1.24.1

     version_check | MultiQC Version v1.25 now available!
       file_search | Search path: /tmp/tmpu2ie1xq6/job_working_directory/000/14/working/multiqc_WDir

          cutadapt | Found 1 reports

     write_results | Data        : report_data
     write_results | Report      : report.html
           multiqc | MultiQC complete

Standard Output:

total 72
-rw-r--r-- 1 1001 127    93 Sep 24 13:41 cutadapt_filtered_reads_plot.txt
-rw-r--r-- 1 1001 127    66 Sep 24 13:41 cutadapt_trimmed_sequences_plot_default_Counts.txt
-rw-r--r-- 1 1001 127    70 Sep 24 13:41 cutadapt_trimmed_sequences_plot_default_Obs_Exp.txt
-rw-r--r-- 1 1001 127   124 Sep 24 13:41 multiqc_citations.txt
-rw-r--r-- 1 1001 127   222 Sep 24 13:41 multiqc_cutadapt.txt
-rw-r--r-- 1 1001 127 39110 Sep 24 13:41 multiqc_data.json
-rw-r--r-- 1 1001 127   105 Sep 24 13:41 multiqc_general_stats.txt
-rw-r--r-- 1 1001 127    29 Sep 24 13:41 multiqc_software_versions.txt
-rw-r--r-- 1 1001 127   190 Sep 24 13:41 multiqc_sources.txt

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"9187e9807a7a11ef9cf9b9ec166fac27"`
chromInfo	`"/tmp/tmpu2ie1xq6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
comment	`""`
dbkey	`"?"`
export	`false`
flat	`false`
results	`[{"__index__": 0, "software_cond": {"__current_case__": 5, "input": {"values": [{"id": 5, "src": "hdca"}]}, "software": "cutadapt"}}]`
saveLog	`"false"`
title	`""`

Step 3: Maternal Illumina reads (hap2):
- step_state: scheduled

Step 21: Cut1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl '/tmp/tmpu2ie1xq6/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpu2ie1xq6/files/c/6/3/dataset_c63f91e7-30c0-4325-9ec2-1b0bc7ee41ce.dat' 'c7' T '/tmp/tmpu2ie1xq6/job_working_directory/000/15/outputs/dataset_2b0e21fb-2243-404d-a3ab-5d7b18a68483.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"9187e9807a7a11ef9cf9b9ec166fac27"`
chromInfo	`"/tmp/tmpu2ie1xq6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
columnList	`"c7"`
dbkey	`"?"`
delimiter	`"T"`

Step 22: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

sed -r --sandbox -e 's/bp//g' -e 's/,//g' -e 's/([a-z])\s+([A-Z])/\1_\2/g' '/tmp/tmpu2ie1xq6/files/d/b/0/dataset_db02bfe1-dcf8-4fb1-b8a9-ce80b374b90b.dat' > '/tmp/tmpu2ie1xq6/job_working_directory/000/16/outputs/dataset_699be2f0-7e9b-42f1-b7fe-1fe5df5dcc6f.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"9187e9807a7a11ef9cf9b9ec166fac27"`
chromInfo	`"/tmp/tmpu2ie1xq6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
replacements	`[{"__index__": 0, "find_pattern": "bp", "replace_pattern": ""}, {"__index__": 1, "find_pattern": ",", "replace_pattern": ""}, {"__index__": 2, "find_pattern": "([a-z])\\s+([A-Z])", "replace_pattern": "\\1_\\2"}]`

Step 23: param_value_from_file:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"9187e9807a7a11ef9cf9b9ec166fac27"`
chromInfo	`"/tmp/tmpu2ie1xq6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
param_type	`"integer"`
remove_newlines	`true`

Step 24: Convert characters1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python /tmp/tmpu2ie1xq6/galaxy-dev/tools/filters/convert_characters.py --strip --condense /tmp/tmpu2ie1xq6/files/6/9/9/dataset_699be2f0-7e9b-42f1-b7fe-1fe5df5dcc6f.dat s /tmp/tmpu2ie1xq6/job_working_directory/000/18/outputs/dataset_f4a0b40f-ef44-49d3-9d19-5255d8529c98.dat

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"txt"`
__workflow_invocation_uuid__	`"9187e9807a7a11ef9cf9b9ec166fac27"`
chromInfo	`"/tmp/tmpu2ie1xq6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
condense	`true`
convert_from	`"s"`
dbkey	`"?"`
strip	`true`

Step 25: Homozygous read coverage for Hifiasm:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"9187e9807a7a11ef9cf9b9ec166fac27"`
chromInfo	`"/tmp/tmpu2ie1xq6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
style_cond	`{"__current_case__": 0, "pick_style": "first", "type_cond": {"__current_case__": 1, "param_type": "integer", "pick_from": [{"__index__": 0, "value": null}, {"__index__": 1, "value": "21"}]}}`

Step 26: Cut1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl '/tmp/tmpu2ie1xq6/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpu2ie1xq6/files/f/4/a/dataset_f4a0b40f-ef44-49d3-9d19-5255d8529c98.dat' 'c3' T '/tmp/tmpu2ie1xq6/job_working_directory/000/19/outputs/dataset_76b1a267-87bf-4645-924a-a8f4a2a7fe55.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"9187e9807a7a11ef9cf9b9ec166fac27"`
chromInfo	`"/tmp/tmpu2ie1xq6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
columnList	`"c3"`
dbkey	`"?"`
delimiter	`"T"`

Step 27: toolshed.g2.bx.psu.edu/repos/bgruening/hifiasm/hifiasm/0.19.9+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -s '/tmp/tmpu2ie1xq6/files/a/3/b/dataset_a3bc77e7-04e0-4b10-8808-d8f7e4df268b.dat' input_0.fastq.gz &&  ln -s '/tmp/tmpu2ie1xq6/files/9/5/2/dataset_952a5638-1adf-4d30-bb9a-888d9416f044.dat' hap1_input_0.fastqsanger &&  ln -s '/tmp/tmpu2ie1xq6/files/7/a/d/dataset_7ad27a38-60fc-44eb-8572-ce702749ec5a.dat' hap1_input_1.fastqsanger &&  ln -s '/tmp/tmpu2ie1xq6/files/e/b/3/dataset_eb3ce23a-ac68-441d-8098-c5f4efdf909d.dat' hap2_input_0.fastqsanger &&  ln -s '/tmp/tmpu2ie1xq6/files/d/8/1/dataset_d81ae627-6f1d-434e-add7-f3611e92b737.dat' hap2_input_1.fastqsanger &&  yak count -k31 -b32 -t${GALAXY_SLOTS:-1} -o hap1.yak hap1_input_0.fastqsanger hap1_input_1.fastqsanger && yak count -k31 -b32 -t${GALAXY_SLOTS:-1} -o hap2.yak hap2_input_0.fastqsanger hap2_input_1.fastqsanger && hifiasm -t ${GALAXY_SLOTS:-1} -o output -f 32 -a 4 -z 0 -m 10000000 -p 100000 -n 3 -x 0.8 -y 0.2   --hom-cov 21 -1 hap1.yak -2 hap2.yak -c 2 -d 5 --trio-dual    --primary input_0.fastq.gz 2> output.log  && mkdir noseq_files && mv *.noseq.gfa noseq_files

Exit Code:

```
0
```

Standard Error:

[M::worker_pipeline::0.253*1.00] processed 10 sequences; 0 distinct k-mers in the hash table
[M::worker_pipeline::0.297*1.00] processed 10 sequences; 0 distinct k-mers in the hash table
[M::main_count] 0 distinct k-mers after shrinking
[M::yak_ch_dump] dumpped the hash table to file 'hap1.yak'.
[M::main] Version: 0.1-r56
[M::main] CMD: yak count -k31 -b32 -t1 -o hap1.yak hap1_input_0.fastqsanger hap1_input_1.fastqsanger
[M::main] Real time: 0.298 sec; CPU: 0.298 sec; Peak RSS: 0.506 GB
[M::worker_pipeline::0.226*1.00] processed 10 sequences; 0 distinct k-mers in the hash table
[M::worker_pipeline::0.275*1.00] processed 10 sequences; 0 distinct k-mers in the hash table
[M::main_count] 0 distinct k-mers after shrinking
[M::yak_ch_dump] dumpped the hash table to file 'hap2.yak'.
[M::main] Version: 0.1-r56
[M::main] CMD: yak count -k31 -b32 -t1 -o hap2.yak hap2_input_0.fastqsanger hap2_input_1.fastqsanger
[M::main] Real time: 0.277 sec; CPU: 0.276 sec; Peak RSS: 0.506 GB

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"fastq.gz"`
__workflow_invocation_uuid__	`"9187e9807a7a11ef9cf9b9ec166fac27"`
advanced_options	`{"__current_case__": 0, "advanced_selector": "blank"}`
assembly_options	`{"__current_case__": 1, "adapter_length": "0", "assembly_selector": "set", "cleaning_rounds": "4", "disable_post_join": false, "hom_cov": "21", "ignore_error_corrected": false, "max_overlap": "0.8", "min_overlap": "0.2", "pop_contigs": "10000000", "pop_unitigs": "100000", "remove_tips": "3"}`
bins_out	`false`
chromInfo	`"/tmp/tmpu2ie1xq6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter_bits	`"32"`
hic_partition	`{"__current_case__": 0, "hic_partition_selector": "blank"}`
log_out	`true`
mode	`{"__current_case__": 1, "max_kmers": "2", "min_kmers": "5", "mode_selector": "trio", "reads": {"values": [{"id": 4, "src": "hdca"}]}, "trio_dual": true, "trioinput": {"__current_case__": 0, "hap1_reads": {"values": [{"id": 2, "src": "hdca"}]}, "hap2_reads": {"values": [{"id": 3, "src": "hdca"}]}, "trio_input_selector": "reads"}, "yak_kmer_length": "31"}`
ont_integration	`{"__current_case__": 0, "ont_integration_selector": "blank"}`
purge_options	`{"__current_case__": 0, "purge_selector": "blank"}`
scaffolding_options	`{"__current_case__": 0, "scaffold_selector": "blank"}`

Step 28: Estimated genome size:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"9187e9807a7a11ef9cf9b9ec166fac27"`
chromInfo	`"/tmp/tmpu2ie1xq6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
param_type	`"integer"`
remove_newlines	`true`

Step 29: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmpu2ie1xq6/files/2/5/e/dataset_25ef91b4-90df-40a2-8542-b8a16a46309c.dat' --discover-paths -o dataset.gfa --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset

Exit Code:

```
0
```

Standard Output:

+++Assembly summary+++: 
# scaffolds: 85
Total scaffold length: 2065905
Average scaffold length: 24304.76
Scaffold N50: 22121
Scaffold auN: 34217.52
Scaffold L50: 30
Largest scaffold: 132637
Smallest scaffold: 11410
# contigs: 85
Total contig length: 2065905
Average contig length: 24304.76
Contig N50: 22121
Contig auN: 34217.52
Contig L50: 30
Largest contig: 132637
Smallest contig: 11410
# gaps in scaffolds: 0
Total gap length in scaffolds: 0
Average gap length in scaffolds: 0.00
Gap N50 in scaffolds: 0
Gap auN in scaffolds: 0.00
Gap L50 in scaffolds: 0
Largest gap in scaffolds: 0
Smallest gap in scaffolds: 0
Base composition (A:C:G:T): 630683:399587:403407:632228
GC content %: 38.87
# soft-masked bases: 0
# segments: 85
Total segment length: 2065905
Average segment length: 24304.76
# gaps: 0
# paths: 85
# edges: 4
Average degree: 0.05
# connected components: 1
Largest connected component length: 96577
# dead ends: 167
# disconnected components: 82
Total length disconnected components: 1969328
# separated components: 83
# bubbles: 0
# circular segments: 0

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"9187e9807a7a11ef9cf9b9ec166fac27"`
chromInfo	`"/tmp/tmpu2ie1xq6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 4, "out_format": "gfa", "terminal_overlaps_condition": {"__current_case__": 0, "terminal_overlaps_select": "no"}}, "selector": "manipulation", "sort": "", "swiss_army_knife": null}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 30: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmpu2ie1xq6/files/0/b/a/dataset_0ba982c2-3eb8-431b-937e-48d6cb7d5408.dat' --discover-paths -o dataset.gfa --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset

Exit Code:

```
0
```

Standard Output:

+++Assembly summary+++: 
# scaffolds: 23
Total scaffold length: 730998
Average scaffold length: 31782.52
Scaffold N50: 25430
Scaffold auN: 54929.70
Scaffold L50: 6
Largest scaffold: 132637
Smallest scaffold: 16240
# contigs: 23
Total contig length: 730998
Average contig length: 31782.52
Contig N50: 25430
Contig auN: 54929.70
Contig L50: 6
Largest contig: 132637
Smallest contig: 16240
# gaps in scaffolds: 0
Total gap length in scaffolds: 0
Average gap length in scaffolds: 0.00
Gap N50 in scaffolds: 0
Gap auN in scaffolds: 0.00
Gap L50 in scaffolds: 0
Largest gap in scaffolds: 0
Smallest gap in scaffolds: 0
Base composition (A:C:G:T): 219106:144177:146357:221358
GC content %: 39.74
# soft-masked bases: 0
# segments: 23
Total segment length: 730998
Average segment length: 31782.52
# gaps: 0
# paths: 23

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"9187e9807a7a11ef9cf9b9ec166fac27"`
chromInfo	`"/tmp/tmpu2ie1xq6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 4, "out_format": "gfa", "terminal_overlaps_condition": {"__current_case__": 0, "terminal_overlaps_select": "no"}}, "selector": "manipulation", "sort": "", "swiss_army_knife": null}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 4: Meryl Database : Child:
- step_state: scheduled

Step 31: Raw Unitig Image:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -s '/tmp/tmpu2ie1xq6/files/e/0/c/dataset_e0cc69c9-f8e7-4c2f-bd3f-eb1b1177e970.dat' input.gfa &&  export QT_QPA_PLATFORM='offscreen' && Bandage image input.gfa 'out.png' --height '2000' --nodewidth '25.0'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"9187e9807a7a11ef9cf9b9ec166fac27"`
chromInfo	`"/tmp/tmpu2ie1xq6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
fontsize	`None`
height	`"2000"`
lengths	`false`
names	`false`
nodewidth	`"25.0"`
output_format	`"png"`
width	`None`

Step 32: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmpu2ie1xq6/files/2/5/e/dataset_25ef91b4-90df-40a2-8542-b8a16a46309c.dat' --discover-paths -o dataset.fasta --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset

Exit Code:

```
0
```

Standard Output:

+++Assembly summary+++: 
# scaffolds: 85
Total scaffold length: 2065905
Average scaffold length: 24304.76
Scaffold N50: 22121
Scaffold auN: 34217.52
Scaffold L50: 30
Largest scaffold: 132637
Smallest scaffold: 11410
# contigs: 85
Total contig length: 2065905
Average contig length: 24304.76
Contig N50: 22121
Contig auN: 34217.52
Contig L50: 30
Largest contig: 132637
Smallest contig: 11410
# gaps in scaffolds: 0
Total gap length in scaffolds: 0
Average gap length in scaffolds: 0.00
Gap N50 in scaffolds: 0
Gap auN in scaffolds: 0.00
Gap L50 in scaffolds: 0
Largest gap in scaffolds: 0
Smallest gap in scaffolds: 0
Base composition (A:C:G:T): 630683:399587:403407:632228
GC content %: 38.87
# soft-masked bases: 0
# segments: 85
Total segment length: 2065905
Average segment length: 24304.76
# gaps: 0
# paths: 85
# edges: 4
Average degree: 0.05
# connected components: 1
Largest connected component length: 96577
# dead ends: 167
# disconnected components: 82
Total length disconnected components: 1969328
# separated components: 83
# bubbles: 0
# circular segments: 0

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"9187e9807a7a11ef9cf9b9ec166fac27"`
chromInfo	`"/tmp/tmpu2ie1xq6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 0, "line_length": null, "out_format": "fasta"}, "selector": "manipulation", "sort": "", "swiss_army_knife": null}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 33: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmpu2ie1xq6/files/0/b/a/dataset_0ba982c2-3eb8-431b-937e-48d6cb7d5408.dat' --discover-paths -o dataset.fasta --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset

Exit Code:

```
0
```

Standard Output:

+++Assembly summary+++: 
# scaffolds: 23
Total scaffold length: 730998
Average scaffold length: 31782.52
Scaffold N50: 25430
Scaffold auN: 54929.70
Scaffold L50: 6
Largest scaffold: 132637
Smallest scaffold: 16240
# contigs: 23
Total contig length: 730998
Average contig length: 31782.52
Contig N50: 25430
Contig auN: 54929.70
Contig L50: 6
Largest contig: 132637
Smallest contig: 16240
# gaps in scaffolds: 0
Total gap length in scaffolds: 0
Average gap length in scaffolds: 0.00
Gap N50 in scaffolds: 0
Gap auN in scaffolds: 0.00
Gap L50 in scaffolds: 0
Largest gap in scaffolds: 0
Smallest gap in scaffolds: 0
Base composition (A:C:G:T): 219106:144177:146357:221358
GC content %: 39.74
# soft-masked bases: 0
# segments: 23
Total segment length: 730998
Average segment length: 31782.52
# gaps: 0
# paths: 23

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"9187e9807a7a11ef9cf9b9ec166fac27"`
chromInfo	`"/tmp/tmpu2ie1xq6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 0, "line_length": null, "out_format": "fasta"}, "selector": "manipulation", "sort": "", "swiss_army_knife": null}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 34: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmpu2ie1xq6/files/2/5/e/dataset_25ef91b4-90df-40a2-8542-b8a16a46309c.dat' --out-size c  --discover-paths --tabular > '/tmp/tmpu2ie1xq6/job_working_directory/000/28/outputs/dataset_6c62b43a-be0f-4905-96cd-9132bf20b589.dat' --threads ${GALAXY_SLOTS:-8}

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"9187e9807a7a11ef9cf9b9ec166fac27"`
chromInfo	`"/tmp/tmpu2ie1xq6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 1, "discover_paths": true, "locale": false, "selector": "statistics", "statistics_condition": {"__current_case__": 0, "out_size": "c", "selector": "size"}, "tabular": true}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 35: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmpu2ie1xq6/files/0/b/a/dataset_0ba982c2-3eb8-431b-937e-48d6cb7d5408.dat' --out-size c  --discover-paths --tabular > '/tmp/tmpu2ie1xq6/job_working_directory/000/29/outputs/dataset_fe05c598-63bd-4437-81c0-46f172e1a8b4.dat' --threads ${GALAXY_SLOTS:-8}

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"9187e9807a7a11ef9cf9b9ec166fac27"`
chromInfo	`"/tmp/tmpu2ie1xq6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 1, "discover_paths": true, "locale": false, "selector": "statistics", "statistics_condition": {"__current_case__": 0, "out_size": "c", "selector": "size"}, "tabular": true}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 36: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmpu2ie1xq6/files/0/b/a/dataset_0ba982c2-3eb8-431b-937e-48d6cb7d5408.dat' 2288021 --nstar-report --locale en_US.UTF-8 --discover-paths --tabular > '/tmp/tmpu2ie1xq6/job_working_directory/000/30/outputs/dataset_aec18975-4489-4544-bddb-6124599b9856.dat' --threads ${GALAXY_SLOTS:-8}

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"9187e9807a7a11ef9cf9b9ec166fac27"`
chromInfo	`"/tmp/tmpu2ie1xq6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 1, "discover_paths": true, "locale": true, "selector": "statistics", "statistics_condition": {"__current_case__": 2, "expected_genomesize": "2288021", "selector": "assembly"}, "tabular": true}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 37: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmpu2ie1xq6/files/2/5/e/dataset_25ef91b4-90df-40a2-8542-b8a16a46309c.dat' 2288021 --nstar-report --locale en_US.UTF-8 --discover-paths --tabular > '/tmp/tmpu2ie1xq6/job_working_directory/000/31/outputs/dataset_65b340e8-d31f-46a7-b04b-e6a2c2a3e44f.dat' --threads ${GALAXY_SLOTS:-8}

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"9187e9807a7a11ef9cf9b9ec166fac27"`
chromInfo	`"/tmp/tmpu2ie1xq6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 1, "discover_paths": true, "locale": true, "selector": "statistics", "statistics_condition": {"__current_case__": 2, "expected_genomesize": "2288021", "selector": "assembly"}, "tabular": true}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 38: toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.7.1+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

busco --in '/tmp/tmpu2ie1xq6/files/d/2/7/dataset_d27e0996-0dd2-4464-9740-a52b4e83873c.dat' --mode 'geno' --out busco_galaxy --cpu ${GALAXY_SLOTS:-4} --evalue 0.001 --limit 3 --contig_break 10  --offline --download_path /cvmfs/data.galaxyproject.org/byhand/busco/v5  --lineage_dataset 'vertebrata_odb10'  --miniprot  && mkdir BUSCO_summaries && ls -l busco_galaxy/run_*/ && cp busco_galaxy/short_summary.*.txt BUSCO_summaries/ && generate_plot.py -wd BUSCO_summaries -rt specific  && echo "##gff-version 3" > busco_output.gff && cat busco_galaxy/run_*/busco_sequences/*busco_sequences/*.gff >> busco_output.gff 2> /dev/null || true

Exit Code:

```
0
```

Standard Error:

2024-09-24 14:06:18 ERROR:	Something went wrong. Results not recorded.
2024-09-24 14:06:18 ERROR:	BUSCO analysis failed!
2024-09-24 14:06:18 ERROR:	Check the logs, read the user guide (https://busco.ezlab.org/busco_userguide.html), and check the BUSCO issue board on https://gitlab.com/ezlab/busco/issues

Standard Output:

2024-09-24 13:47:52 INFO:	***** Start a BUSCO v5.7.1 analysis, current time: 09/24/2024 13:47:52 *****
2024-09-24 13:47:52 INFO:	Configuring BUSCO with local environment
2024-09-24 13:47:52 INFO:	Running genome mode
2024-09-24 13:47:53 INFO:	Input file is /tmp/tmpu2ie1xq6/files/d/2/7/dataset_d27e0996-0dd2-4464-9740-a52b4e83873c.dat
2024-09-24 13:47:53 WARNING:	Option evalue was provided but is not used in the selected run mode, euk_genome_min
2024-09-24 13:47:53 WARNING:	Option limit was provided but is not used in the selected run mode, euk_genome_min
2024-09-24 13:47:54 INFO:	Running BUSCO using lineage dataset vertebrata_odb10 (eukaryota, 2021-02-19)
2024-09-24 13:47:54 INFO:	Running 1 job(s) on bbtools, starting at 09/24/2024 13:47:54
2024-09-24 13:47:55 INFO:	[bbtools]	1 of 1 task(s) completed
2024-09-24 13:47:55 INFO:	Running 1 job(s) on miniprot_index, starting at 09/24/2024 13:47:55
2024-09-24 13:47:56 INFO:	[miniprot_index]	1 of 1 task(s) completed
2024-09-24 13:47:56 INFO:	Running 1 job(s) on miniprot_align, starting at 09/24/2024 13:47:56
2024-09-24 14:05:44 INFO:	[miniprot_align]	1 of 1 task(s) completed
2024-09-24 14:05:51 INFO:	***** Run HMMER on gene sequences *****
2024-09-24 14:05:52 INFO:	Running 621 job(s) on hmmsearch, starting at 09/24/2024 14:05:52
2024-09-24 14:05:56 INFO:	[hmmsearch]	63 of 621 task(s) completed
2024-09-24 14:05:59 INFO:	[hmmsearch]	125 of 621 task(s) completed
2024-09-24 14:06:01 INFO:	[hmmsearch]	187 of 621 task(s) completed
2024-09-24 14:06:03 INFO:	[hmmsearch]	249 of 621 task(s) completed
2024-09-24 14:06:06 INFO:	[hmmsearch]	311 of 621 task(s) completed
2024-09-24 14:06:09 INFO:	[hmmsearch]	373 of 621 task(s) completed
2024-09-24 14:06:11 INFO:	[hmmsearch]	435 of 621 task(s) completed
2024-09-24 14:06:13 INFO:	[hmmsearch]	497 of 621 task(s) completed
2024-09-24 14:06:15 INFO:	[hmmsearch]	559 of 621 task(s) completed
2024-09-24 14:06:18 INFO:	[hmmsearch]	621 of 621 task(s) completed
2024-09-24 14:06:18 INFO:	51 exons in total
2024-09-24 14:06:18 WARNING:	2 of 40 Complete matches (5.0%) contain internal stop codons in Miniprot gene predictions
2024-09-24 14:06:18 WARNING:	BUSCO gene predictions from Miniprot have low average identity (0.46000000834465027). You may want to repeat the analysis using the Metaeuk pipeline.

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"9187e9807a7a11ef9cf9b9ec166fac27"`
adv	`{"contig_break": "10", "evalue": "0.001", "limit": "3"}`
busco_mode	`{"__current_case__": 0, "mode": "geno", "use_augustus": {"__current_case__": 1, "use_augustus_selector": "miniprot"}}`
chromInfo	`"/tmp/tmpu2ie1xq6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
lineage	`{"__current_case__": 1, "lineage_dataset": "vertebrata_odb10", "lineage_mode": "select_lineage"}`
lineage_conditional	`{"__current_case__": 0, "cached_db": "v5", "selector": "cached"}`
outputs	`["short_summary", "missing", "image", "gff"]`

Step 39: toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.7.1+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

busco --in '/tmp/tmpu2ie1xq6/files/a/4/5/dataset_a45996db-7a43-4726-a736-259dd424b794.dat' --mode 'geno' --out busco_galaxy --cpu ${GALAXY_SLOTS:-4} --evalue 0.001 --limit 3 --contig_break 10  --offline --download_path /cvmfs/data.galaxyproject.org/byhand/busco/v5  --lineage_dataset 'vertebrata_odb10'  --miniprot  && mkdir BUSCO_summaries && ls -l busco_galaxy/run_*/ && cp busco_galaxy/short_summary.*.txt BUSCO_summaries/ && generate_plot.py -wd BUSCO_summaries -rt specific  && echo "##gff-version 3" > busco_output.gff && cat busco_galaxy/run_*/busco_sequences/*busco_sequences/*.gff >> busco_output.gff 2> /dev/null || true

Exit Code:

```
0
```

Standard Error:

2024-09-24 13:57:39 ERROR:	Something went wrong. Results not recorded.
2024-09-24 13:57:39 ERROR:	BUSCO analysis failed!
2024-09-24 13:57:39 ERROR:	Check the logs, read the user guide (https://busco.ezlab.org/busco_userguide.html), and check the BUSCO issue board on https://gitlab.com/ezlab/busco/issues

Standard Output:

2024-09-24 13:47:51 INFO:	***** Start a BUSCO v5.7.1 analysis, current time: 09/24/2024 13:47:51 *****
2024-09-24 13:47:51 INFO:	Configuring BUSCO with local environment
2024-09-24 13:47:51 INFO:	Running genome mode
2024-09-24 13:47:53 INFO:	Input file is /tmp/tmpu2ie1xq6/files/a/4/5/dataset_a45996db-7a43-4726-a736-259dd424b794.dat
2024-09-24 13:47:53 WARNING:	Option evalue was provided but is not used in the selected run mode, euk_genome_min
2024-09-24 13:47:53 WARNING:	Option limit was provided but is not used in the selected run mode, euk_genome_min
2024-09-24 13:47:54 INFO:	Running BUSCO using lineage dataset vertebrata_odb10 (eukaryota, 2021-02-19)
2024-09-24 13:47:54 INFO:	Running 1 job(s) on bbtools, starting at 09/24/2024 13:47:54
2024-09-24 13:47:55 INFO:	[bbtools]	1 of 1 task(s) completed
2024-09-24 13:47:55 INFO:	Running 1 job(s) on miniprot_index, starting at 09/24/2024 13:47:55
2024-09-24 13:47:56 INFO:	[miniprot_index]	1 of 1 task(s) completed
2024-09-24 13:47:56 INFO:	Running 1 job(s) on miniprot_align, starting at 09/24/2024 13:47:56
2024-09-24 13:57:19 INFO:	[miniprot_align]	1 of 1 task(s) completed
2024-09-24 13:57:21 INFO:	***** Run HMMER on gene sequences *****
2024-09-24 13:57:21 INFO:	Running 347 job(s) on hmmsearch, starting at 09/24/2024 13:57:21
2024-09-24 13:57:24 INFO:	[hmmsearch]	35 of 347 task(s) completed
2024-09-24 13:57:25 INFO:	[hmmsearch]	70 of 347 task(s) completed
2024-09-24 13:57:27 INFO:	[hmmsearch]	105 of 347 task(s) completed
2024-09-24 13:57:28 INFO:	[hmmsearch]	139 of 347 task(s) completed
2024-09-24 13:57:29 INFO:	[hmmsearch]	174 of 347 task(s) completed
2024-09-24 13:57:30 INFO:	[hmmsearch]	209 of 347 task(s) completed
2024-09-24 13:57:32 INFO:	[hmmsearch]	243 of 347 task(s) completed
2024-09-24 13:57:34 INFO:	[hmmsearch]	278 of 347 task(s) completed
2024-09-24 13:57:36 INFO:	[hmmsearch]	313 of 347 task(s) completed
2024-09-24 13:57:38 INFO:	[hmmsearch]	347 of 347 task(s) completed
2024-09-24 13:57:38 INFO:	12 exons in total
2024-09-24 13:57:39 WARNING:	1 of 9 Complete matches (11.1%) contain internal stop codons in Miniprot gene predictions

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"9187e9807a7a11ef9cf9b9ec166fac27"`
adv	`{"contig_break": "10", "evalue": "0.001", "limit": "3"}`
busco_mode	`{"__current_case__": 0, "mode": "geno", "use_augustus": {"__current_case__": 1, "use_augustus_selector": "miniprot"}}`
chromInfo	`"/tmp/tmpu2ie1xq6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
lineage	`{"__current_case__": 1, "lineage_dataset": "vertebrata_odb10", "lineage_mode": "select_lineage"}`
lineage_conditional	`{"__current_case__": 0, "cached_db": "v5", "selector": "cached"}`
outputs	`["short_summary", "missing", "image", "gff"]`

Step 40: toolshed.g2.bx.psu.edu/repos/iuc/merqury/merqury/1.3+galaxy4:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

mkdir -p output_files && mkdir -p read-db.meryl pat.meryl mat.meryl && tar -zxf /tmp/tmpu2ie1xq6/files/1/8/9/dataset_189a0e23-fc6d-4513-aa2b-2d3e0903444f.dat -C read-db.meryl --strip-components=1 && tar -zxf /tmp/tmpu2ie1xq6/files/3/2/1/dataset_321ae82f-01d1-4666-9854-c1d49a09e626.dat -C pat.meryl --strip-components=1 && tar -zxf /tmp/tmpu2ie1xq6/files/d/c/a/dataset_dca6f26a-bf7a-4c1a-b298-0b6516963c33.dat -C mat.meryl --strip-components=1 && ln -s '/tmp/tmpu2ie1xq6/files/d/2/7/dataset_d27e0996-0dd2-4464-9740-a52b4e83873c.dat' assembly_01.fasta && ln -s '/tmp/tmpu2ie1xq6/files/a/4/5/dataset_a45996db-7a43-4726-a736-259dd424b794.dat' assembly_02.fasta && merqury.sh read-db.meryl pat.meryl mat.meryl assembly_01.fasta assembly_02.fasta output_merqury &> /tmp/tmpu2ie1xq6/job_working_directory/000/34/outputs/dataset_540bf01a-8f0d-478d-a90b-a6f3d77b7d19.dat && mv output_merqury* output_files && find . -maxdepth 1 -name 'assembly_only*' -type f -print0 | xargs -0r mv -t output_files  && sed -i '1s/^/assembly\tk-mer set\tsolid k-mers in assembly\tsolid k-mers in reads\tcompleteness %\n/' 'output_files/output_merqury.completeness.stats' && sed -i '1s/^/assembly\tunique k-mers\tcommon k-mers\tQV\terror rate\n/' 'output_files/output_merqury.qv'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"9187e9807a7a11ef9cf9b9ec166fac27"`
chromInfo	`"/tmp/tmpu2ie1xq6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
label	`"output_merqury"`
mode	`{"__current_case__": 1, "assembly_options": {"__current_case__": 1, "assembly_01": {"values": [{"id": 33, "src": "hda"}]}, "assembly_02": {"values": [{"id": 34, "src": "hda"}]}, "number_assemblies": "two"}, "meryldb_F1": {"values": [{"id": 1, "src": "hda"}]}, "meryldb_MAT": {"values": [{"id": 3, "src": "hda"}]}, "meryldb_PAT": {"values": [{"id": 2, "src": "hda"}]}, "options": "trio"}`
output_add_headers	`true`
output_selector	`["qv", "plots", "sizes", "stats", "bed", "wig", "log", "hist"]`

Step 5: Hapmer Database : Paternal:
- step_state: scheduled

Step 41: Data prep Hap1:

step_state: scheduled

Subworkflow Steps

Step 1: gfa_stats:
- step_state: scheduled

Step 2: sort1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/tmpu2ie1xq6/galaxy-dev/tools/filters/sorter.py'  --input='/tmp/tmpu2ie1xq6/files/6/c/6/dataset_6c62b43a-be0f-4905-96cd-9132bf20b589.dat' --output='/tmp/tmpu2ie1xq6/job_working_directory/000/35/outputs/dataset_90390c1a-b15a-4336-a4bd-8698bd4cc8c7.dat'    --key=2,2nr   --header 0

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"9187e9817a7a11ef9cf9b9ec166fac27"`
chromInfo	`"/tmp/tmpu2ie1xq6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
column	`"2"`
column_set	`[]`
dbkey	`"?"`
header_lines	`"0"`
order	`"DESC"`
style	`"num"`

Step 3: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmpu2ie1xq6/job_working_directory/000/36/configs/tmp7jkd5z5t' '/tmp/tmpu2ie1xq6/files/9/0/3/dataset_90390c1a-b15a-4336-a4bd-8698bd4cc8c7.dat' > '/tmp/tmpu2ie1xq6/job_working_directory/000/36/outputs/dataset_bb676150-4bc1-4a96-9ed5-fb668d5a7661.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"9187e9817a7a11ef9cf9b9ec166fac27"`
chromInfo	`"/tmp/tmpu2ie1xq6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
code	`"{total += $2; $3 = total}1"`
dbkey	`"?"`

Step 4: toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.8+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

datamash         absmax 3 < /tmp/tmpu2ie1xq6/files/b/b/6/dataset_bb676150-4bc1-4a96-9ed5-fb668d5a7661.dat > '/tmp/tmpu2ie1xq6/job_working_directory/000/37/outputs/dataset_b8c17ac0-24ba-4fae-98c1-4541b2b4676a.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"9187e9817a7a11ef9cf9b9ec166fac27"`
chromInfo	`"/tmp/tmpu2ie1xq6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
grouping	`""`
header_in	`false`
header_out	`false`
ignore_case	`false`
narm	`false`
need_sort	`false`
operations	`[{"__index__": 0, "op_column": "3", "op_name": "absmax"}]`
print_full_line	`false`

Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpu2ie1xq6/files/b/b/6/dataset_bb676150-4bc1-4a96-9ed5-fb668d5a7661.dat" "/tmp/tmpu2ie1xq6/job_working_directory/000/38/outputs/dataset_9c13c682-3cfa-438b-93e8-24ec82d71c7e.dat" "1" "yes"

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"9187e9817a7a11ef9cf9b9ec166fac27"`
chromInfo	`"/tmp/tmpu2ie1xq6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
exp	`"1"`
iterate	`"yes"`

Step 6: param_value_from_file:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"9187e9817a7a11ef9cf9b9ec166fac27"`
chromInfo	`"/tmp/tmpu2ie1xq6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
param_type	`"integer"`
remove_newlines	`true`

Step 7: toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"9187e9817a7a11ef9cf9b9ec166fac27"`
chromInfo	`"/tmp/tmpu2ie1xq6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
components	`[{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "c3/", "select_param_type": "text"}}, {"__index__": 1, "param_type": {"__current_case__": 1, "component_value": "2065905", "select_param_type": "integer"}}]`
dbkey	`"?"`

Step 8: toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types str,int,int,int  --file '/tmp/tmpu2ie1xq6/job_working_directory/000/52/configs/tmpaj_y5s9t' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmpu2ie1xq6/files/9/c/1/dataset_9c13c682-3cfa-438b-93e8-24ec82d71c7e.dat' '/tmp/tmpu2ie1xq6/job_working_directory/000/52/outputs/dataset_6e193fef-0b7a-4391-92f1-ac4dbe742726.dat'

Exit Code:

```
0
```

Standard Output:

c3/2065905
c2/1000000
c3/1000000
Computing 3 new columns with instructions ['c3/2065905;;', 'c2/1000000;;', 'c3/1000000;;']
Computed new column values for 100.00% of 85 lines written.

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"9187e9817a7a11ef9cf9b9ec166fac27"`
avoid_scientific_notation	`false`
chromInfo	`"/tmp/tmpu2ie1xq6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
error_handling	`{"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}}`
ops	`{"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/2065905"}, {"__index__": 1, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c2/1000000"}, {"__index__": 2, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1000000"}], "header_lines_select": "no"}`

Step 42: Data Prep Hap2:

step_state: scheduled

Subworkflow Steps

Step 1: gfa_stats:
- step_state: scheduled

Step 2: sort1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/tmpu2ie1xq6/galaxy-dev/tools/filters/sorter.py'  --input='/tmp/tmpu2ie1xq6/files/f/e/0/dataset_fe05c598-63bd-4437-81c0-46f172e1a8b4.dat' --output='/tmp/tmpu2ie1xq6/job_working_directory/000/40/outputs/dataset_29c441a0-9cf7-4b6e-b5b2-d95efcb14d63.dat'    --key=2,2nr   --header 0

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"9187e9827a7a11ef9cf9b9ec166fac27"`
chromInfo	`"/tmp/tmpu2ie1xq6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
column	`"2"`
column_set	`[]`
dbkey	`"?"`
header_lines	`"0"`
order	`"DESC"`
style	`"num"`

Step 3: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmpu2ie1xq6/job_working_directory/000/41/configs/tmpbnq2nxk0' '/tmp/tmpu2ie1xq6/files/2/9/c/dataset_29c441a0-9cf7-4b6e-b5b2-d95efcb14d63.dat' > '/tmp/tmpu2ie1xq6/job_working_directory/000/41/outputs/dataset_2e1435a1-b46f-4ae1-a608-eac4ba0e21c8.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"9187e9827a7a11ef9cf9b9ec166fac27"`
chromInfo	`"/tmp/tmpu2ie1xq6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
code	`"{total += $2; $3 = total}1"`
dbkey	`"?"`

Step 4: toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.8+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

datamash         absmax 3 < /tmp/tmpu2ie1xq6/files/2/e/1/dataset_2e1435a1-b46f-4ae1-a608-eac4ba0e21c8.dat > '/tmp/tmpu2ie1xq6/job_working_directory/000/42/outputs/dataset_46b187ee-a505-4acc-ae2d-7786e14b97e5.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"9187e9827a7a11ef9cf9b9ec166fac27"`
chromInfo	`"/tmp/tmpu2ie1xq6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
grouping	`""`
header_in	`false`
header_out	`false`
ignore_case	`false`
narm	`false`
need_sort	`false`
operations	`[{"__index__": 0, "op_column": "3", "op_name": "absmax"}]`
print_full_line	`false`

Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpu2ie1xq6/files/2/e/1/dataset_2e1435a1-b46f-4ae1-a608-eac4ba0e21c8.dat" "/tmp/tmpu2ie1xq6/job_working_directory/000/43/outputs/dataset_86a1cb60-5263-424a-8a36-4aa5f5f52324.dat" "1" "yes"

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"9187e9827a7a11ef9cf9b9ec166fac27"`
chromInfo	`"/tmp/tmpu2ie1xq6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
exp	`"1"`
iterate	`"yes"`

Step 6: param_value_from_file:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"9187e9827a7a11ef9cf9b9ec166fac27"`
chromInfo	`"/tmp/tmpu2ie1xq6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
param_type	`"integer"`
remove_newlines	`true`

Step 7: toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"9187e9827a7a11ef9cf9b9ec166fac27"`
chromInfo	`"/tmp/tmpu2ie1xq6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
components	`[{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "c3/", "select_param_type": "text"}}, {"__index__": 1, "param_type": {"__current_case__": 1, "component_value": "730998", "select_param_type": "integer"}}]`
dbkey	`"?"`

Step 8: toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types str,int,int,int  --file '/tmp/tmpu2ie1xq6/job_working_directory/000/53/configs/tmp20p2lfym' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmpu2ie1xq6/files/8/6/a/dataset_86a1cb60-5263-424a-8a36-4aa5f5f52324.dat' '/tmp/tmpu2ie1xq6/job_working_directory/000/53/outputs/dataset_1c5a15dd-f2d5-4dd6-a474-c3ed1711a58b.dat'

Exit Code:

```
0
```

Standard Output:

c3/730998
c2/1000000
c3/1000000
Computing 3 new columns with instructions ['c3/730998;;', 'c2/1000000;;', 'c3/1000000;;']
Computed new column values for 100.00% of 23 lines written.

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"9187e9827a7a11ef9cf9b9ec166fac27"`
avoid_scientific_notation	`false`
chromInfo	`"/tmp/tmpu2ie1xq6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
error_handling	`{"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}}`
ops	`{"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/730998"}, {"__index__": 1, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c2/1000000"}, {"__index__": 2, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1000000"}], "header_lines_select": "no"}`

Step 43: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmpu2ie1xq6/job_working_directory/000/45/configs/tmplc8obpss' '/tmp/tmpu2ie1xq6/files/a/e/c/dataset_aec18975-4489-4544-bddb-6124599b9856.dat' > '/tmp/tmpu2ie1xq6/job_working_directory/000/45/outputs/dataset_a7e13211-6512-4c0e-9263-9f1ebdc3a47e.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"9187e9807a7a11ef9cf9b9ec166fac27"`
chromInfo	`"/tmp/tmpu2ie1xq6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
code	`"BEGIN{print \"Metric\\thap2-Maternal\"}; {print}; "`
dbkey	`"?"`

Step 44: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmpu2ie1xq6/job_working_directory/000/46/configs/tmppbxnq4jd' '/tmp/tmpu2ie1xq6/files/6/5/b/dataset_65b340e8-d31f-46a7-b04b-e6a2c2a3e44f.dat' > '/tmp/tmpu2ie1xq6/job_working_directory/000/46/outputs/dataset_f74c6582-6f49-4e53-88df-5e1c1965418e.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"9187e9807a7a11ef9cf9b9ec166fac27"`
chromInfo	`"/tmp/tmpu2ie1xq6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
code	`"BEGIN{print \"Metric\\thap1-Paternal\"}; {print}; "`
dbkey	`"?"`

Step 45: merqury_qv:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"9187e9807a7a11ef9cf9b9ec166fac27"`
input	`{"values": [{"id": 10, "src": "hdca"}]}`
which	`{"__current_case__": 1, "identifier": "output_merqury", "which_dataset": "by_identifier"}`

Step 46: output_merqury.spectra-cn.fl:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"9187e9807a7a11ef9cf9b9ec166fac27"`
input	`{"values": [{"id": 11, "src": "hdca"}]}`
which	`{"__current_case__": 1, "identifier": "output_merqury.spectra-cn.fl", "which_dataset": "by_identifier"}`

Step 47: output_merqury.spectra-asm.fl:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"9187e9807a7a11ef9cf9b9ec166fac27"`
input	`{"values": [{"id": 11, "src": "hdca"}]}`
which	`{"__current_case__": 1, "identifier": "output_merqury.spectra-asm.fl", "which_dataset": "by_identifier"}`

Step 48: output_merqury.assembly_01.spectra-cn.fl:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"9187e9807a7a11ef9cf9b9ec166fac27"`
input	`{"values": [{"id": 11, "src": "hdca"}]}`
which	`{"__current_case__": 1, "identifier": "output_merqury.assembly_01.spectra-cn.fl", "which_dataset": "by_identifier"}`

Step 49: output_merqury.assembly_02.spectra-cn.fl:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"9187e9807a7a11ef9cf9b9ec166fac27"`
input	`{"values": [{"id": 11, "src": "hdca"}]}`
which	`{"__current_case__": 1, "identifier": "output_merqury.assembly_02.spectra-cn.fl", "which_dataset": "by_identifier"}`

Step 50: merqury_stats:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"9187e9807a7a11ef9cf9b9ec166fac27"`
input	`{"values": [{"id": 13, "src": "hdca"}]}`
which	`{"__current_case__": 1, "identifier": "output_merqury.completeness", "which_dataset": "by_identifier"}`

Step 6: Hapmer Database : Maternal:
- step_state: scheduled

Step 51: Plots:

step_state: scheduled

Subworkflow Steps

Step 1: Primary data:
- step_state: scheduled
Step 2: Alternate data:
- step_state: scheduled

Step 11: Size Plot:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

cat '/tmp/tmpu2ie1xq6/job_working_directory/000/66/configs/tmpzhbul_o9' && Rscript '/tmp/tmpu2ie1xq6/job_working_directory/000/66/configs/tmpzhbul_o9'

Exit Code:

```
0
```

Standard Error:

Warning message:
In Sys.setlocale("LC_MESSAGES", "en_US.UTF-8") :
  OS reports request to set locale to "en_US.UTF-8" cannot be honored
Warning message:
package ‘ggplot2’ was built under R version 4.1.3 
Warning message:
Using `size` aesthetic for lines was deprecated in ggplot2 3.4.0.
ℹ Please use `linewidth` instead.

Standard Output:

        options(show.error.messages=F, error=function(){cat(geterrmessage(), file=stderr()); q("no",1,F)})

        loc <- Sys.setlocale("LC_MESSAGES", "en_US.UTF-8")
    

library(ggplot2)


        #Choose between automatically scaled x and y axis or user defined
            gg_scalex = NULL
            gg_scaley = NULL
    


            gg_theme = theme_bw()
    


            gg_legend = theme(legend.position="right")
    

input <- read.csv('/tmp/tmpu2ie1xq6/files/6/4/e/dataset_64e3cc18-6bb6-4a53-b453-523cdf04e5e4.dat', sep='\t', header=TRUE)

names(input)[2] <- "xcol"
names(input)[3] <- "ycol"

    gg_facet = NULL
    gg_factor = aes(colour=factor(factor))

        gg_line = geom_line(size=1, alpha=1, gg_factor)

        color_scale = scale_color_brewer(palette='Set1', direction='1')

    names(input)[1] <- "factor"


    

    gg_axistitle = theme(axis.title = element_text(color = NULL, size = NULL, face = NULL))

    gg_axistext = theme(axis.text = element_text(color = NULL, size = NULL, face = NULL))

    gg_plottitle = theme(plot.title = element_text(color = NULL, size = NULL, face = NULL))

    gg_gridline = NULL

    gg_point = NULL

#this is the actual ggplot command to make the final plot(s)
plot_out <- ggplot(input, aes(xcol, ycol)) + gg_point + gg_line + gg_facet +
    gg_theme + gg_scalex + gg_scaley + color_scale + gg_legend + ggtitle('') + xlab('Scaffold number') + ylab('Cumulative Size (Mb)')+
    gg_axistitle + gg_axistext + gg_plottitle + gg_gridline


        gg_width <- as.double('6.0')
        gg_height <- as.double('4.0')
        gg_unit <- 'in'
        gg_dpi <- as.double('300.0')
        gg_add_device <- 'none'
        output1 <- '/tmp/tmpu2ie1xq6/job_working_directory/000/66/outputs/dataset_b4e66ceb-7d64-4333-9cd0-b9bee75fdbbc.dat'
        output2 <- 'XXXX'

        ggsave(filename = output1, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = "png")
        if(gg_add_device != "none"){
          ggsave(filename = output2, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = gg_add_device)
        }

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"9187e9837a7a11ef9cf9b9ec166fac27"`
adv	{"axis_text_customization": {"__current_case__": 0, "axis_customization": "default"}, "axis_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "factor": {"__current_case__": 1, "colororder": "1", "colors": "Set1", "factorcol": "1", "factoring": "Single"}, "gridlinecust": "default", "legend": "yes", "plot_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "scaling": {"__current_case__": 0, "plot_scaling": "Automatic"}, "theme": "bw", "transform": "none", "type_conditional": {"__current_case__": 2, "type_options": "lines"}}
chromInfo	`"/tmp/tmpu2ie1xq6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
out	`{"additional_output_format": "none", "dpi_output_dim": "300.0", "height_output_dim": "4.0", "unit_output_dim": "in", "width_output_dim": "6.0"}`
title	`""`
xlab	`"Scaffold number"`
xplot	`"2"`
ylab	`"Cumulative Size (Mb)"`
yplot	`"3"`

Step 3: Name of primary assembly:
- step_state: scheduled
Step 4: Name of alternate assembly:
- step_state: scheduled

Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpu2ie1xq6/files/6/e/1/dataset_6e193fef-0b7a-4391-92f1-ac4dbe742726.dat" "/tmp/tmpu2ie1xq6/job_working_directory/000/60/outputs/dataset_ae0d1e37-8943-473d-8870-7025525fd054.dat" "Hap1" "no"

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"9187e9837a7a11ef9cf9b9ec166fac27"`
chromInfo	`"/tmp/tmpu2ie1xq6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
exp	`"Hap1"`
iterate	`"no"`

Step 6: toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpu2ie1xq6/files/1/c/5/dataset_1c5a15dd-f2d5-4dd6-a474-c3ed1711a58b.dat" "/tmp/tmpu2ie1xq6/job_working_directory/000/61/outputs/dataset_04c39c1d-500c-4a19-a224-1c465eac5945.dat" "Hap2" "no"

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"9187e9837a7a11ef9cf9b9ec166fac27"`
chromInfo	`"/tmp/tmpu2ie1xq6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
exp	`"Hap2"`
iterate	`"no"`

Step 7: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cat/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

cat '/tmp/tmpu2ie1xq6/files/a/e/0/dataset_ae0d1e37-8943-473d-8870-7025525fd054.dat' >> '/tmp/tmpu2ie1xq6/job_working_directory/000/62/outputs/dataset_ff30e83e-fd3e-4568-a201-a1f97bc33134.dat' && cat '/tmp/tmpu2ie1xq6/files/0/4/c/dataset_04c39c1d-500c-4a19-a224-1c465eac5945.dat' >> '/tmp/tmpu2ie1xq6/job_working_directory/000/62/outputs/dataset_ff30e83e-fd3e-4568-a201-a1f97bc33134.dat' && exit 0

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"9187e9837a7a11ef9cf9b9ec166fac27"`
chromInfo	`"/tmp/tmpu2ie1xq6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
queries	`[{"__index__": 0, "inputs2": {"values": [{"id": 143, "src": "hda"}]}}]`

Step 8: Cut1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl '/tmp/tmpu2ie1xq6/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpu2ie1xq6/files/f/f/3/dataset_ff30e83e-fd3e-4568-a201-a1f97bc33134.dat' 'c8,c5,c6' T '/tmp/tmpu2ie1xq6/job_working_directory/000/63/outputs/dataset_2f81f70a-dab7-4aba-9d4f-a6436c2201b0.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"9187e9837a7a11ef9cf9b9ec166fac27"`
chromInfo	`"/tmp/tmpu2ie1xq6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
columnList	`"c8,c5,c6"`
dbkey	`"?"`
delimiter	`"T"`

Step 9: Cut1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl '/tmp/tmpu2ie1xq6/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpu2ie1xq6/files/f/f/3/dataset_ff30e83e-fd3e-4568-a201-a1f97bc33134.dat' 'c8,c4,c7' T '/tmp/tmpu2ie1xq6/job_working_directory/000/64/outputs/dataset_64e3cc18-6bb6-4a53-b453-523cdf04e5e4.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"9187e9837a7a11ef9cf9b9ec166fac27"`
chromInfo	`"/tmp/tmpu2ie1xq6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
columnList	`"c8,c4,c7"`
dbkey	`"?"`
delimiter	`"T"`

Step 10: Nx Plot:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

cat '/tmp/tmpu2ie1xq6/job_working_directory/000/65/configs/tmpzee0dbo_' && Rscript '/tmp/tmpu2ie1xq6/job_working_directory/000/65/configs/tmpzee0dbo_'

Exit Code:

```
0
```

Standard Error:

Warning message:
In Sys.setlocale("LC_MESSAGES", "en_US.UTF-8") :
  OS reports request to set locale to "en_US.UTF-8" cannot be honored
Warning message:
package ‘ggplot2’ was built under R version 4.1.3 
Warning message:
Using `size` aesthetic for lines was deprecated in ggplot2 3.4.0.
ℹ Please use `linewidth` instead.

Standard Output:

        options(show.error.messages=F, error=function(){cat(geterrmessage(), file=stderr()); q("no",1,F)})

        loc <- Sys.setlocale("LC_MESSAGES", "en_US.UTF-8")
    

library(ggplot2)


        #Choose between automatically scaled x and y axis or user defined
            gg_scalex = NULL
            gg_scaley = NULL
    


            gg_theme = theme_bw()
    


            gg_legend = theme(legend.position="right")
    

input <- read.csv('/tmp/tmpu2ie1xq6/files/2/f/8/dataset_2f81f70a-dab7-4aba-9d4f-a6436c2201b0.dat', sep='\t', header=TRUE)

names(input)[2] <- "xcol"
names(input)[3] <- "ycol"

    gg_facet = NULL
    gg_factor = aes(colour=factor(factor))

        gg_line = geom_line(size=1, alpha=1, gg_factor)

        color_scale = scale_color_brewer(palette='Set1', direction='1')

    names(input)[1] <- "factor"


    

    gg_axistitle = theme(axis.title = element_text(color = NULL, size = NULL, face = NULL))

    gg_axistext = theme(axis.text = element_text(color = NULL, size = NULL, face = NULL))

    gg_plottitle = theme(plot.title = element_text(color = NULL, size = NULL, face = NULL))

    gg_gridline = NULL

    gg_point = NULL

#this is the actual ggplot command to make the final plot(s)
plot_out <- ggplot(input, aes(xcol, ycol)) + gg_point + gg_line + gg_facet +
    gg_theme + gg_scalex + gg_scaley + color_scale + gg_legend + ggtitle('') + xlab('x') + ylab('Nx (Mb)')+
    gg_axistitle + gg_axistext + gg_plottitle + gg_gridline


        gg_width <- as.double('6.0')
        gg_height <- as.double('4.0')
        gg_unit <- 'in'
        gg_dpi <- as.double('300.0')
        gg_add_device <- 'none'
        output1 <- '/tmp/tmpu2ie1xq6/job_working_directory/000/65/outputs/dataset_f84e8937-440f-4d34-8518-0ff114262c8e.dat'
        output2 <- 'XXXX'

        ggsave(filename = output1, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = "png")
        if(gg_add_device != "none"){
          ggsave(filename = output2, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = gg_add_device)
        }

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"9187e9837a7a11ef9cf9b9ec166fac27"`
adv	{"axis_text_customization": {"__current_case__": 0, "axis_customization": "default"}, "axis_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "factor": {"__current_case__": 1, "colororder": "1", "colors": "Set1", "factorcol": "1", "factoring": "Single"}, "gridlinecust": "default", "legend": "yes", "plot_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "scaling": {"__current_case__": 0, "plot_scaling": "Automatic"}, "theme": "bw", "transform": "none", "type_conditional": {"__current_case__": 2, "type_options": "lines"}}
chromInfo	`"/tmp/tmpu2ie1xq6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
out	`{"additional_output_format": "none", "dpi_output_dim": "300.0", "height_output_dim": "4.0", "unit_output_dim": "in", "width_output_dim": "6.0"}`
title	`""`
xlab	`"x"`
xplot	`"2"`
ylab	`"Nx (Mb)"`
yplot	`"3"`

Step 52: join1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/tmpu2ie1xq6/galaxy-dev/tools/filters/join.py' '/tmp/tmpu2ie1xq6/files/f/7/4/dataset_f74c6582-6f49-4e53-88df-5e1c1965418e.dat' '/tmp/tmpu2ie1xq6/files/a/7/e/dataset_a7e13211-6512-4c0e-9263-9f1ebdc3a47e.dat' 1 1 '/tmp/tmpu2ie1xq6/job_working_directory/000/47/outputs/dataset_322f79f3-2b9e-41db-ad21-91c216ae75a4.dat' -u -p --index_depth=3 --buffer=50000000 --fill_options_file=/tmp/tmpu2ie1xq6/job_working_directory/000/47/configs/tmp_73jr_gh

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"9187e9807a7a11ef9cf9b9ec166fac27"`
chromInfo	`"/tmp/tmpu2ie1xq6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
field1	`"1"`
field2	`"1"`
fill_empty_columns	`{"__current_case__": 1, "do_fill_empty_columns": {"__current_case__": 0, "column_fill_type": "single_fill_value", "fill_value": "."}, "fill_columns_by": "fill_unjoined_only", "fill_empty_columns_switch": "fill_empty"}`
header	`""`
partial	`"-p"`
unmatched	`"-u"`

Step 53: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cut_tool/9.3+galaxy2:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

cut --complement -f '3' '/tmp/tmpu2ie1xq6/files/3/2/2/dataset_322f79f3-2b9e-41db-ad21-91c216ae75a4.dat' > '/tmp/tmpu2ie1xq6/job_working_directory/000/48/outputs/dataset_a9a3d038-0cc0-4434-86fc-44d04f7279c5.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"9187e9807a7a11ef9cf9b9ec166fac27"`
chromInfo	`"/tmp/tmpu2ie1xq6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
complement	`"--complement"`
cut_type_options	`{"__current_case__": 0, "colnames_option": {"__current_case__": 1, "header": "N", "list": ["3"]}, "cut_element": "-f", "delimiter": ""}`
dbkey	`"?"`

Step 54: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_find_and_replace/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/86755160afbf/text_processing/find_and_replace' -o '/tmp/tmpu2ie1xq6/job_working_directory/000/49/outputs/dataset_e9f76367-405b-40a2-95bd-98b956dbe7f3.dat' -g     '#' 'Number of' '/tmp/tmpu2ie1xq6/files/a/9/a/dataset_a9a3d038-0cc0-4434-86fc-44d04f7279c5.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"9187e9807a7a11ef9cf9b9ec166fac27"`
chromInfo	`"/tmp/tmpu2ie1xq6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
find_and_replace	`[{"__index__": 0, "caseinsensitive": false, "find_pattern": "#", "global": true, "is_regex": false, "replace_pattern": "Number of", "searchwhere": {"__current_case__": 0, "searchwhere_select": "line"}, "skip_first_line": false, "wholewords": false}]`

Step 7: Bits for bloom filter:
- step_state: scheduled
Step 8: Database for Busco Lineage:
- step_state: scheduled
Step 9: Lineage:
- step_state: scheduled
Step 10: Homozygous Read Coverage:
- step_state: scheduled

Other invocation details
- history_id
  - 3140eb6941fc7bbf
- history_state
  - ok
- invocation_id
  - 3140eb6941fc7bbf
- invocation_state
  - scheduled
- workflow_id
  - 96b1a3aa73899802

gxydevbot · 2024-10-14T04:20:17Z

There are new updates, they have been integrated to the PR, check the file diff.

github-actions · 2024-10-14T04:55:44Z

Test Results (powered by Planemo)

Test Summary

Test State	Count
Total	1
Passed	0
Error	0
Failure	1
Skipped	0

Failed Tests

❌ Assembly-Hifi-Trio-phasing-VGP5.ga_0

Problems:

Output with path /tmp/tmp6b1tqnft/Busco on data 40 short summary__8205d377-abc8-456f-a03f-60ef759c68b7 different than expected
Expected text 'C:1.2%[S:1.2%,D:0.0%],F:0.4%,M:98.4%,n:3354' in output ('# BUSCO version is: 5.7.1 
# The lineage dataset is: vertebrata_odb10 (Creation date: 2021-02-19, number of genomes: 67, number of BUSCOs: 3354)
# Summarized benchmarking in BUSCO notation for file /tmp/tmp18ydi7f3/files/b/f/3/dataset_bf30f9a3-0319-4936-86d9-d639aa26979a.dat
# BUSCO was run in mode: euk_genome_min
# Gene predictor used: miniprot

	***** Results: *****

	C:1.2%[S:1.2%,D:0.0%],F:0.1%,M:98.7%,n:3354,E:5.0%	   
	40	Complete BUSCOs (C)	(of which 2 contain internal stop codons)		   
	39	Complete and single-copy BUSCOs (S)	   
	1	Complete and duplicated BUSCOs (D)	   
	4	Fragmented BUSCOs (F)			   
	3310	Missing BUSCOs (M)			   
	3354	Total BUSCO groups searched		   

Assembly Statistics:
	85	Number of scaffolds
	85	Number of contigs
	2065905	Total length
	0.000%	Percent gaps
	22 KB	Scaffold N50
	22 KB	Contigs N50


Dependencies and versions:
	hmmsearch: 3.1
	bbtools: None
	miniprot_index: 0.13-r248
	miniprot_align: 0.13-r248
	python: sys.version_info(major=3, minor=9, micro=19, releaselevel='final', serial=0)
	busco: 5.7.1
')

Workflow invocation details

Invocation Messages

Steps

Step 1: Pacbio Reads Collection : child:
- step_state: scheduled
Step 2: Paternal Illumina reads (hap1):
- step_state: scheduled
Step 11: Genomescope Model Parameters:
- step_state: scheduled
Step 12: Genomescope Summary:
- step_state: scheduled
Step 13: Utilize homology information to correct trio-phasing errors:
- step_state: scheduled
Step 14: SAK input file (Optional):
- step_state: scheduled
Step 15: Name for Haplotype 1:
- step_state: scheduled
Step 16: Name for Haplotype 2:
- step_state: scheduled

Step 17: toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.9+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -f -s '/tmp/tmp18ydi7f3/files/0/7/4/dataset_0748183d-d989-4950-9332-fd5e4f06376e.dat' 'yeast_reads_sub1_fastq_gz.fq.gz' &&  cutadapt  -j=${GALAXY_SLOTS:-4}   -b 'ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT'   -b 'ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT'    --error-rate=0.1 --times=1 --overlap=35    --action=trim --rc     --discard-trimmed   --minimum-length=1      --json=stats.json -o 'out1.fq.gz'  'yeast_reads_sub1_fastq_gz.fq.gz'  > report.txt

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"dc4754aa89e411efb6217c1e5266f0ee"`
adapter_options	`{"action": "trim", "error_rate": "0.1", "match_read_wildcards": false, "no_indels": false, "no_match_adapter_wildcards": true, "overlap": "35", "revcomp": true, "times": "1"}`
chromInfo	`"/tmp/tmp18ydi7f3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter_options	`{"discard_casava": false, "discard_trimmed": true, "discard_untrimmed": false, "max_average_error_rate": null, "max_expected_errors": null, "max_n": null, "maximum_length": null, "maximum_length2": null, "minimum_length": "1", "minimum_length2": null, "pair_filter": "any"}`
library	{"__current_case__": 0, "input_1": {"values": [{"id": 1, "src": "dce"}]}, "r1": {"adapters": [], "anywhere_adapters": [{"__index__": 0, "adapter_source": {"__current_case__": 0, "adapter": "ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT", "adapter_name": "", "adapter_source_list": "user"}, "single_noindels": false}, {"__index__": 1, "adapter_source": {"__current_case__": 0, "adapter": "ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT", "adapter_name": "", "adapter_source_list": "user"}, "single_noindels": false}], "front_adapters": []}, "type": "single"}
other_trimming_options	`{"cut": "0", "cut2": "0", "nextseq_trim": "0", "poly_a": false, "quality_cutoff": "0", "quality_cutoff2": "", "shorten_options": {"__current_case__": 1, "shorten_values": "False"}, "shorten_options_r2": {"__current_case__": 1, "shorten_values_r2": "False"}, "trim_n": false}`
output_selector	`["json_stats", "report"]`
read_mod_options	`{"length_tag": "", "rename": "", "strip_suffix": "", "zero_cap": false}`

Step 18: toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types float,float,float,float,float,int  --file '/tmp/tmp18ydi7f3/job_working_directory/000/12/configs/tmp4z2canqb' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmp18ydi7f3/files/6/a/a/dataset_6aa2d939-68a2-4a14-9a57-c4d862edb62e.dat' '/tmp/tmp18ydi7f3/job_working_directory/000/12/outputs/dataset_88af9c4e-4eb9-4cfb-bda7-1a520657c4a5.dat'

Exit Code:

```
0
```

Standard Output:

c3*2
Computing 1 new columns with instructions ['c3*2;;']
Computed new column values for 100.00% of 1 lines written.

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"dc4754aa89e411efb6217c1e5266f0ee"`
avoid_scientific_notation	`false`
chromInfo	`"/tmp/tmp18ydi7f3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
error_handling	`{"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}}`
ops	`{"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3*2"}], "header_lines_select": "no"}`

Step 19: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

grep -G -A 0 -B 0 --no-group-separator  -i -- 'Haploid' '/tmp/tmp18ydi7f3/files/4/5/4/dataset_45426056-f0fc-4163-9728-0e268310f9c0.dat' > '/tmp/tmp18ydi7f3/job_working_directory/000/13/outputs/dataset_ffa714d0-bad0-408b-9be2-c9944014b251.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"dc4754aa89e411efb6217c1e5266f0ee"`
case_sensitive	`"-i"`
chromInfo	`"/tmp/tmp18ydi7f3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
color	`"NOCOLOR"`
dbkey	`"?"`
invert	`""`
lines_after	`"0"`
lines_before	`"0"`
regex_type	`"-G"`
url_paste	`"Haploid"`

Step 20: toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

die() { echo "$@" 1>&2 ; exit 1; } &&  mkdir multiqc_WDir &&   mkdir multiqc_WDir/cutadapt_0 &&     ln -s '/tmp/tmp18ydi7f3/files/d/0/d/dataset_d0dd58df-cf3a-4552-bc86-89c18b5cd458.dat' 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' && sed -i.old 's/You are running/This is/' 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' && grep -q "This is cutadapt" 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' || die "'This is cutadapt' or 'You are running cutadapt' not found in the file" &&   multiqc multiqc_WDir --filename 'report'       && mkdir -p ./plots && ls -l ./report_data/ && cp ./report_data/*plot*.txt ./plots/ | true

Exit Code:

```
0
```

Standard Error:

/// MultiQC 🔍 v1.24.1

     version_check | MultiQC Version v1.25.1 now available!
       file_search | Search path: /tmp/tmp18ydi7f3/job_working_directory/000/14/working/multiqc_WDir

          cutadapt | Found 1 reports

     write_results | Data        : report_data
     write_results | Report      : report.html
           multiqc | MultiQC complete

Standard Output:

total 72
-rw-r--r-- 1 1001 118    93 Oct 14 04:30 cutadapt_filtered_reads_plot.txt
-rw-r--r-- 1 1001 118    66 Oct 14 04:30 cutadapt_trimmed_sequences_plot_default_Counts.txt
-rw-r--r-- 1 1001 118    70 Oct 14 04:30 cutadapt_trimmed_sequences_plot_default_Obs_Exp.txt
-rw-r--r-- 1 1001 118   124 Oct 14 04:30 multiqc_citations.txt
-rw-r--r-- 1 1001 118   222 Oct 14 04:30 multiqc_cutadapt.txt
-rw-r--r-- 1 1001 118 39114 Oct 14 04:30 multiqc_data.json
-rw-r--r-- 1 1001 118   105 Oct 14 04:30 multiqc_general_stats.txt
-rw-r--r-- 1 1001 118    29 Oct 14 04:30 multiqc_software_versions.txt
-rw-r--r-- 1 1001 118   194 Oct 14 04:30 multiqc_sources.txt

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"dc4754aa89e411efb6217c1e5266f0ee"`
chromInfo	`"/tmp/tmp18ydi7f3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
comment	`""`
dbkey	`"?"`
export	`false`
flat	`false`
results	`[{"__index__": 0, "software_cond": {"__current_case__": 5, "input": {"values": [{"id": 5, "src": "hdca"}]}, "software": "cutadapt"}}]`
saveLog	`"false"`
title	`""`

Step 3: Maternal Illumina reads (hap2):
- step_state: scheduled

Step 21: Cut1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl '/tmp/tmp18ydi7f3/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmp18ydi7f3/files/8/8/a/dataset_88af9c4e-4eb9-4cfb-bda7-1a520657c4a5.dat' 'c7' T '/tmp/tmp18ydi7f3/job_working_directory/000/15/outputs/dataset_1250fcf3-7843-4b77-b298-95ff857e81ba.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"dc4754aa89e411efb6217c1e5266f0ee"`
chromInfo	`"/tmp/tmp18ydi7f3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
columnList	`"c7"`
dbkey	`"?"`
delimiter	`"T"`

Step 22: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

sed -r --sandbox -e 's/bp//g' -e 's/,//g' -e 's/([a-z])\s+([A-Z])/\1_\2/g' '/tmp/tmp18ydi7f3/files/f/f/a/dataset_ffa714d0-bad0-408b-9be2-c9944014b251.dat' > '/tmp/tmp18ydi7f3/job_working_directory/000/16/outputs/dataset_7ad735c1-7c60-40cf-86e8-379f6305b182.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"dc4754aa89e411efb6217c1e5266f0ee"`
chromInfo	`"/tmp/tmp18ydi7f3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
replacements	`[{"__index__": 0, "find_pattern": "bp", "replace_pattern": ""}, {"__index__": 1, "find_pattern": ",", "replace_pattern": ""}, {"__index__": 2, "find_pattern": "([a-z])\\s+([A-Z])", "replace_pattern": "\\1_\\2"}]`

Step 23: param_value_from_file:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"dc4754aa89e411efb6217c1e5266f0ee"`
chromInfo	`"/tmp/tmp18ydi7f3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
param_type	`"integer"`
remove_newlines	`true`

Step 24: Convert characters1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python /tmp/tmp18ydi7f3/galaxy-dev/tools/filters/convert_characters.py --strip --condense /tmp/tmp18ydi7f3/files/7/a/d/dataset_7ad735c1-7c60-40cf-86e8-379f6305b182.dat s /tmp/tmp18ydi7f3/job_working_directory/000/18/outputs/dataset_eb9f2d0f-8f18-41ab-9ade-f246e199daef.dat

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"txt"`
__workflow_invocation_uuid__	`"dc4754aa89e411efb6217c1e5266f0ee"`
chromInfo	`"/tmp/tmp18ydi7f3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
condense	`true`
convert_from	`"s"`
dbkey	`"?"`
strip	`true`

Step 25: Homozygous read coverage for Hifiasm:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"dc4754aa89e411efb6217c1e5266f0ee"`
chromInfo	`"/tmp/tmp18ydi7f3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
style_cond	`{"__current_case__": 0, "pick_style": "first", "type_cond": {"__current_case__": 1, "param_type": "integer", "pick_from": [{"__index__": 0, "value": null}, {"__index__": 1, "value": "21"}]}}`

Step 26: Cut1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl '/tmp/tmp18ydi7f3/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmp18ydi7f3/files/e/b/9/dataset_eb9f2d0f-8f18-41ab-9ade-f246e199daef.dat' 'c3' T '/tmp/tmp18ydi7f3/job_working_directory/000/19/outputs/dataset_fbcf9ef0-2622-4801-9d5a-4c32ce0aec2e.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"dc4754aa89e411efb6217c1e5266f0ee"`
chromInfo	`"/tmp/tmp18ydi7f3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
columnList	`"c3"`
dbkey	`"?"`
delimiter	`"T"`

Step 27: toolshed.g2.bx.psu.edu/repos/bgruening/hifiasm/hifiasm/0.19.9+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -s '/tmp/tmp18ydi7f3/files/6/e/0/dataset_6e0b2ff9-8397-4ae8-8597-319895b34dba.dat' input_0.fastq.gz &&  ln -s '/tmp/tmp18ydi7f3/files/1/0/7/dataset_1079ee3f-13be-4c63-8eee-4e643b7834e6.dat' hap1_input_0.fastqsanger &&  ln -s '/tmp/tmp18ydi7f3/files/1/b/0/dataset_1b02a98d-9b87-4057-997c-33d2e96e480a.dat' hap1_input_1.fastqsanger &&  ln -s '/tmp/tmp18ydi7f3/files/6/c/3/dataset_6c32c2ac-482a-4992-b5f0-555d59026158.dat' hap2_input_0.fastqsanger &&  ln -s '/tmp/tmp18ydi7f3/files/2/4/4/dataset_24439ad3-07d6-4bd8-bfa3-5760ff1c61e7.dat' hap2_input_1.fastqsanger &&  yak count -k31 -b32 -t${GALAXY_SLOTS:-1} -o hap1.yak hap1_input_0.fastqsanger hap1_input_1.fastqsanger && yak count -k31 -b32 -t${GALAXY_SLOTS:-1} -o hap2.yak hap2_input_0.fastqsanger hap2_input_1.fastqsanger && hifiasm -t ${GALAXY_SLOTS:-1} -o output -f 32 -a 4 -z 0 -m 10000000 -p 100000 -n 3 -x 0.8 -y 0.2   --hom-cov 21 -1 hap1.yak -2 hap2.yak -c 2 -d 5 --trio-dual    --primary input_0.fastq.gz 2> output.log  && mkdir noseq_files && mv *.noseq.gfa noseq_files

Exit Code:

```
0
```

Standard Error:

[M::worker_pipeline::0.302*1.00] processed 10 sequences; 0 distinct k-mers in the hash table
[M::worker_pipeline::0.346*1.00] processed 10 sequences; 0 distinct k-mers in the hash table
[M::main_count] 0 distinct k-mers after shrinking
[M::yak_ch_dump] dumpped the hash table to file 'hap1.yak'.
[M::main] Version: 0.1-r56
[M::main] CMD: yak count -k31 -b32 -t1 -o hap1.yak hap1_input_0.fastqsanger hap1_input_1.fastqsanger
[M::main] Real time: 0.346 sec; CPU: 0.347 sec; Peak RSS: 0.506 GB
[M::worker_pipeline::0.252*1.01] processed 10 sequences; 0 distinct k-mers in the hash table
[M::worker_pipeline::0.294*1.00] processed 10 sequences; 0 distinct k-mers in the hash table
[M::main_count] 0 distinct k-mers after shrinking
[M::yak_ch_dump] dumpped the hash table to file 'hap2.yak'.
[M::main] Version: 0.1-r56
[M::main] CMD: yak count -k31 -b32 -t1 -o hap2.yak hap2_input_0.fastqsanger hap2_input_1.fastqsanger
[M::main] Real time: 0.294 sec; CPU: 0.296 sec; Peak RSS: 0.506 GB

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"fastq.gz"`
__workflow_invocation_uuid__	`"dc4754aa89e411efb6217c1e5266f0ee"`
advanced_options	`{"__current_case__": 0, "advanced_selector": "blank"}`
assembly_options	`{"__current_case__": 1, "adapter_length": "0", "assembly_selector": "set", "cleaning_rounds": "4", "disable_post_join": false, "hom_cov": "21", "ignore_error_corrected": false, "max_overlap": "0.8", "min_overlap": "0.2", "pop_contigs": "10000000", "pop_unitigs": "100000", "remove_tips": "3"}`
bins_out	`false`
chromInfo	`"/tmp/tmp18ydi7f3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter_bits	`"32"`
hic_partition	`{"__current_case__": 0, "hic_partition_selector": "blank"}`
log_out	`true`
mode	`{"__current_case__": 1, "max_kmers": "2", "min_kmers": "5", "mode_selector": "trio", "reads": {"values": [{"id": 4, "src": "hdca"}]}, "trio_dual": true, "trioinput": {"__current_case__": 0, "hap1_reads": {"values": [{"id": 2, "src": "hdca"}]}, "hap2_reads": {"values": [{"id": 3, "src": "hdca"}]}, "trio_input_selector": "reads"}, "yak_kmer_length": "31"}`
ont_integration	`{"__current_case__": 0, "ont_integration_selector": "blank"}`
purge_options	`{"__current_case__": 0, "purge_selector": "blank"}`
scaffolding_options	`{"__current_case__": 0, "scaffold_selector": "blank"}`

Step 28: Estimated genome size:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"dc4754aa89e411efb6217c1e5266f0ee"`
chromInfo	`"/tmp/tmp18ydi7f3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
param_type	`"integer"`
remove_newlines	`true`

Step 29: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmp18ydi7f3/files/a/7/c/dataset_a7cc541b-e71f-4026-8e5e-82751351bbca.dat' --discover-paths  -o dataset.gfa --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset

Exit Code:

```
0
```

Standard Output:

+++Assembly summary+++: 
# scaffolds: 85
Total scaffold length: 2065905
Average scaffold length: 24304.76
Scaffold N50: 22121
Scaffold auN: 34217.52
Scaffold L50: 30
Largest scaffold: 132637
Smallest scaffold: 11410
# contigs: 85
Total contig length: 2065905
Average contig length: 24304.76
Contig N50: 22121
Contig auN: 34217.52
Contig L50: 30
Largest contig: 132637
Smallest contig: 11410
# gaps in scaffolds: 0
Total gap length in scaffolds: 0
Average gap length in scaffolds: 0.00
Gap N50 in scaffolds: 0
Gap auN in scaffolds: 0.00
Gap L50 in scaffolds: 0
Largest gap in scaffolds: 0
Smallest gap in scaffolds: 0
Base composition (A:C:G:T): 630683:399587:403407:632228
GC content %: 38.87
# soft-masked bases: 0
# segments: 85
Total segment length: 2065905
Average segment length: 24304.76
# gaps: 0
# paths: 85
# edges: 4
Average degree: 0.05
# connected components: 1
Largest connected component length: 96577
# dead ends: 167
# disconnected components: 82
Total length disconnected components: 1969328
# separated components: 83
# bubbles: 0
# circular segments: 0
# circular paths: 0

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"dc4754aa89e411efb6217c1e5266f0ee"`
chromInfo	`"/tmp/tmp18ydi7f3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 4, "out_format": "gfa", "terminal_overlaps_condition": {"__current_case__": 0, "terminal_overlaps_select": "no"}}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 30: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmp18ydi7f3/files/e/0/e/dataset_e0e20184-4d5b-4818-93e2-5c9ffdf954a8.dat' --discover-paths  -o dataset.gfa --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset

Exit Code:

```
0
```

Standard Output:

+++Assembly summary+++: 
# scaffolds: 23
Total scaffold length: 730998
Average scaffold length: 31782.52
Scaffold N50: 25430
Scaffold auN: 54929.70
Scaffold L50: 6
Largest scaffold: 132637
Smallest scaffold: 16240
# contigs: 23
Total contig length: 730998
Average contig length: 31782.52
Contig N50: 25430
Contig auN: 54929.70
Contig L50: 6
Largest contig: 132637
Smallest contig: 16240
# gaps in scaffolds: 0
Total gap length in scaffolds: 0
Average gap length in scaffolds: 0.00
Gap N50 in scaffolds: 0
Gap auN in scaffolds: 0.00
Gap L50 in scaffolds: 0
Largest gap in scaffolds: 0
Smallest gap in scaffolds: 0
Base composition (A:C:G:T): 219106:144177:146357:221358
GC content %: 39.74
# soft-masked bases: 0
# segments: 23
Total segment length: 730998
Average segment length: 31782.52
# gaps: 0
# paths: 23

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"dc4754aa89e411efb6217c1e5266f0ee"`
chromInfo	`"/tmp/tmp18ydi7f3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 4, "out_format": "gfa", "terminal_overlaps_condition": {"__current_case__": 0, "terminal_overlaps_select": "no"}}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 4: Meryl Database : Child:
- step_state: scheduled

Step 31: Raw Unitig Image:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -s '/tmp/tmp18ydi7f3/files/3/b/c/dataset_3bc721e2-7b6a-4fcc-940b-afb711b2fef3.dat' input.gfa &&  export QT_QPA_PLATFORM='offscreen' && Bandage image input.gfa 'out.png' --height '2000' --nodewidth '25.0'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"dc4754aa89e411efb6217c1e5266f0ee"`
chromInfo	`"/tmp/tmp18ydi7f3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
fontsize	`None`
height	`"2000"`
lengths	`false`
names	`false`
nodewidth	`"25.0"`
output_format	`"png"`
width	`None`

Step 32: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmp18ydi7f3/files/a/7/c/dataset_a7cc541b-e71f-4026-8e5e-82751351bbca.dat' --discover-paths  -o dataset.fasta --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset

Exit Code:

```
0
```

Standard Output:

+++Assembly summary+++: 
# scaffolds: 85
Total scaffold length: 2065905
Average scaffold length: 24304.76
Scaffold N50: 22121
Scaffold auN: 34217.52
Scaffold L50: 30
Largest scaffold: 132637
Smallest scaffold: 11410
# contigs: 85
Total contig length: 2065905
Average contig length: 24304.76
Contig N50: 22121
Contig auN: 34217.52
Contig L50: 30
Largest contig: 132637
Smallest contig: 11410
# gaps in scaffolds: 0
Total gap length in scaffolds: 0
Average gap length in scaffolds: 0.00
Gap N50 in scaffolds: 0
Gap auN in scaffolds: 0.00
Gap L50 in scaffolds: 0
Largest gap in scaffolds: 0
Smallest gap in scaffolds: 0
Base composition (A:C:G:T): 630683:399587:403407:632228
GC content %: 38.87
# soft-masked bases: 0
# segments: 85
Total segment length: 2065905
Average segment length: 24304.76
# gaps: 0
# paths: 85
# edges: 4
Average degree: 0.05
# connected components: 1
Largest connected component length: 96577
# dead ends: 167
# disconnected components: 82
Total length disconnected components: 1969328
# separated components: 83
# bubbles: 0
# circular segments: 0
# circular paths: 0

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"dc4754aa89e411efb6217c1e5266f0ee"`
chromInfo	`"/tmp/tmp18ydi7f3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 0, "line_length": null, "out_format": "fasta"}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 33: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmp18ydi7f3/files/e/0/e/dataset_e0e20184-4d5b-4818-93e2-5c9ffdf954a8.dat' --discover-paths  -o dataset.fasta --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset

Exit Code:

```
0
```

Standard Output:

+++Assembly summary+++: 
# scaffolds: 23
Total scaffold length: 730998
Average scaffold length: 31782.52
Scaffold N50: 25430
Scaffold auN: 54929.70
Scaffold L50: 6
Largest scaffold: 132637
Smallest scaffold: 16240
# contigs: 23
Total contig length: 730998
Average contig length: 31782.52
Contig N50: 25430
Contig auN: 54929.70
Contig L50: 6
Largest contig: 132637
Smallest contig: 16240
# gaps in scaffolds: 0
Total gap length in scaffolds: 0
Average gap length in scaffolds: 0.00
Gap N50 in scaffolds: 0
Gap auN in scaffolds: 0.00
Gap L50 in scaffolds: 0
Largest gap in scaffolds: 0
Smallest gap in scaffolds: 0
Base composition (A:C:G:T): 219106:144177:146357:221358
GC content %: 39.74
# soft-masked bases: 0
# segments: 23
Total segment length: 730998
Average segment length: 31782.52
# gaps: 0
# paths: 23

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"dc4754aa89e411efb6217c1e5266f0ee"`
chromInfo	`"/tmp/tmp18ydi7f3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 0, "line_length": null, "out_format": "fasta"}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 34: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmp18ydi7f3/files/a/7/c/dataset_a7cc541b-e71f-4026-8e5e-82751351bbca.dat' --out-size c  --discover-paths --tabular > '/tmp/tmp18ydi7f3/job_working_directory/000/28/outputs/dataset_cee42c26-69a4-4965-b3fe-72eaada337a0.dat' --threads ${GALAXY_SLOTS:-8}

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"dc4754aa89e411efb6217c1e5266f0ee"`
chromInfo	`"/tmp/tmp18ydi7f3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 1, "discover_paths": true, "locale": false, "selector": "statistics", "statistics_condition": {"__current_case__": 0, "out_size": "c", "selector": "size"}, "tabular": true}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 35: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmp18ydi7f3/files/e/0/e/dataset_e0e20184-4d5b-4818-93e2-5c9ffdf954a8.dat' --out-size c  --discover-paths --tabular > '/tmp/tmp18ydi7f3/job_working_directory/000/29/outputs/dataset_f58523c6-ee5a-4e91-a304-0c2ec5518a62.dat' --threads ${GALAXY_SLOTS:-8}

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"dc4754aa89e411efb6217c1e5266f0ee"`
chromInfo	`"/tmp/tmp18ydi7f3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 1, "discover_paths": true, "locale": false, "selector": "statistics", "statistics_condition": {"__current_case__": 0, "out_size": "c", "selector": "size"}, "tabular": true}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 36: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmp18ydi7f3/files/e/0/e/dataset_e0e20184-4d5b-4818-93e2-5c9ffdf954a8.dat' 2288021 --nstar-report --locale en_US.UTF-8 --discover-paths --tabular > '/tmp/tmp18ydi7f3/job_working_directory/000/30/outputs/dataset_abd191a0-ad3d-43d8-bd7d-e33d5ad95c97.dat' --threads ${GALAXY_SLOTS:-8}

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"dc4754aa89e411efb6217c1e5266f0ee"`
chromInfo	`"/tmp/tmp18ydi7f3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 1, "discover_paths": true, "locale": true, "selector": "statistics", "statistics_condition": {"__current_case__": 2, "expected_genomesize": "2288021", "selector": "assembly"}, "tabular": true}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 37: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmp18ydi7f3/files/a/7/c/dataset_a7cc541b-e71f-4026-8e5e-82751351bbca.dat' 2288021 --nstar-report --locale en_US.UTF-8 --discover-paths --tabular > '/tmp/tmp18ydi7f3/job_working_directory/000/31/outputs/dataset_e0be7a20-112f-42c6-a537-961964bfdfa8.dat' --threads ${GALAXY_SLOTS:-8}

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"dc4754aa89e411efb6217c1e5266f0ee"`
chromInfo	`"/tmp/tmp18ydi7f3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 1, "discover_paths": true, "locale": true, "selector": "statistics", "statistics_condition": {"__current_case__": 2, "expected_genomesize": "2288021", "selector": "assembly"}, "tabular": true}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 38: toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.7.1+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

busco --in '/tmp/tmp18ydi7f3/files/b/f/3/dataset_bf30f9a3-0319-4936-86d9-d639aa26979a.dat' --mode 'geno' --out busco_galaxy --cpu ${GALAXY_SLOTS:-4} --evalue 0.001 --limit 3 --contig_break 10  --offline --download_path /cvmfs/data.galaxyproject.org/byhand/busco/v5  --lineage_dataset 'vertebrata_odb10'  --miniprot  && mkdir BUSCO_summaries && ls -l busco_galaxy/run_*/ && cp busco_galaxy/short_summary.*.txt BUSCO_summaries/ && generate_plot.py -wd BUSCO_summaries -rt specific  && echo "##gff-version 3" > busco_output.gff && cat busco_galaxy/run_*/busco_sequences/*busco_sequences/*.gff >> busco_output.gff 2> /dev/null || true

Exit Code:

```
0
```

Standard Error:

2024-10-14 04:54:34 ERROR:	Something went wrong. Results not recorded.
2024-10-14 04:54:34 ERROR:	BUSCO analysis failed!
2024-10-14 04:54:34 ERROR:	Check the logs, read the user guide (https://busco.ezlab.org/busco_userguide.html), and check the BUSCO issue board on https://gitlab.com/ezlab/busco/issues

Standard Output:

2024-10-14 04:36:30 INFO:	***** Start a BUSCO v5.7.1 analysis, current time: 10/14/2024 04:36:30 *****
2024-10-14 04:36:30 INFO:	Configuring BUSCO with local environment
2024-10-14 04:36:30 INFO:	Running genome mode
2024-10-14 04:36:31 INFO:	Input file is /tmp/tmp18ydi7f3/files/b/f/3/dataset_bf30f9a3-0319-4936-86d9-d639aa26979a.dat
2024-10-14 04:36:31 WARNING:	Option evalue was provided but is not used in the selected run mode, euk_genome_min
2024-10-14 04:36:31 WARNING:	Option limit was provided but is not used in the selected run mode, euk_genome_min
2024-10-14 04:36:32 INFO:	Running BUSCO using lineage dataset vertebrata_odb10 (eukaryota, 2021-02-19)
2024-10-14 04:36:32 INFO:	Running 1 job(s) on bbtools, starting at 10/14/2024 04:36:32
2024-10-14 04:36:33 INFO:	[bbtools]	1 of 1 task(s) completed
2024-10-14 04:36:33 INFO:	Running 1 job(s) on miniprot_index, starting at 10/14/2024 04:36:33
2024-10-14 04:36:34 INFO:	[miniprot_index]	1 of 1 task(s) completed
2024-10-14 04:36:34 INFO:	Running 1 job(s) on miniprot_align, starting at 10/14/2024 04:36:34
2024-10-14 04:54:09 INFO:	[miniprot_align]	1 of 1 task(s) completed
2024-10-14 04:54:14 INFO:	***** Run HMMER on gene sequences *****
2024-10-14 04:54:15 INFO:	Running 621 job(s) on hmmsearch, starting at 10/14/2024 04:54:15
2024-10-14 04:54:19 INFO:	[hmmsearch]	63 of 621 task(s) completed
2024-10-14 04:54:21 INFO:	[hmmsearch]	125 of 621 task(s) completed
2024-10-14 04:54:22 INFO:	[hmmsearch]	187 of 621 task(s) completed
2024-10-14 04:54:24 INFO:	[hmmsearch]	249 of 621 task(s) completed
2024-10-14 04:54:26 INFO:	[hmmsearch]	311 of 621 task(s) completed
2024-10-14 04:54:27 INFO:	[hmmsearch]	373 of 621 task(s) completed
2024-10-14 04:54:29 INFO:	[hmmsearch]	435 of 621 task(s) completed
2024-10-14 04:54:30 INFO:	[hmmsearch]	497 of 621 task(s) completed
2024-10-14 04:54:31 INFO:	[hmmsearch]	559 of 621 task(s) completed
2024-10-14 04:54:33 INFO:	[hmmsearch]	621 of 621 task(s) completed
2024-10-14 04:54:33 INFO:	51 exons in total
2024-10-14 04:54:33 WARNING:	2 of 40 Complete matches (5.0%) contain internal stop codons in Miniprot gene predictions
2024-10-14 04:54:33 WARNING:	BUSCO gene predictions from Miniprot have low average identity (0.46000000834465027). You may want to repeat the analysis using the Metaeuk pipeline.

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"dc4754aa89e411efb6217c1e5266f0ee"`
adv	`{"contig_break": "10", "evalue": "0.001", "limit": "3"}`
busco_mode	`{"__current_case__": 0, "mode": "geno", "use_augustus": {"__current_case__": 1, "use_augustus_selector": "miniprot"}}`
chromInfo	`"/tmp/tmp18ydi7f3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
lineage	`{"__current_case__": 1, "lineage_dataset": "vertebrata_odb10", "lineage_mode": "select_lineage"}`
lineage_conditional	`{"__current_case__": 0, "cached_db": "v5", "selector": "cached"}`
outputs	`["short_summary", "missing", "image", "gff"]`

Step 39: toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.7.1+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

busco --in '/tmp/tmp18ydi7f3/files/7/f/c/dataset_7fc0883f-751d-4c55-83e2-00b80c7e000a.dat' --mode 'geno' --out busco_galaxy --cpu ${GALAXY_SLOTS:-4} --evalue 0.001 --limit 3 --contig_break 10  --offline --download_path /cvmfs/data.galaxyproject.org/byhand/busco/v5  --lineage_dataset 'vertebrata_odb10'  --miniprot  && mkdir BUSCO_summaries && ls -l busco_galaxy/run_*/ && cp busco_galaxy/short_summary.*.txt BUSCO_summaries/ && generate_plot.py -wd BUSCO_summaries -rt specific  && echo "##gff-version 3" > busco_output.gff && cat busco_galaxy/run_*/busco_sequences/*busco_sequences/*.gff >> busco_output.gff 2> /dev/null || true

Exit Code:

```
0
```

Standard Error:

2024-10-14 04:46:21 ERROR:	Something went wrong. Results not recorded.
2024-10-14 04:46:21 ERROR:	BUSCO analysis failed!
2024-10-14 04:46:21 ERROR:	Check the logs, read the user guide (https://busco.ezlab.org/busco_userguide.html), and check the BUSCO issue board on https://gitlab.com/ezlab/busco/issues

Standard Output:

2024-10-14 04:36:30 INFO:	***** Start a BUSCO v5.7.1 analysis, current time: 10/14/2024 04:36:30 *****
2024-10-14 04:36:30 INFO:	Configuring BUSCO with local environment
2024-10-14 04:36:30 INFO:	Running genome mode
2024-10-14 04:36:31 INFO:	Input file is /tmp/tmp18ydi7f3/files/7/f/c/dataset_7fc0883f-751d-4c55-83e2-00b80c7e000a.dat
2024-10-14 04:36:31 WARNING:	Option evalue was provided but is not used in the selected run mode, euk_genome_min
2024-10-14 04:36:31 WARNING:	Option limit was provided but is not used in the selected run mode, euk_genome_min
2024-10-14 04:36:32 INFO:	Running BUSCO using lineage dataset vertebrata_odb10 (eukaryota, 2021-02-19)
2024-10-14 04:36:32 INFO:	Running 1 job(s) on bbtools, starting at 10/14/2024 04:36:32
2024-10-14 04:36:33 INFO:	[bbtools]	1 of 1 task(s) completed
2024-10-14 04:36:33 INFO:	Running 1 job(s) on miniprot_index, starting at 10/14/2024 04:36:33
2024-10-14 04:36:34 INFO:	[miniprot_index]	1 of 1 task(s) completed
2024-10-14 04:36:34 INFO:	Running 1 job(s) on miniprot_align, starting at 10/14/2024 04:36:34
2024-10-14 04:45:44 INFO:	[miniprot_align]	1 of 1 task(s) completed
2024-10-14 04:45:46 INFO:	***** Run HMMER on gene sequences *****
2024-10-14 04:45:47 INFO:	Running 347 job(s) on hmmsearch, starting at 10/14/2024 04:45:47
2024-10-14 04:45:52 INFO:	[hmmsearch]	35 of 347 task(s) completed
2024-10-14 04:45:55 INFO:	[hmmsearch]	70 of 347 task(s) completed
2024-10-14 04:45:59 INFO:	[hmmsearch]	105 of 347 task(s) completed
2024-10-14 04:46:02 INFO:	[hmmsearch]	139 of 347 task(s) completed
2024-10-14 04:46:05 INFO:	[hmmsearch]	174 of 347 task(s) completed
2024-10-14 04:46:09 INFO:	[hmmsearch]	209 of 347 task(s) completed
2024-10-14 04:46:12 INFO:	[hmmsearch]	243 of 347 task(s) completed
2024-10-14 04:46:15 INFO:	[hmmsearch]	278 of 347 task(s) completed
2024-10-14 04:46:18 INFO:	[hmmsearch]	313 of 347 task(s) completed
2024-10-14 04:46:21 INFO:	[hmmsearch]	347 of 347 task(s) completed
2024-10-14 04:46:21 INFO:	12 exons in total
2024-10-14 04:46:21 WARNING:	1 of 9 Complete matches (11.1%) contain internal stop codons in Miniprot gene predictions

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"dc4754aa89e411efb6217c1e5266f0ee"`
adv	`{"contig_break": "10", "evalue": "0.001", "limit": "3"}`
busco_mode	`{"__current_case__": 0, "mode": "geno", "use_augustus": {"__current_case__": 1, "use_augustus_selector": "miniprot"}}`
chromInfo	`"/tmp/tmp18ydi7f3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
lineage	`{"__current_case__": 1, "lineage_dataset": "vertebrata_odb10", "lineage_mode": "select_lineage"}`
lineage_conditional	`{"__current_case__": 0, "cached_db": "v5", "selector": "cached"}`
outputs	`["short_summary", "missing", "image", "gff"]`

Step 40: toolshed.g2.bx.psu.edu/repos/iuc/merqury/merqury/1.3+galaxy4:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

mkdir -p output_files && mkdir -p read-db.meryl pat.meryl mat.meryl && tar -zxf /tmp/tmp18ydi7f3/files/a/8/5/dataset_a85f219d-7a93-49de-8b11-e92c1c5a98d8.dat -C read-db.meryl --strip-components=1 && tar -zxf /tmp/tmp18ydi7f3/files/8/8/9/dataset_8891b3b6-0cb8-4216-b6b1-77a732a48331.dat -C pat.meryl --strip-components=1 && tar -zxf /tmp/tmp18ydi7f3/files/f/b/8/dataset_fb8f0e43-86d3-4c06-b66d-68a9944c8cf4.dat -C mat.meryl --strip-components=1 && ln -s '/tmp/tmp18ydi7f3/files/b/f/3/dataset_bf30f9a3-0319-4936-86d9-d639aa26979a.dat' assembly_01.fasta && ln -s '/tmp/tmp18ydi7f3/files/7/f/c/dataset_7fc0883f-751d-4c55-83e2-00b80c7e000a.dat' assembly_02.fasta && merqury.sh read-db.meryl pat.meryl mat.meryl assembly_01.fasta assembly_02.fasta output_merqury &> /tmp/tmp18ydi7f3/job_working_directory/000/34/outputs/dataset_a5d481f6-5d1e-4dfb-9906-d8608dd5dfd3.dat && mv output_merqury* output_files && find . -maxdepth 1 -name 'assembly_only*' -type f -print0 | xargs -0r mv -t output_files  && sed -i '1s/^/assembly\tk-mer set\tsolid k-mers in assembly\tsolid k-mers in reads\tcompleteness %\n/' 'output_files/output_merqury.completeness.stats' && sed -i '1s/^/assembly\tunique k-mers\tcommon k-mers\tQV\terror rate\n/' 'output_files/output_merqury.qv'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"dc4754aa89e411efb6217c1e5266f0ee"`
chromInfo	`"/tmp/tmp18ydi7f3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
label	`"output_merqury"`
mode	`{"__current_case__": 1, "assembly_options": {"__current_case__": 1, "assembly_01": {"values": [{"id": 33, "src": "hda"}]}, "assembly_02": {"values": [{"id": 34, "src": "hda"}]}, "number_assemblies": "two"}, "meryldb_F1": {"values": [{"id": 1, "src": "hda"}]}, "meryldb_MAT": {"values": [{"id": 3, "src": "hda"}]}, "meryldb_PAT": {"values": [{"id": 2, "src": "hda"}]}, "options": "trio"}`
output_add_headers	`true`
output_selector	`["qv", "plots", "sizes", "stats", "bed", "wig", "log", "hist"]`

Step 5: Hapmer Database : Paternal:
- step_state: scheduled

Step 41: Data prep Hap1:

step_state: scheduled

Subworkflow Steps

Step 1: gfa_stats:
- step_state: scheduled

Step 2: sort1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/tmp18ydi7f3/galaxy-dev/tools/filters/sorter.py'  --input='/tmp/tmp18ydi7f3/files/c/e/e/dataset_cee42c26-69a4-4965-b3fe-72eaada337a0.dat' --output='/tmp/tmp18ydi7f3/job_working_directory/000/35/outputs/dataset_437c577c-84f8-4f41-adde-15927b70d712.dat'    --key=2,2nr   --header 0

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"dc4754ab89e411efb6217c1e5266f0ee"`
chromInfo	`"/tmp/tmp18ydi7f3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
column	`"2"`
column_set	`[]`
dbkey	`"?"`
header_lines	`"0"`
order	`"DESC"`
style	`"num"`

Step 3: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmp18ydi7f3/job_working_directory/000/36/configs/tmpkm270k8j' '/tmp/tmp18ydi7f3/files/4/3/7/dataset_437c577c-84f8-4f41-adde-15927b70d712.dat' > '/tmp/tmp18ydi7f3/job_working_directory/000/36/outputs/dataset_e90f573d-b50a-48d0-b486-3d6c77a01f74.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"dc4754ab89e411efb6217c1e5266f0ee"`
chromInfo	`"/tmp/tmp18ydi7f3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
code	`"{total += $2; $3 = total}1"`
dbkey	`"?"`

Step 4: toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.8+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

datamash         absmax 3 < /tmp/tmp18ydi7f3/files/e/9/0/dataset_e90f573d-b50a-48d0-b486-3d6c77a01f74.dat > '/tmp/tmp18ydi7f3/job_working_directory/000/37/outputs/dataset_a442d71c-61bc-4b69-a7b0-ab3b37f915da.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"dc4754ab89e411efb6217c1e5266f0ee"`
chromInfo	`"/tmp/tmp18ydi7f3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
grouping	`""`
header_in	`false`
header_out	`false`
ignore_case	`false`
narm	`false`
need_sort	`false`
operations	`[{"__index__": 0, "op_column": "3", "op_name": "absmax"}]`
print_full_line	`false`

Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmp18ydi7f3/files/e/9/0/dataset_e90f573d-b50a-48d0-b486-3d6c77a01f74.dat" "/tmp/tmp18ydi7f3/job_working_directory/000/38/outputs/dataset_b5ff8c74-4dd6-4043-ba6c-062475a80a20.dat" "1" "yes"

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"dc4754ab89e411efb6217c1e5266f0ee"`
chromInfo	`"/tmp/tmp18ydi7f3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
exp	`"1"`
iterate	`"yes"`

Step 6: param_value_from_file:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"dc4754ab89e411efb6217c1e5266f0ee"`
chromInfo	`"/tmp/tmp18ydi7f3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
param_type	`"integer"`
remove_newlines	`true`

Step 7: toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"dc4754ab89e411efb6217c1e5266f0ee"`
chromInfo	`"/tmp/tmp18ydi7f3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
components	`[{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "c3/", "select_param_type": "text"}}, {"__index__": 1, "param_type": {"__current_case__": 1, "component_value": "2065905", "select_param_type": "integer"}}]`
dbkey	`"?"`

Step 8: toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types str,int,int,int  --file '/tmp/tmp18ydi7f3/job_working_directory/000/59/configs/tmpijb9jm5b' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmp18ydi7f3/files/b/5/f/dataset_b5ff8c74-4dd6-4043-ba6c-062475a80a20.dat' '/tmp/tmp18ydi7f3/job_working_directory/000/59/outputs/dataset_5a88f441-ad9c-4953-b170-2cb7cc227836.dat'

Exit Code:

```
0
```

Standard Output:

c3/2065905
c2/1000000
c3/1000000
Computing 3 new columns with instructions ['c3/2065905;;', 'c2/1000000;;', 'c3/1000000;;']
Computed new column values for 100.00% of 85 lines written.

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"dc4754ab89e411efb6217c1e5266f0ee"`
avoid_scientific_notation	`false`
chromInfo	`"/tmp/tmp18ydi7f3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
error_handling	`{"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}}`
ops	`{"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/2065905"}, {"__index__": 1, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c2/1000000"}, {"__index__": 2, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1000000"}], "header_lines_select": "no"}`

Step 42: Data Prep Hap2:

step_state: scheduled

Subworkflow Steps

Step 1: gfa_stats:
- step_state: scheduled

Step 2: sort1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/tmp18ydi7f3/galaxy-dev/tools/filters/sorter.py'  --input='/tmp/tmp18ydi7f3/files/f/5/8/dataset_f58523c6-ee5a-4e91-a304-0c2ec5518a62.dat' --output='/tmp/tmp18ydi7f3/job_working_directory/000/40/outputs/dataset_f45f5171-51df-4673-9f5c-04a0c4692b85.dat'    --key=2,2nr   --header 0

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"dc4754ac89e411efb6217c1e5266f0ee"`
chromInfo	`"/tmp/tmp18ydi7f3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
column	`"2"`
column_set	`[]`
dbkey	`"?"`
header_lines	`"0"`
order	`"DESC"`
style	`"num"`

Step 3: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmp18ydi7f3/job_working_directory/000/41/configs/tmpj316nznd' '/tmp/tmp18ydi7f3/files/f/4/5/dataset_f45f5171-51df-4673-9f5c-04a0c4692b85.dat' > '/tmp/tmp18ydi7f3/job_working_directory/000/41/outputs/dataset_78a07fa8-8fa9-47bf-adfd-1d19ca178035.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"dc4754ac89e411efb6217c1e5266f0ee"`
chromInfo	`"/tmp/tmp18ydi7f3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
code	`"{total += $2; $3 = total}1"`
dbkey	`"?"`

Step 4: toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.8+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

datamash         absmax 3 < /tmp/tmp18ydi7f3/files/7/8/a/dataset_78a07fa8-8fa9-47bf-adfd-1d19ca178035.dat > '/tmp/tmp18ydi7f3/job_working_directory/000/42/outputs/dataset_b2f943f3-af32-4903-8cb2-c819eff66190.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"dc4754ac89e411efb6217c1e5266f0ee"`
chromInfo	`"/tmp/tmp18ydi7f3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
grouping	`""`
header_in	`false`
header_out	`false`
ignore_case	`false`
narm	`false`
need_sort	`false`
operations	`[{"__index__": 0, "op_column": "3", "op_name": "absmax"}]`
print_full_line	`false`

Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmp18ydi7f3/files/7/8/a/dataset_78a07fa8-8fa9-47bf-adfd-1d19ca178035.dat" "/tmp/tmp18ydi7f3/job_working_directory/000/43/outputs/dataset_ebb89ae8-fe88-4795-a1ad-80b9516cfefb.dat" "1" "yes"

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"dc4754ac89e411efb6217c1e5266f0ee"`
chromInfo	`"/tmp/tmp18ydi7f3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
exp	`"1"`
iterate	`"yes"`

Step 6: param_value_from_file:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"dc4754ac89e411efb6217c1e5266f0ee"`
chromInfo	`"/tmp/tmp18ydi7f3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
param_type	`"integer"`
remove_newlines	`true`

Step 7: toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"dc4754ac89e411efb6217c1e5266f0ee"`
chromInfo	`"/tmp/tmp18ydi7f3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
components	`[{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "c3/", "select_param_type": "text"}}, {"__index__": 1, "param_type": {"__current_case__": 1, "component_value": "730998", "select_param_type": "integer"}}]`
dbkey	`"?"`

Step 8: toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types str,int,int,int  --file '/tmp/tmp18ydi7f3/job_working_directory/000/58/configs/tmpy6lwl4ru' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmp18ydi7f3/files/e/b/b/dataset_ebb89ae8-fe88-4795-a1ad-80b9516cfefb.dat' '/tmp/tmp18ydi7f3/job_working_directory/000/58/outputs/dataset_724d8073-e040-48bc-8084-dac910c25f94.dat'

Exit Code:

```
0
```

Standard Output:

c3/730998
c2/1000000
c3/1000000
Computing 3 new columns with instructions ['c3/730998;;', 'c2/1000000;;', 'c3/1000000;;']
Computed new column values for 100.00% of 23 lines written.

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"dc4754ac89e411efb6217c1e5266f0ee"`
avoid_scientific_notation	`false`
chromInfo	`"/tmp/tmp18ydi7f3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
error_handling	`{"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}}`
ops	`{"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/730998"}, {"__index__": 1, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c2/1000000"}, {"__index__": 2, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1000000"}], "header_lines_select": "no"}`

Step 43: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmp18ydi7f3/job_working_directory/000/45/configs/tmplhl_gepd' '/tmp/tmp18ydi7f3/files/a/b/d/dataset_abd191a0-ad3d-43d8-bd7d-e33d5ad95c97.dat' > '/tmp/tmp18ydi7f3/job_working_directory/000/45/outputs/dataset_064e4b68-866f-4c65-b6e1-e8e60dfa41a4.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"dc4754aa89e411efb6217c1e5266f0ee"`
chromInfo	`"/tmp/tmp18ydi7f3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
code	`"BEGIN{print \"Metric\\thap2-Maternal\"}; {print}; "`
dbkey	`"?"`

Step 44: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmp18ydi7f3/job_working_directory/000/46/configs/tmpkl2uzjhl' '/tmp/tmp18ydi7f3/files/e/0/b/dataset_e0be7a20-112f-42c6-a537-961964bfdfa8.dat' > '/tmp/tmp18ydi7f3/job_working_directory/000/46/outputs/dataset_85dbcc07-f538-475f-b931-381887dc46f4.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"dc4754aa89e411efb6217c1e5266f0ee"`
chromInfo	`"/tmp/tmp18ydi7f3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
code	`"BEGIN{print \"Metric\\thap1-Paternal\"}; {print}; "`
dbkey	`"?"`

Step 45: merqury_qv:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"dc4754aa89e411efb6217c1e5266f0ee"`
input	`{"values": [{"id": 10, "src": "hdca"}]}`
which	`{"__current_case__": 1, "identifier": "output_merqury", "which_dataset": "by_identifier"}`

Step 46: output_merqury.spectra-cn.fl:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"dc4754aa89e411efb6217c1e5266f0ee"`
input	`{"values": [{"id": 11, "src": "hdca"}]}`
which	`{"__current_case__": 1, "identifier": "output_merqury.spectra-cn.fl", "which_dataset": "by_identifier"}`

Step 47: output_merqury.spectra-asm.fl:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"dc4754aa89e411efb6217c1e5266f0ee"`
input	`{"values": [{"id": 11, "src": "hdca"}]}`
which	`{"__current_case__": 1, "identifier": "output_merqury.spectra-asm.fl", "which_dataset": "by_identifier"}`

Step 48: output_merqury.assembly_01.spectra-cn.fl:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"dc4754aa89e411efb6217c1e5266f0ee"`
input	`{"values": [{"id": 11, "src": "hdca"}]}`
which	`{"__current_case__": 1, "identifier": "output_merqury.assembly_01.spectra-cn.fl", "which_dataset": "by_identifier"}`

Step 49: output_merqury.assembly_02.spectra-cn.fl:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"dc4754aa89e411efb6217c1e5266f0ee"`
input	`{"values": [{"id": 11, "src": "hdca"}]}`
which	`{"__current_case__": 1, "identifier": "output_merqury.assembly_02.spectra-cn.fl", "which_dataset": "by_identifier"}`

Step 50: merqury_stats:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"dc4754aa89e411efb6217c1e5266f0ee"`
input	`{"values": [{"id": 13, "src": "hdca"}]}`
which	`{"__current_case__": 1, "identifier": "output_merqury.completeness", "which_dataset": "by_identifier"}`

Step 6: Hapmer Database : Maternal:
- step_state: scheduled

Step 51: Plots:

step_state: scheduled

Subworkflow Steps

Step 1: Primary data:
- step_state: scheduled
Step 2: Alternate data:
- step_state: scheduled

Step 11: Size Plot:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

cat '/tmp/tmp18ydi7f3/job_working_directory/000/66/configs/tmpfpe91z2c' && Rscript '/tmp/tmp18ydi7f3/job_working_directory/000/66/configs/tmpfpe91z2c'

Exit Code:

```
0
```

Standard Error:

Warning message:
In Sys.setlocale("LC_MESSAGES", "en_US.UTF-8") :
  OS reports request to set locale to "en_US.UTF-8" cannot be honored
Warning message:
package ‘ggplot2’ was built under R version 4.1.3 
Warning message:
Using `size` aesthetic for lines was deprecated in ggplot2 3.4.0.
ℹ Please use `linewidth` instead.

Standard Output:

        options(show.error.messages=F, error=function(){cat(geterrmessage(), file=stderr()); q("no",1,F)})

        loc <- Sys.setlocale("LC_MESSAGES", "en_US.UTF-8")
    

library(ggplot2)


        #Choose between automatically scaled x and y axis or user defined
            gg_scalex = NULL
            gg_scaley = NULL
    


            gg_theme = theme_bw()
    


            gg_legend = theme(legend.position="right")
    

input <- read.csv('/tmp/tmp18ydi7f3/files/f/5/e/dataset_f5efd354-ebdd-416a-bf27-d90502240f40.dat', sep='\t', header=TRUE)

names(input)[2] <- "xcol"
names(input)[3] <- "ycol"

    gg_facet = NULL
    gg_factor = aes(colour=factor(factor))

        gg_line = geom_line(size=1, alpha=1, gg_factor)

        color_scale = scale_color_brewer(palette='Set1', direction='1')

    names(input)[1] <- "factor"


    

    gg_axistitle = theme(axis.title = element_text(color = NULL, size = NULL, face = NULL))

    gg_axistext = theme(axis.text = element_text(color = NULL, size = NULL, face = NULL))

    gg_plottitle = theme(plot.title = element_text(color = NULL, size = NULL, face = NULL))

    gg_gridline = NULL

    gg_point = NULL

#this is the actual ggplot command to make the final plot(s)
plot_out <- ggplot(input, aes(xcol, ycol)) + gg_point + gg_line + gg_facet +
    gg_theme + gg_scalex + gg_scaley + color_scale + gg_legend + ggtitle('') + xlab('Scaffold number') + ylab('Cumulative Size (Mb)')+
    gg_axistitle + gg_axistext + gg_plottitle + gg_gridline


        gg_width <- as.double('6.0')
        gg_height <- as.double('4.0')
        gg_unit <- 'in'
        gg_dpi <- as.double('300.0')
        gg_add_device <- 'none'
        output1 <- '/tmp/tmp18ydi7f3/job_working_directory/000/66/outputs/dataset_6b9d0709-9f4c-4573-ac93-4a3aa7f131c6.dat'
        output2 <- 'XXXX'

        ggsave(filename = output1, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = "png")
        if(gg_add_device != "none"){
          ggsave(filename = output2, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = gg_add_device)
        }

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"dc4754ad89e411efb6217c1e5266f0ee"`
adv	{"axis_text_customization": {"__current_case__": 0, "axis_customization": "default"}, "axis_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "factor": {"__current_case__": 1, "colororder": "1", "colors": "Set1", "factorcol": "1", "factoring": "Single"}, "gridlinecust": "default", "legend": "yes", "plot_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "scaling": {"__current_case__": 0, "plot_scaling": "Automatic"}, "theme": "bw", "transform": "none", "type_conditional": {"__current_case__": 2, "type_options": "lines"}}
chromInfo	`"/tmp/tmp18ydi7f3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
out	`{"additional_output_format": "none", "dpi_output_dim": "300.0", "height_output_dim": "4.0", "unit_output_dim": "in", "width_output_dim": "6.0"}`
title	`""`
xlab	`"Scaffold number"`
xplot	`"2"`
ylab	`"Cumulative Size (Mb)"`
yplot	`"3"`

Step 3: Name of primary assembly:
- step_state: scheduled
Step 4: Name of alternate assembly:
- step_state: scheduled

Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmp18ydi7f3/files/5/a/8/dataset_5a88f441-ad9c-4953-b170-2cb7cc227836.dat" "/tmp/tmp18ydi7f3/job_working_directory/000/60/outputs/dataset_466e6df7-bb60-40ba-9060-eb3271264c4b.dat" "Hap1" "no"

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"dc4754ad89e411efb6217c1e5266f0ee"`
chromInfo	`"/tmp/tmp18ydi7f3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
exp	`"Hap1"`
iterate	`"no"`

Step 6: toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmp18ydi7f3/files/7/2/4/dataset_724d8073-e040-48bc-8084-dac910c25f94.dat" "/tmp/tmp18ydi7f3/job_working_directory/000/61/outputs/dataset_0c7b7d23-f6c3-4eb5-9d0f-d2c7eb25f8a6.dat" "Hap2" "no"

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"dc4754ad89e411efb6217c1e5266f0ee"`
chromInfo	`"/tmp/tmp18ydi7f3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
exp	`"Hap2"`
iterate	`"no"`

Step 7: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cat/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

cat '/tmp/tmp18ydi7f3/files/4/6/6/dataset_466e6df7-bb60-40ba-9060-eb3271264c4b.dat' >> '/tmp/tmp18ydi7f3/job_working_directory/000/62/outputs/dataset_532c12a4-2e92-4052-a2f7-8d24c8722ec3.dat' && cat '/tmp/tmp18ydi7f3/files/0/c/7/dataset_0c7b7d23-f6c3-4eb5-9d0f-d2c7eb25f8a6.dat' >> '/tmp/tmp18ydi7f3/job_working_directory/000/62/outputs/dataset_532c12a4-2e92-4052-a2f7-8d24c8722ec3.dat' && exit 0

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"dc4754ad89e411efb6217c1e5266f0ee"`
chromInfo	`"/tmp/tmp18ydi7f3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
queries	`[{"__index__": 0, "inputs2": {"values": [{"id": 143, "src": "hda"}]}}]`

Step 8: Cut1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl '/tmp/tmp18ydi7f3/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmp18ydi7f3/files/5/3/2/dataset_532c12a4-2e92-4052-a2f7-8d24c8722ec3.dat' 'c8,c5,c6' T '/tmp/tmp18ydi7f3/job_working_directory/000/63/outputs/dataset_f35e7c84-c321-4202-83f4-c5dbaf5a3300.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"dc4754ad89e411efb6217c1e5266f0ee"`
chromInfo	`"/tmp/tmp18ydi7f3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
columnList	`"c8,c5,c6"`
dbkey	`"?"`
delimiter	`"T"`

Step 9: Cut1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl '/tmp/tmp18ydi7f3/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmp18ydi7f3/files/5/3/2/dataset_532c12a4-2e92-4052-a2f7-8d24c8722ec3.dat' 'c8,c4,c7' T '/tmp/tmp18ydi7f3/job_working_directory/000/64/outputs/dataset_f5efd354-ebdd-416a-bf27-d90502240f40.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"dc4754ad89e411efb6217c1e5266f0ee"`
chromInfo	`"/tmp/tmp18ydi7f3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
columnList	`"c8,c4,c7"`
dbkey	`"?"`
delimiter	`"T"`

Step 10: Nx Plot:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

cat '/tmp/tmp18ydi7f3/job_working_directory/000/65/configs/tmpgpw3pad_' && Rscript '/tmp/tmp18ydi7f3/job_working_directory/000/65/configs/tmpgpw3pad_'

Exit Code:

```
0
```

Standard Error:

Warning message:
In Sys.setlocale("LC_MESSAGES", "en_US.UTF-8") :
  OS reports request to set locale to "en_US.UTF-8" cannot be honored
Warning message:
package ‘ggplot2’ was built under R version 4.1.3 
Warning message:
Using `size` aesthetic for lines was deprecated in ggplot2 3.4.0.
ℹ Please use `linewidth` instead.

Standard Output:

        options(show.error.messages=F, error=function(){cat(geterrmessage(), file=stderr()); q("no",1,F)})

        loc <- Sys.setlocale("LC_MESSAGES", "en_US.UTF-8")
    

library(ggplot2)


        #Choose between automatically scaled x and y axis or user defined
            gg_scalex = NULL
            gg_scaley = NULL
    


            gg_theme = theme_bw()
    


            gg_legend = theme(legend.position="right")
    

input <- read.csv('/tmp/tmp18ydi7f3/files/f/3/5/dataset_f35e7c84-c321-4202-83f4-c5dbaf5a3300.dat', sep='\t', header=TRUE)

names(input)[2] <- "xcol"
names(input)[3] <- "ycol"

    gg_facet = NULL
    gg_factor = aes(colour=factor(factor))

        gg_line = geom_line(size=1, alpha=1, gg_factor)

        color_scale = scale_color_brewer(palette='Set1', direction='1')

    names(input)[1] <- "factor"


    

    gg_axistitle = theme(axis.title = element_text(color = NULL, size = NULL, face = NULL))

    gg_axistext = theme(axis.text = element_text(color = NULL, size = NULL, face = NULL))

    gg_plottitle = theme(plot.title = element_text(color = NULL, size = NULL, face = NULL))

    gg_gridline = NULL

    gg_point = NULL

#this is the actual ggplot command to make the final plot(s)
plot_out <- ggplot(input, aes(xcol, ycol)) + gg_point + gg_line + gg_facet +
    gg_theme + gg_scalex + gg_scaley + color_scale + gg_legend + ggtitle('') + xlab('x') + ylab('Nx (Mb)')+
    gg_axistitle + gg_axistext + gg_plottitle + gg_gridline


        gg_width <- as.double('6.0')
        gg_height <- as.double('4.0')
        gg_unit <- 'in'
        gg_dpi <- as.double('300.0')
        gg_add_device <- 'none'
        output1 <- '/tmp/tmp18ydi7f3/job_working_directory/000/65/outputs/dataset_51afd548-b4ec-4f6c-8988-84aff2070a78.dat'
        output2 <- 'XXXX'

        ggsave(filename = output1, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = "png")
        if(gg_add_device != "none"){
          ggsave(filename = output2, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = gg_add_device)
        }

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"dc4754ad89e411efb6217c1e5266f0ee"`
adv	{"axis_text_customization": {"__current_case__": 0, "axis_customization": "default"}, "axis_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "factor": {"__current_case__": 1, "colororder": "1", "colors": "Set1", "factorcol": "1", "factoring": "Single"}, "gridlinecust": "default", "legend": "yes", "plot_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "scaling": {"__current_case__": 0, "plot_scaling": "Automatic"}, "theme": "bw", "transform": "none", "type_conditional": {"__current_case__": 2, "type_options": "lines"}}
chromInfo	`"/tmp/tmp18ydi7f3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
out	`{"additional_output_format": "none", "dpi_output_dim": "300.0", "height_output_dim": "4.0", "unit_output_dim": "in", "width_output_dim": "6.0"}`
title	`""`
xlab	`"x"`
xplot	`"2"`
ylab	`"Nx (Mb)"`
yplot	`"3"`

Step 52: join1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/tmp18ydi7f3/galaxy-dev/tools/filters/join.py' '/tmp/tmp18ydi7f3/files/8/5/d/dataset_85dbcc07-f538-475f-b931-381887dc46f4.dat' '/tmp/tmp18ydi7f3/files/0/6/4/dataset_064e4b68-866f-4c65-b6e1-e8e60dfa41a4.dat' 1 1 '/tmp/tmp18ydi7f3/job_working_directory/000/47/outputs/dataset_e1959ad9-3fc8-41df-888b-118319a96207.dat' -u -p --index_depth=3 --buffer=50000000 --fill_options_file=/tmp/tmp18ydi7f3/job_working_directory/000/47/configs/tmpwunlm3jf

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"dc4754aa89e411efb6217c1e5266f0ee"`
chromInfo	`"/tmp/tmp18ydi7f3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
field1	`"1"`
field2	`"1"`
fill_empty_columns	`{"__current_case__": 1, "do_fill_empty_columns": {"__current_case__": 0, "column_fill_type": "single_fill_value", "fill_value": "."}, "fill_columns_by": "fill_unjoined_only", "fill_empty_columns_switch": "fill_empty"}`
header	`""`
partial	`"-p"`
unmatched	`"-u"`

Step 53: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cut_tool/9.3+galaxy2:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

cut --complement -f '3' '/tmp/tmp18ydi7f3/files/e/1/9/dataset_e1959ad9-3fc8-41df-888b-118319a96207.dat' > '/tmp/tmp18ydi7f3/job_working_directory/000/48/outputs/dataset_82605b6a-bf7a-4df6-9737-9846f8f3968e.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"dc4754aa89e411efb6217c1e5266f0ee"`
chromInfo	`"/tmp/tmp18ydi7f3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
complement	`"--complement"`
cut_type_options	`{"__current_case__": 0, "colnames_option": {"__current_case__": 1, "header": "N", "list": ["3"]}, "cut_element": "-f", "delimiter": ""}`
dbkey	`"?"`

Step 54: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_find_and_replace/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/86755160afbf/text_processing/find_and_replace' -o '/tmp/tmp18ydi7f3/job_working_directory/000/49/outputs/dataset_9c08fdc2-7d74-4060-ae90-8b8417fe821b.dat' -g     '#' 'Number of' '/tmp/tmp18ydi7f3/files/8/2/6/dataset_82605b6a-bf7a-4df6-9737-9846f8f3968e.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"dc4754aa89e411efb6217c1e5266f0ee"`
chromInfo	`"/tmp/tmp18ydi7f3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
find_and_replace	`[{"__index__": 0, "caseinsensitive": false, "find_pattern": "#", "global": true, "is_regex": false, "replace_pattern": "Number of", "searchwhere": {"__current_case__": 0, "searchwhere_select": "line"}, "skip_first_line": false, "wholewords": false}]`

Step 7: Bits for bloom filter:
- step_state: scheduled
Step 8: Database for Busco Lineage:
- step_state: scheduled
Step 9: Lineage:
- step_state: scheduled
Step 10: Homozygous Read Coverage:
- step_state: scheduled

Other invocation details
- history_id
  - 5817d803ab645ce9
- history_state
  - ok
- invocation_id
  - 5817d803ab645ce9
- invocation_state
  - scheduled
- workflow_id
  - b939a5092a7260c1

gxydevbot · 2024-10-28T04:19:31Z

There are new updates, they have been integrated to the PR, check the file diff.

github-actions · 2024-10-28T04:53:18Z

Test Results (powered by Planemo)

Test Summary

Test State	Count
Total	1
Passed	0
Error	0
Failure	1
Skipped	0

Failed Tests

❌ Assembly-Hifi-Trio-phasing-VGP5.ga_0

Problems:

Output with path /tmp/tmpd13tzbay/Assembly statistics for Hap1 and Hap2__b0623484-8db8-4aa9-a31b-ab8b930a6eef different than expected
Expected line '# contigs	85	23' in output ('Metric	hap1-Paternal	hap2-Maternal
Expected genome size	2,288,021	2,288,021
# scaffolds	81	27
Total scaffold length	1,988,019	836,724
Average scaffold length	24,543.44	30,989.78
Scaffold N50	22,011	31,085
Scaffold N50	22,011	31,085
Scaffold auN	34,607.62	51,544.22
Scaffold L50	29	7
Scaffold L50	29	7
Scaffold NG50	20,749	0
Scaffold NG50	20,749	0
Scaffold auNG	30,069.92	18,849.60
Scaffold LG50	36	0
Scaffold LG50	36	0
Largest scaffold	132,684	132,684
Smallest scaffold	15,406	16,240
# contigs	81	27
Total contig length	1,988,019	836,724
Average contig length	24,543.44	30,989.78
Contig N50	22,011	31,085
Contig N50	22,011	31,085
Contig auN	34,607.62	51,544.22
Contig L50	29	7
Contig L50	29	7
Contig NG50	20,749	0
Contig NG50	20,749	0
Contig auNG	30,069.92	18,849.60
Contig LG50	36	0
Contig LG50	36	0
Largest contig	132,684	132,684
Smallest contig	15,406	16,240
# gaps in scaffolds	0	0
Total gap length in scaffolds	0	0
Average gap length in scaffolds	0.00	0.00
Gap N50 in scaffolds	0	0
Gap auN in scaffolds	0.00	0.00
Gap L50 in scaffolds	0	0
Largest gap in scaffolds	0	0
Smallest gap in scaffolds	0	0
Base composition (A:C:G:T)	606,195:384,545:388,054:609,225	252,099:164,572:166,355:253,698
GC content %	38.86	39.55
# soft-masked bases	0	0
# segments	81	27
Total segment length	1,988,019	836,724
Average segment length	24,543.44	30,989.78
# gaps	0	0
# paths	81	27
# edges	4	.
Average degree	0.05	.
# connected components	1	.
Largest connected component length	89,366	.
# dead ends	159	.
# disconnected components	78	.
Total length disconnected components	1,898,653	.
# separated components	79	.
# bubbles	0	.
# circular segments	0	.
# circular paths	0	.
Scaffold N10	93,875	132,684
Scaffold N20	39,024	93,875
Scaffold N30	26,760	46,449
Scaffold N40	24,154	43,611
Scaffold N50	22,011	31,085
Scaffold N50	22,011	31,085
Scaffold N60	20,442	24,012
Scaffold N70	19,760	21,778
Scaffold N80	19,051	19,871
Scaffold N90	17,544	17,885
Scaffold N100	15,406	16,240
Scaffold L10	2	1
Scaffold L20	6	2
Scaffold L30	13	3
Scaffold L40	21	5
Scaffold L50	29	7
Scaffold L50	29	7
Scaffold L60	39	11
Scaffold L70	49	14
Scaffold L80	59	18
Scaffold L90	70	23
Scaffold L100	81	27
Scaffold NG10	46,449	46,449
Scaffold NG20	33,978	24,991
Scaffold NG30	25,221	19,760
Scaffold NG40	23,338	0
Scaffold NG50	20,749	0
Scaffold NG50	20,749	0
Scaffold NG60	19,814	0
Scaffold NG70	19,045	0
Scaffold NG80	17,501	0
Scaffold NG90	0	0
Scaffold NG100	0	0
Scaffold LG10	3	3
Scaffold LG20	8	9
Scaffold LG30	16	19
Scaffold LG40	26	0
Scaffold LG50	36	0
Scaffold LG50	36	0
Scaffold LG60	48	0
Scaffold LG70	60	0
Scaffold LG80	72	0
Scaffold LG90	0	0
Scaffold LG100	0	0
Contig N10	93,875	132,684
Contig N20	39,024	93,875
Contig N30	26,760	46,449
Contig N40	24,154	43,611
Contig N50	22,011	31,085
Contig N50	22,011	31,085
Contig N60	20,442	24,012
Contig N70	19,760	21,778
Contig N80	19,051	19,871
Contig N90	17,544	17,885
Contig N100	15,406	16,240
Contig L10	2	1
Contig L20	6	2
Contig L30	13	3
Contig L40	21	5
Contig L50	29	7
Contig L50	29	7
Contig L60	39	11
Contig L70	49	14
Contig L80	59	18
Contig L90	70	23
Contig L100	81	27
Contig NG10	46,449	46,449
Contig NG20	33,978	24,991
Contig NG30	25,221	19,760
Contig NG40	23,338	0
Contig NG50	20,749	0
Contig NG50	20,749	0
Contig NG60	19,814	0
Contig NG70	19,045	0
Contig NG80	17,501	0
Contig NG90	0	0
Contig NG100	0	0
Contig LG10	3	3
Contig LG20	8	9
Contig LG30	16	19
Contig LG40	26	0
Contig LG50	36	0
Contig LG50	36	0
Contig LG60	48	0
Contig LG70	60	0
Contig LG80	72	0
Contig LG90	0	0
Contig LG100	0	0
Gap N10	0	0
Gap N20	0	0
Gap N30	0	0
Gap N40	0	0
Gap N50	0	0
Gap N60	0	0
Gap N70	0	0
Gap N80	0	0
Gap N90	0	0
Gap N100	0	0
Gap L10	0	0
Gap L20	0	0
Gap L30	0	0
Gap L40	0	0
Gap L50	0	0
Gap L60	0	0
Gap L70	0	0
Gap L80	0	0
Gap L90	0	0
Gap L100	0	0
')

Output with path /tmp/tmpf_p8sx0t/usable hap1 gfa__3c51ef66-1e50-4e89-b19e-c9cca0f13848 different than expected
Expected 175+-0 lines in the output found 167

Output with path /tmp/tmp1k0937lv/Hifiasm Trio hap1__d6495869-817c-403b-83fb-d56775e67985 different than expected
Expected 170+-0 lines in the output found 162

Output with path /tmp/tmpvt1xr49h/Busco on data 40 short summary__6047f1b9-ac32-4831-b953-d560899c23ff different than expected
Expected text 'C:1.2%[S:1.2%,D:0.0%],F:0.4%,M:98.4%,n:3354' in output ('# BUSCO version is: 5.7.1 
# The lineage dataset is: vertebrata_odb10 (Creation date: 2021-02-19, number of genomes: 67, number of BUSCOs: 3354)
# Summarized benchmarking in BUSCO notation for file /tmp/tmpb_plyg02/files/d/6/4/dataset_d6495869-817c-403b-83fb-d56775e67985.dat
# BUSCO was run in mode: euk_genome_min
# Gene predictor used: miniprot

	***** Results: *****

	C:1.1%[S:1.1%,D:0.0%],F:0.1%,M:98.8%,n:3354,E:5.3%	   
	38	Complete BUSCOs (C)	(of which 2 contain internal stop codons)		   
	37	Complete and single-copy BUSCOs (S)	   
	1	Complete and duplicated BUSCOs (D)	   
	4	Fragmented BUSCOs (F)			   
	3312	Missing BUSCOs (M)			   
	3354	Total BUSCO groups searched		   

Assembly Statistics:
	81	Number of scaffolds
	81	Number of contigs
	1988019	Total length
	0.000%	Percent gaps
	22 KB	Scaffold N50
	22 KB	Contigs N50


Dependencies and versions:
	hmmsearch: 3.1
	bbtools: None
	miniprot_index: 0.13-r248
	miniprot_align: 0.13-r248
	python: sys.version_info(major=3, minor=9, micro=19, releaselevel='final', serial=0)
	busco: 5.7.1
')

Workflow invocation details

Invocation Messages

Steps

Step 1: Pacbio Reads Collection : child:
- step_state: scheduled
Step 2: Paternal Illumina reads (hap1):
- step_state: scheduled
Step 11: Genomescope Model Parameters:
- step_state: scheduled
Step 12: Genomescope Summary:
- step_state: scheduled
Step 13: Utilize homology information to correct trio-phasing errors:
- step_state: scheduled
Step 14: SAK input file (Optional):
- step_state: scheduled
Step 15: Name for Haplotype 1:
- step_state: scheduled
Step 16: Name for Haplotype 2:
- step_state: scheduled

Step 17: toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.9+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -f -s '/tmp/tmpb_plyg02/files/6/d/6/dataset_6d62c5fd-49ae-4567-becc-6aac4d2608af.dat' 'yeast_reads_sub1_fastq_gz.fq.gz' &&  cutadapt  -j=${GALAXY_SLOTS:-4}   -b 'ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT'   -b 'ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT'    --error-rate=0.1 --times=1 --overlap=35    --action=trim --rc     --discard-trimmed   --minimum-length=1      --json=stats.json -o 'out1.fq.gz'  'yeast_reads_sub1_fastq_gz.fq.gz'  > report.txt

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"e4fd841a94e411efbe540bd11b7ee3fb"`
adapter_options	`{"action": "trim", "error_rate": "0.1", "match_read_wildcards": false, "no_indels": false, "no_match_adapter_wildcards": true, "overlap": "35", "revcomp": true, "times": "1"}`
chromInfo	`"/tmp/tmpb_plyg02/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter_options	`{"discard_casava": false, "discard_trimmed": true, "discard_untrimmed": false, "max_average_error_rate": null, "max_expected_errors": null, "max_n": null, "maximum_length": null, "maximum_length2": null, "minimum_length": "1", "minimum_length2": null, "pair_filter": "any"}`
library	{"__current_case__": 0, "input_1": {"values": [{"id": 1, "src": "dce"}]}, "r1": {"adapters": [], "anywhere_adapters": [{"__index__": 0, "adapter_source": {"__current_case__": 0, "adapter": "ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT", "adapter_name": "", "adapter_source_list": "user"}, "single_noindels": false}, {"__index__": 1, "adapter_source": {"__current_case__": 0, "adapter": "ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT", "adapter_name": "", "adapter_source_list": "user"}, "single_noindels": false}], "front_adapters": []}, "type": "single"}
other_trimming_options	`{"cut": "0", "cut2": "0", "nextseq_trim": "0", "poly_a": false, "quality_cutoff": "0", "quality_cutoff2": "", "shorten_options": {"__current_case__": 1, "shorten_values": "False"}, "shorten_options_r2": {"__current_case__": 1, "shorten_values_r2": "False"}, "trim_n": false}`
output_selector	`["json_stats", "report"]`
read_mod_options	`{"length_tag": "", "rename": "", "strip_suffix": "", "zero_cap": false}`

Step 18: toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types float,float,float,float,float,int  --file '/tmp/tmpb_plyg02/job_working_directory/000/12/configs/tmppzk454jn' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmpb_plyg02/files/9/9/5/dataset_995a3d6a-8d6f-4f33-9246-d91daea43d0e.dat' '/tmp/tmpb_plyg02/job_working_directory/000/12/outputs/dataset_97637859-abce-4bd1-b2ba-db5098d9834d.dat'

Exit Code:

```
0
```

Standard Output:

c3*2
Computing 1 new columns with instructions ['c3*2;;']
Computed new column values for 100.00% of 1 lines written.

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"e4fd841a94e411efbe540bd11b7ee3fb"`
avoid_scientific_notation	`false`
chromInfo	`"/tmp/tmpb_plyg02/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
error_handling	`{"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}}`
ops	`{"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3*2"}], "header_lines_select": "no"}`

Step 19: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

grep -G -A 0 -B 0 --no-group-separator  -i -- 'Haploid' '/tmp/tmpb_plyg02/files/f/b/b/dataset_fbb0f817-7c96-4bbc-8627-03a3b622830b.dat' > '/tmp/tmpb_plyg02/job_working_directory/000/13/outputs/dataset_c291670f-f6bf-4b52-9bdd-6833226a82e8.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"e4fd841a94e411efbe540bd11b7ee3fb"`
case_sensitive	`"-i"`
chromInfo	`"/tmp/tmpb_plyg02/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
color	`"NOCOLOR"`
dbkey	`"?"`
invert	`""`
lines_after	`"0"`
lines_before	`"0"`
regex_type	`"-G"`
url_paste	`"Haploid"`

Step 20: toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

die() { echo "$@" 1>&2 ; exit 1; } &&  mkdir multiqc_WDir &&   mkdir multiqc_WDir/cutadapt_0 &&     ln -s '/tmp/tmpb_plyg02/files/6/8/7/dataset_6877a030-dbf8-4d8d-834b-a4444e3561db.dat' 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' && sed -i.old 's/You are running/This is/' 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' && grep -q "This is cutadapt" 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' || die "'This is cutadapt' or 'You are running cutadapt' not found in the file" &&   multiqc multiqc_WDir --filename 'report'       && mkdir -p ./plots && ls -l ./report_data/ && cp ./report_data/*plot*.txt ./plots/ | true

Exit Code:

```
0
```

Standard Error:

/// MultiQC 🎃 v1.24.1

     version_check | MultiQC Version v1.25.1 now available!
       file_search | Search path: /tmp/tmpb_plyg02/job_working_directory/000/14/working/multiqc_WDir

          cutadapt | Found 1 reports

     write_results | Data        : report_data
     write_results | Report      : report.html
           multiqc | MultiQC complete

Standard Output:

total 72
-rw-r--r-- 1 1001 127    93 Oct 28 04:28 cutadapt_filtered_reads_plot.txt
-rw-r--r-- 1 1001 127    66 Oct 28 04:28 cutadapt_trimmed_sequences_plot_default_Counts.txt
-rw-r--r-- 1 1001 127    70 Oct 28 04:28 cutadapt_trimmed_sequences_plot_default_Obs_Exp.txt
-rw-r--r-- 1 1001 127   124 Oct 28 04:28 multiqc_citations.txt
-rw-r--r-- 1 1001 127   222 Oct 28 04:28 multiqc_cutadapt.txt
-rw-r--r-- 1 1001 127 39114 Oct 28 04:28 multiqc_data.json
-rw-r--r-- 1 1001 127   105 Oct 28 04:28 multiqc_general_stats.txt
-rw-r--r-- 1 1001 127    29 Oct 28 04:28 multiqc_software_versions.txt
-rw-r--r-- 1 1001 127   194 Oct 28 04:28 multiqc_sources.txt

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"e4fd841a94e411efbe540bd11b7ee3fb"`
chromInfo	`"/tmp/tmpb_plyg02/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
comment	`""`
dbkey	`"?"`
export	`false`
flat	`false`
results	`[{"__index__": 0, "software_cond": {"__current_case__": 5, "input": {"values": [{"id": 5, "src": "hdca"}]}, "software": "cutadapt"}}]`
saveLog	`"false"`
title	`""`

Step 3: Maternal Illumina reads (hap2):
- step_state: scheduled

Step 21: Cut1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl '/tmp/tmpb_plyg02/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpb_plyg02/files/9/7/6/dataset_97637859-abce-4bd1-b2ba-db5098d9834d.dat' 'c7' T '/tmp/tmpb_plyg02/job_working_directory/000/15/outputs/dataset_daedd934-0171-4d49-8d35-3ec21ecf68b6.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"e4fd841a94e411efbe540bd11b7ee3fb"`
chromInfo	`"/tmp/tmpb_plyg02/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
columnList	`"c7"`
dbkey	`"?"`
delimiter	`"T"`

Step 22: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

sed -r --sandbox -e 's/bp//g' -e 's/,//g' -e 's/([a-z])\s+([A-Z])/\1_\2/g' '/tmp/tmpb_plyg02/files/c/2/9/dataset_c291670f-f6bf-4b52-9bdd-6833226a82e8.dat' > '/tmp/tmpb_plyg02/job_working_directory/000/16/outputs/dataset_cf9e94d9-722c-4717-908d-17301073a31a.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"e4fd841a94e411efbe540bd11b7ee3fb"`
chromInfo	`"/tmp/tmpb_plyg02/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
replacements	`[{"__index__": 0, "find_pattern": "bp", "replace_pattern": ""}, {"__index__": 1, "find_pattern": ",", "replace_pattern": ""}, {"__index__": 2, "find_pattern": "([a-z])\\s+([A-Z])", "replace_pattern": "\\1_\\2"}]`

Step 23: param_value_from_file:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"e4fd841a94e411efbe540bd11b7ee3fb"`
chromInfo	`"/tmp/tmpb_plyg02/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
param_type	`"integer"`
remove_newlines	`true`

Step 24: Convert characters1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python /tmp/tmpb_plyg02/galaxy-dev/tools/filters/convert_characters.py --strip --condense /tmp/tmpb_plyg02/files/c/f/9/dataset_cf9e94d9-722c-4717-908d-17301073a31a.dat s /tmp/tmpb_plyg02/job_working_directory/000/18/outputs/dataset_4e7c8667-3b66-4940-9a11-a11c8070586e.dat

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"txt"`
__workflow_invocation_uuid__	`"e4fd841a94e411efbe540bd11b7ee3fb"`
chromInfo	`"/tmp/tmpb_plyg02/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
condense	`true`
convert_from	`"s"`
dbkey	`"?"`
strip	`true`

Step 25: Homozygous read coverage for Hifiasm:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"e4fd841a94e411efbe540bd11b7ee3fb"`
chromInfo	`"/tmp/tmpb_plyg02/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
style_cond	`{"__current_case__": 0, "pick_style": "first", "type_cond": {"__current_case__": 1, "param_type": "integer", "pick_from": [{"__index__": 0, "value": null}, {"__index__": 1, "value": "21"}]}}`

Step 26: Cut1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl '/tmp/tmpb_plyg02/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpb_plyg02/files/4/e/7/dataset_4e7c8667-3b66-4940-9a11-a11c8070586e.dat' 'c3' T '/tmp/tmpb_plyg02/job_working_directory/000/19/outputs/dataset_ec3617b2-3eda-42d8-8ab8-350b1638c221.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"e4fd841a94e411efbe540bd11b7ee3fb"`
chromInfo	`"/tmp/tmpb_plyg02/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
columnList	`"c3"`
dbkey	`"?"`
delimiter	`"T"`

Step 27: toolshed.g2.bx.psu.edu/repos/bgruening/hifiasm/hifiasm/0.20.0+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -s '/tmp/tmpb_plyg02/files/e/b/4/dataset_eb479467-26ea-45b3-a40e-c7b3ea002ff0.dat' input_0.fastq.gz &&  ln -s '/tmp/tmpb_plyg02/files/d/6/1/dataset_d612abb4-b7ab-4221-88a1-f40695542db0.dat' hap1_input_0.fastqsanger &&  ln -s '/tmp/tmpb_plyg02/files/7/9/3/dataset_793973f0-4568-4579-9db2-bf2eb49f8d66.dat' hap1_input_1.fastqsanger &&  ln -s '/tmp/tmpb_plyg02/files/3/8/d/dataset_38d98df0-90ab-4a11-a68f-931cf9f446c4.dat' hap2_input_0.fastqsanger &&  ln -s '/tmp/tmpb_plyg02/files/e/1/3/dataset_e133c9b9-5209-4ff8-851e-e4dcc568cff4.dat' hap2_input_1.fastqsanger &&  yak count -k31 -b32 -t${GALAXY_SLOTS:-1} -o hap1.yak hap1_input_0.fastqsanger hap1_input_1.fastqsanger && yak count -k31 -b32 -t${GALAXY_SLOTS:-1} -o hap2.yak hap2_input_0.fastqsanger hap2_input_1.fastqsanger && hifiasm -t ${GALAXY_SLOTS:-1} -o output -f 32 -a 4 -z 0 -m 10000000 -p 100000 -n 3 -x 0.8 -y 0.2   --hom-cov 21 -1 hap1.yak -2 hap2.yak -c 2 -d 5 --trio-dual    --primary input_0.fastq.gz 2> output.log  && mkdir noseq_files && mv *.noseq.gfa noseq_files

Exit Code:

```
0
```

Standard Error:

[M::worker_pipeline::0.245*1.00] processed 10 sequences; 0 distinct k-mers in the hash table
[M::worker_pipeline::0.291*1.00] processed 10 sequences; 0 distinct k-mers in the hash table
[M::main_count] 0 distinct k-mers after shrinking
[M::yak_ch_dump] dumpped the hash table to file 'hap1.yak'.
[M::main] Version: 0.1-r69-dirty
[M::main] CMD: yak count -k31 -b32 -t1 -o hap1.yak hap1_input_0.fastqsanger hap1_input_1.fastqsanger
[M::main] Real time: 0.292 sec; CPU: 0.291 sec; Peak RSS: 0.506 GB
[M::worker_pipeline::0.239*1.00] processed 10 sequences; 0 distinct k-mers in the hash table
[M::worker_pipeline::0.287*1.00] processed 10 sequences; 0 distinct k-mers in the hash table
[M::main_count] 0 distinct k-mers after shrinking
[M::yak_ch_dump] dumpped the hash table to file 'hap2.yak'.
[M::main] Version: 0.1-r69-dirty
[M::main] CMD: yak count -k31 -b32 -t1 -o hap2.yak hap2_input_0.fastqsanger hap2_input_1.fastqsanger
[M::main] Real time: 0.288 sec; CPU: 0.287 sec; Peak RSS: 0.506 GB

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"fastq.gz"`
__workflow_invocation_uuid__	`"e4fd841a94e411efbe540bd11b7ee3fb"`
advanced_options	`{"__current_case__": 0, "advanced_selector": "blank"}`
assembly_options	`{"__current_case__": 1, "adapter_length": "0", "assembly_selector": "set", "cleaning_rounds": "4", "disable_post_join": false, "hom_cov": "21", "ignore_error_corrected": false, "max_overlap": "0.8", "min_overlap": "0.2", "pop_contigs": "10000000", "pop_unitigs": "100000", "remove_tips": "3"}`
bins_out	`false`
chromInfo	`"/tmp/tmpb_plyg02/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter_bits	`"32"`
hic_partition	`{"__current_case__": 0, "hic_partition_selector": "blank"}`
log_out	`true`
mode	`{"__current_case__": 1, "max_kmers": "2", "min_kmers": "5", "mode_selector": "trio", "reads": {"values": [{"id": 4, "src": "hdca"}]}, "trio_dual": true, "trioinput": {"__current_case__": 0, "hap1_reads": {"values": [{"id": 2, "src": "hdca"}]}, "hap2_reads": {"values": [{"id": 3, "src": "hdca"}]}, "trio_input_selector": "reads"}, "yak_kmer_length": "31"}`
ont_integration	`{"__current_case__": 0, "ont_integration_selector": "blank"}`
purge_options	`{"__current_case__": 0, "purge_selector": "blank"}`
scaffolding_options	`{"__current_case__": 0, "scaffold_selector": "blank"}`

Step 28: Estimated genome size:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"e4fd841a94e411efbe540bd11b7ee3fb"`
chromInfo	`"/tmp/tmpb_plyg02/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
param_type	`"integer"`
remove_newlines	`true`

Step 29: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmpb_plyg02/files/7/0/7/dataset_70780a1a-94e5-41cb-9e3b-1d259fd059db.dat' --discover-paths  -o dataset.gfa --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset

Exit Code:

```
0
```

Standard Output:

+++Assembly summary+++: 
# scaffolds: 81
Total scaffold length: 1988019
Average scaffold length: 24543.44
Scaffold N50: 22011
Scaffold auN: 34607.62
Scaffold L50: 29
Largest scaffold: 132684
Smallest scaffold: 15406
# contigs: 81
Total contig length: 1988019
Average contig length: 24543.44
Contig N50: 22011
Contig auN: 34607.62
Contig L50: 29
Largest contig: 132684
Smallest contig: 15406
# gaps in scaffolds: 0
Total gap length in scaffolds: 0
Average gap length in scaffolds: 0.00
Gap N50 in scaffolds: 0
Gap auN in scaffolds: 0.00
Gap L50 in scaffolds: 0
Largest gap in scaffolds: 0
Smallest gap in scaffolds: 0
Base composition (A:C:G:T): 606195:384545:388054:609225
GC content %: 38.86
# soft-masked bases: 0
# segments: 81
Total segment length: 1988019
Average segment length: 24543.44
# gaps: 0
# paths: 81
# edges: 4
Average degree: 0.05
# connected components: 1
Largest connected component length: 89366
# dead ends: 159
# disconnected components: 78
Total length disconnected components: 1898653
# separated components: 79
# bubbles: 0
# circular segments: 0
# circular paths: 0

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"e4fd841a94e411efbe540bd11b7ee3fb"`
chromInfo	`"/tmp/tmpb_plyg02/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 4, "out_format": "gfa", "terminal_overlaps_condition": {"__current_case__": 0, "terminal_overlaps_select": "no"}}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 30: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmpb_plyg02/files/4/c/d/dataset_4cd5640d-d946-43bc-92a8-123938394be6.dat' --discover-paths  -o dataset.gfa --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset

Exit Code:

```
0
```

Standard Output:

+++Assembly summary+++: 
# scaffolds: 27
Total scaffold length: 836724
Average scaffold length: 30989.78
Scaffold N50: 31085
Scaffold auN: 51544.22
Scaffold L50: 7
Largest scaffold: 132684
Smallest scaffold: 16240
# contigs: 27
Total contig length: 836724
Average contig length: 30989.78
Contig N50: 31085
Contig auN: 51544.22
Contig L50: 7
Largest contig: 132684
Smallest contig: 16240
# gaps in scaffolds: 0
Total gap length in scaffolds: 0
Average gap length in scaffolds: 0.00
Gap N50 in scaffolds: 0
Gap auN in scaffolds: 0.00
Gap L50 in scaffolds: 0
Largest gap in scaffolds: 0
Smallest gap in scaffolds: 0
Base composition (A:C:G:T): 252099:164572:166355:253698
GC content %: 39.55
# soft-masked bases: 0
# segments: 27
Total segment length: 836724
Average segment length: 30989.78
# gaps: 0
# paths: 27

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"e4fd841a94e411efbe540bd11b7ee3fb"`
chromInfo	`"/tmp/tmpb_plyg02/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 4, "out_format": "gfa", "terminal_overlaps_condition": {"__current_case__": 0, "terminal_overlaps_select": "no"}}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 4: Meryl Database : Child:
- step_state: scheduled

Step 31: Raw Unitig Image:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -s '/tmp/tmpb_plyg02/files/1/b/f/dataset_1bf19c8d-9802-49b3-b3d8-ef2967a49c1c.dat' input.gfa &&  export QT_QPA_PLATFORM='offscreen' && Bandage image input.gfa 'out.png' --height '2000' --nodewidth '25.0'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"e4fd841a94e411efbe540bd11b7ee3fb"`
chromInfo	`"/tmp/tmpb_plyg02/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
fontsize	`None`
height	`"2000"`
lengths	`false`
names	`false`
nodewidth	`"25.0"`
output_format	`"png"`
width	`None`

Step 32: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmpb_plyg02/files/7/0/7/dataset_70780a1a-94e5-41cb-9e3b-1d259fd059db.dat' --discover-paths  -o dataset.fasta --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset

Exit Code:

```
0
```

Standard Output:

+++Assembly summary+++: 
# scaffolds: 81
Total scaffold length: 1988019
Average scaffold length: 24543.44
Scaffold N50: 22011
Scaffold auN: 34607.62
Scaffold L50: 29
Largest scaffold: 132684
Smallest scaffold: 15406
# contigs: 81
Total contig length: 1988019
Average contig length: 24543.44
Contig N50: 22011
Contig auN: 34607.62
Contig L50: 29
Largest contig: 132684
Smallest contig: 15406
# gaps in scaffolds: 0
Total gap length in scaffolds: 0
Average gap length in scaffolds: 0.00
Gap N50 in scaffolds: 0
Gap auN in scaffolds: 0.00
Gap L50 in scaffolds: 0
Largest gap in scaffolds: 0
Smallest gap in scaffolds: 0
Base composition (A:C:G:T): 606195:384545:388054:609225
GC content %: 38.86
# soft-masked bases: 0
# segments: 81
Total segment length: 1988019
Average segment length: 24543.44
# gaps: 0
# paths: 81
# edges: 4
Average degree: 0.05
# connected components: 1
Largest connected component length: 89366
# dead ends: 159
# disconnected components: 78
Total length disconnected components: 1898653
# separated components: 79
# bubbles: 0
# circular segments: 0
# circular paths: 0

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"e4fd841a94e411efbe540bd11b7ee3fb"`
chromInfo	`"/tmp/tmpb_plyg02/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 0, "line_length": null, "out_format": "fasta"}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 33: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmpb_plyg02/files/4/c/d/dataset_4cd5640d-d946-43bc-92a8-123938394be6.dat' --discover-paths  -o dataset.fasta --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset

Exit Code:

```
0
```

Standard Output:

+++Assembly summary+++: 
# scaffolds: 27
Total scaffold length: 836724
Average scaffold length: 30989.78
Scaffold N50: 31085
Scaffold auN: 51544.22
Scaffold L50: 7
Largest scaffold: 132684
Smallest scaffold: 16240
# contigs: 27
Total contig length: 836724
Average contig length: 30989.78
Contig N50: 31085
Contig auN: 51544.22
Contig L50: 7
Largest contig: 132684
Smallest contig: 16240
# gaps in scaffolds: 0
Total gap length in scaffolds: 0
Average gap length in scaffolds: 0.00
Gap N50 in scaffolds: 0
Gap auN in scaffolds: 0.00
Gap L50 in scaffolds: 0
Largest gap in scaffolds: 0
Smallest gap in scaffolds: 0
Base composition (A:C:G:T): 252099:164572:166355:253698
GC content %: 39.55
# soft-masked bases: 0
# segments: 27
Total segment length: 836724
Average segment length: 30989.78
# gaps: 0
# paths: 27

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"e4fd841a94e411efbe540bd11b7ee3fb"`
chromInfo	`"/tmp/tmpb_plyg02/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 0, "line_length": null, "out_format": "fasta"}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 34: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmpb_plyg02/files/7/0/7/dataset_70780a1a-94e5-41cb-9e3b-1d259fd059db.dat' --out-size c  --discover-paths --tabular > '/tmp/tmpb_plyg02/job_working_directory/000/28/outputs/dataset_576040e5-9258-4f00-b8f5-60d2eb876a3d.dat' --threads ${GALAXY_SLOTS:-8}

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"e4fd841a94e411efbe540bd11b7ee3fb"`
chromInfo	`"/tmp/tmpb_plyg02/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 1, "discover_paths": true, "locale": false, "selector": "statistics", "statistics_condition": {"__current_case__": 0, "out_size": "c", "selector": "size"}, "tabular": true}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 35: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmpb_plyg02/files/4/c/d/dataset_4cd5640d-d946-43bc-92a8-123938394be6.dat' --out-size c  --discover-paths --tabular > '/tmp/tmpb_plyg02/job_working_directory/000/29/outputs/dataset_4c44b695-b478-4d9d-b9b3-9b4be01333ea.dat' --threads ${GALAXY_SLOTS:-8}

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"e4fd841a94e411efbe540bd11b7ee3fb"`
chromInfo	`"/tmp/tmpb_plyg02/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 1, "discover_paths": true, "locale": false, "selector": "statistics", "statistics_condition": {"__current_case__": 0, "out_size": "c", "selector": "size"}, "tabular": true}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 36: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmpb_plyg02/files/4/c/d/dataset_4cd5640d-d946-43bc-92a8-123938394be6.dat' 2288021 --nstar-report --locale en_US.UTF-8 --discover-paths --tabular > '/tmp/tmpb_plyg02/job_working_directory/000/30/outputs/dataset_92c8ccae-329c-4235-91a6-ae879e56ef23.dat' --threads ${GALAXY_SLOTS:-8}

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"e4fd841a94e411efbe540bd11b7ee3fb"`
chromInfo	`"/tmp/tmpb_plyg02/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 1, "discover_paths": true, "locale": true, "selector": "statistics", "statistics_condition": {"__current_case__": 2, "expected_genomesize": "2288021", "selector": "assembly"}, "tabular": true}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 37: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmpb_plyg02/files/7/0/7/dataset_70780a1a-94e5-41cb-9e3b-1d259fd059db.dat' 2288021 --nstar-report --locale en_US.UTF-8 --discover-paths --tabular > '/tmp/tmpb_plyg02/job_working_directory/000/31/outputs/dataset_e9041b3c-cd24-4e26-8ca6-b70c2f151739.dat' --threads ${GALAXY_SLOTS:-8}

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"e4fd841a94e411efbe540bd11b7ee3fb"`
chromInfo	`"/tmp/tmpb_plyg02/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 1, "discover_paths": true, "locale": true, "selector": "statistics", "statistics_condition": {"__current_case__": 2, "expected_genomesize": "2288021", "selector": "assembly"}, "tabular": true}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 38: toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.7.1+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

busco --in '/tmp/tmpb_plyg02/files/d/6/4/dataset_d6495869-817c-403b-83fb-d56775e67985.dat' --mode 'geno' --out busco_galaxy --cpu ${GALAXY_SLOTS:-4} --evalue 0.001 --limit 3 --contig_break 10  --offline --download_path /cvmfs/data.galaxyproject.org/byhand/busco/v5  --lineage_dataset 'vertebrata_odb10'  --miniprot  && mkdir BUSCO_summaries && ls -l busco_galaxy/run_*/ && cp busco_galaxy/short_summary.*.txt BUSCO_summaries/ && generate_plot.py -wd BUSCO_summaries -rt specific  && echo "##gff-version 3" > busco_output.gff && cat busco_galaxy/run_*/busco_sequences/*busco_sequences/*.gff >> busco_output.gff 2> /dev/null || true

Exit Code:

```
0
```

Standard Error:

2024-10-28 04:52:01 ERROR:	Something went wrong. Results not recorded.
2024-10-28 04:52:01 ERROR:	BUSCO analysis failed!
2024-10-28 04:52:01 ERROR:	Check the logs, read the user guide (https://busco.ezlab.org/busco_userguide.html), and check the BUSCO issue board on https://gitlab.com/ezlab/busco/issues

Standard Output:

2024-10-28 04:33:30 INFO:	***** Start a BUSCO v5.7.1 analysis, current time: 10/28/2024 04:33:30 *****
2024-10-28 04:33:30 INFO:	Configuring BUSCO with local environment
2024-10-28 04:33:30 INFO:	Running genome mode
2024-10-28 04:33:34 INFO:	Input file is /tmp/tmpb_plyg02/files/d/6/4/dataset_d6495869-817c-403b-83fb-d56775e67985.dat
2024-10-28 04:33:34 WARNING:	Option evalue was provided but is not used in the selected run mode, euk_genome_min
2024-10-28 04:33:34 WARNING:	Option limit was provided but is not used in the selected run mode, euk_genome_min
2024-10-28 04:33:35 INFO:	Running BUSCO using lineage dataset vertebrata_odb10 (eukaryota, 2021-02-19)
2024-10-28 04:33:35 INFO:	Running 1 job(s) on bbtools, starting at 10/28/2024 04:33:35
2024-10-28 04:33:36 INFO:	[bbtools]	1 of 1 task(s) completed
2024-10-28 04:33:36 INFO:	Running 1 job(s) on miniprot_index, starting at 10/28/2024 04:33:36
2024-10-28 04:33:37 INFO:	[miniprot_index]	1 of 1 task(s) completed
2024-10-28 04:33:37 INFO:	Running 1 job(s) on miniprot_align, starting at 10/28/2024 04:33:37
2024-10-28 04:51:06 INFO:	[miniprot_align]	1 of 1 task(s) completed
2024-10-28 04:51:12 INFO:	***** Run HMMER on gene sequences *****
2024-10-28 04:51:13 INFO:	Running 617 job(s) on hmmsearch, starting at 10/28/2024 04:51:13
2024-10-28 04:51:19 INFO:	[hmmsearch]	62 of 617 task(s) completed
2024-10-28 04:51:24 INFO:	[hmmsearch]	124 of 617 task(s) completed
2024-10-28 04:51:29 INFO:	[hmmsearch]	186 of 617 task(s) completed
2024-10-28 04:51:33 INFO:	[hmmsearch]	247 of 617 task(s) completed
2024-10-28 04:51:38 INFO:	[hmmsearch]	309 of 617 task(s) completed
2024-10-28 04:51:43 INFO:	[hmmsearch]	371 of 617 task(s) completed
2024-10-28 04:51:47 INFO:	[hmmsearch]	432 of 617 task(s) completed
2024-10-28 04:51:52 INFO:	[hmmsearch]	494 of 617 task(s) completed
2024-10-28 04:51:56 INFO:	[hmmsearch]	556 of 617 task(s) completed
2024-10-28 04:52:01 INFO:	[hmmsearch]	617 of 617 task(s) completed
2024-10-28 04:52:01 INFO:	48 exons in total
2024-10-28 04:52:01 WARNING:	2 of 38 Complete matches (5.3%) contain internal stop codons in Miniprot gene predictions
2024-10-28 04:52:01 WARNING:	BUSCO gene predictions from Miniprot have low average identity (0.46000000834465027). You may want to repeat the analysis using the Metaeuk pipeline.

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"e4fd841a94e411efbe540bd11b7ee3fb"`
adv	`{"contig_break": "10", "evalue": "0.001", "limit": "3"}`
busco_mode	`{"__current_case__": 0, "mode": "geno", "use_augustus": {"__current_case__": 1, "use_augustus_selector": "miniprot"}}`
chromInfo	`"/tmp/tmpb_plyg02/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
lineage	`{"__current_case__": 1, "lineage_dataset": "vertebrata_odb10", "lineage_mode": "select_lineage"}`
lineage_conditional	`{"__current_case__": 0, "cached_db": "v5", "selector": "cached"}`
outputs	`["short_summary", "missing", "image", "gff"]`

Step 39: toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.7.1+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

busco --in '/tmp/tmpb_plyg02/files/9/6/9/dataset_969578b6-4d74-4537-9c3c-c82eee14e8fe.dat' --mode 'geno' --out busco_galaxy --cpu ${GALAXY_SLOTS:-4} --evalue 0.001 --limit 3 --contig_break 10  --offline --download_path /cvmfs/data.galaxyproject.org/byhand/busco/v5  --lineage_dataset 'vertebrata_odb10'  --miniprot  && mkdir BUSCO_summaries && ls -l busco_galaxy/run_*/ && cp busco_galaxy/short_summary.*.txt BUSCO_summaries/ && generate_plot.py -wd BUSCO_summaries -rt specific  && echo "##gff-version 3" > busco_output.gff && cat busco_galaxy/run_*/busco_sequences/*busco_sequences/*.gff >> busco_output.gff 2> /dev/null || true

Exit Code:

```
0
```

Standard Error:

2024-10-28 04:44:41 ERROR:	Something went wrong. Results not recorded.
2024-10-28 04:44:41 ERROR:	BUSCO analysis failed!
2024-10-28 04:44:41 ERROR:	Check the logs, read the user guide (https://busco.ezlab.org/busco_userguide.html), and check the BUSCO issue board on https://gitlab.com/ezlab/busco/issues

Standard Output:

2024-10-28 04:33:31 INFO:	***** Start a BUSCO v5.7.1 analysis, current time: 10/28/2024 04:33:31 *****
2024-10-28 04:33:31 INFO:	Configuring BUSCO with local environment
2024-10-28 04:33:31 INFO:	Running genome mode
2024-10-28 04:33:34 INFO:	Input file is /tmp/tmpb_plyg02/files/9/6/9/dataset_969578b6-4d74-4537-9c3c-c82eee14e8fe.dat
2024-10-28 04:33:34 WARNING:	Option evalue was provided but is not used in the selected run mode, euk_genome_min
2024-10-28 04:33:34 WARNING:	Option limit was provided but is not used in the selected run mode, euk_genome_min
2024-10-28 04:33:35 INFO:	Running BUSCO using lineage dataset vertebrata_odb10 (eukaryota, 2021-02-19)
2024-10-28 04:33:35 INFO:	Running 1 job(s) on bbtools, starting at 10/28/2024 04:33:35
2024-10-28 04:33:36 INFO:	[bbtools]	1 of 1 task(s) completed
2024-10-28 04:33:36 INFO:	Running 1 job(s) on miniprot_index, starting at 10/28/2024 04:33:36
2024-10-28 04:33:37 INFO:	[miniprot_index]	1 of 1 task(s) completed
2024-10-28 04:33:37 INFO:	Running 1 job(s) on miniprot_align, starting at 10/28/2024 04:33:37
2024-10-28 04:43:42 INFO:	[miniprot_align]	1 of 1 task(s) completed
2024-10-28 04:43:44 INFO:	***** Run HMMER on gene sequences *****
2024-10-28 04:43:45 INFO:	Running 383 job(s) on hmmsearch, starting at 10/28/2024 04:43:45
2024-10-28 04:43:52 INFO:	[hmmsearch]	39 of 383 task(s) completed
2024-10-28 04:43:57 INFO:	[hmmsearch]	77 of 383 task(s) completed
2024-10-28 04:44:03 INFO:	[hmmsearch]	115 of 383 task(s) completed
2024-10-28 04:44:09 INFO:	[hmmsearch]	154 of 383 task(s) completed
2024-10-28 04:44:14 INFO:	[hmmsearch]	192 of 383 task(s) completed
2024-10-28 04:44:19 INFO:	[hmmsearch]	230 of 383 task(s) completed
2024-10-28 04:44:25 INFO:	[hmmsearch]	269 of 383 task(s) completed
2024-10-28 04:44:30 INFO:	[hmmsearch]	307 of 383 task(s) completed
2024-10-28 04:44:36 INFO:	[hmmsearch]	345 of 383 task(s) completed
2024-10-28 04:44:41 INFO:	[hmmsearch]	383 of 383 task(s) completed
2024-10-28 04:44:41 INFO:	14 exons in total
2024-10-28 04:44:41 WARNING:	1 of 10 Complete matches (10.0%) contain internal stop codons in Miniprot gene predictions

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"e4fd841a94e411efbe540bd11b7ee3fb"`
adv	`{"contig_break": "10", "evalue": "0.001", "limit": "3"}`
busco_mode	`{"__current_case__": 0, "mode": "geno", "use_augustus": {"__current_case__": 1, "use_augustus_selector": "miniprot"}}`
chromInfo	`"/tmp/tmpb_plyg02/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
lineage	`{"__current_case__": 1, "lineage_dataset": "vertebrata_odb10", "lineage_mode": "select_lineage"}`
lineage_conditional	`{"__current_case__": 0, "cached_db": "v5", "selector": "cached"}`
outputs	`["short_summary", "missing", "image", "gff"]`

Step 40: toolshed.g2.bx.psu.edu/repos/iuc/merqury/merqury/1.3+galaxy4:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

mkdir -p output_files && mkdir -p read-db.meryl pat.meryl mat.meryl && tar -zxf /tmp/tmpb_plyg02/files/a/f/d/dataset_afdc34c1-5e1e-4086-9419-0189427d4d60.dat -C read-db.meryl --strip-components=1 && tar -zxf /tmp/tmpb_plyg02/files/0/2/a/dataset_02adbd04-3920-4c47-9960-45839d150d0c.dat -C pat.meryl --strip-components=1 && tar -zxf /tmp/tmpb_plyg02/files/3/a/1/dataset_3a17c098-a945-4b25-ae48-5506b26e1c66.dat -C mat.meryl --strip-components=1 && ln -s '/tmp/tmpb_plyg02/files/d/6/4/dataset_d6495869-817c-403b-83fb-d56775e67985.dat' assembly_01.fasta && ln -s '/tmp/tmpb_plyg02/files/9/6/9/dataset_969578b6-4d74-4537-9c3c-c82eee14e8fe.dat' assembly_02.fasta && merqury.sh read-db.meryl pat.meryl mat.meryl assembly_01.fasta assembly_02.fasta output_merqury &> /tmp/tmpb_plyg02/job_working_directory/000/34/outputs/dataset_68e12d30-22f4-4551-a9c6-4a3b44123442.dat && mv output_merqury* output_files && find . -maxdepth 1 -name 'assembly_only*' -type f -print0 | xargs -0r mv -t output_files  && sed -i '1s/^/assembly\tk-mer set\tsolid k-mers in assembly\tsolid k-mers in reads\tcompleteness %\n/' 'output_files/output_merqury.completeness.stats' && sed -i '1s/^/assembly\tunique k-mers\tcommon k-mers\tQV\terror rate\n/' 'output_files/output_merqury.qv'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"e4fd841a94e411efbe540bd11b7ee3fb"`
chromInfo	`"/tmp/tmpb_plyg02/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
label	`"output_merqury"`
mode	`{"__current_case__": 1, "assembly_options": {"__current_case__": 1, "assembly_01": {"values": [{"id": 33, "src": "hda"}]}, "assembly_02": {"values": [{"id": 34, "src": "hda"}]}, "number_assemblies": "two"}, "meryldb_F1": {"values": [{"id": 1, "src": "hda"}]}, "meryldb_MAT": {"values": [{"id": 3, "src": "hda"}]}, "meryldb_PAT": {"values": [{"id": 2, "src": "hda"}]}, "options": "trio"}`
output_add_headers	`true`
output_selector	`["qv", "plots", "sizes", "stats", "bed", "wig", "log", "hist"]`

Step 5: Hapmer Database : Paternal:
- step_state: scheduled

Step 41: Data prep Hap1:

step_state: scheduled

Subworkflow Steps

Step 1: gfa_stats:
- step_state: scheduled

Step 2: sort1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/tmpb_plyg02/galaxy-dev/tools/filters/sorter.py'  --input='/tmp/tmpb_plyg02/files/5/7/6/dataset_576040e5-9258-4f00-b8f5-60d2eb876a3d.dat' --output='/tmp/tmpb_plyg02/job_working_directory/000/35/outputs/dataset_d916a21f-89c0-4267-8b87-10eec96492d6.dat'    --key=2,2nr   --header 0

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"e4fd841b94e411efbe540bd11b7ee3fb"`
chromInfo	`"/tmp/tmpb_plyg02/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
column	`"2"`
column_set	`[]`
dbkey	`"?"`
header_lines	`"0"`
order	`"DESC"`
style	`"num"`

Step 3: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmpb_plyg02/job_working_directory/000/36/configs/tmpname3uhg' '/tmp/tmpb_plyg02/files/d/9/1/dataset_d916a21f-89c0-4267-8b87-10eec96492d6.dat' > '/tmp/tmpb_plyg02/job_working_directory/000/36/outputs/dataset_429802dc-210e-47fb-9326-4ac764837d4b.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"e4fd841b94e411efbe540bd11b7ee3fb"`
chromInfo	`"/tmp/tmpb_plyg02/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
code	`"{total += $2; $3 = total}1"`
dbkey	`"?"`

Step 4: toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.8+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

datamash         absmax 3 < /tmp/tmpb_plyg02/files/4/2/9/dataset_429802dc-210e-47fb-9326-4ac764837d4b.dat > '/tmp/tmpb_plyg02/job_working_directory/000/37/outputs/dataset_6d7f3c2f-1323-4182-9113-f1180b083964.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"e4fd841b94e411efbe540bd11b7ee3fb"`
chromInfo	`"/tmp/tmpb_plyg02/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
grouping	`""`
header_in	`false`
header_out	`false`
ignore_case	`false`
narm	`false`
need_sort	`false`
operations	`[{"__index__": 0, "op_column": "3", "op_name": "absmax"}]`
print_full_line	`false`

Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpb_plyg02/files/4/2/9/dataset_429802dc-210e-47fb-9326-4ac764837d4b.dat" "/tmp/tmpb_plyg02/job_working_directory/000/38/outputs/dataset_7f0e38f9-8358-4fb5-9e12-3478d3ecaf1a.dat" "1" "yes"

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"e4fd841b94e411efbe540bd11b7ee3fb"`
chromInfo	`"/tmp/tmpb_plyg02/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
exp	`"1"`
iterate	`"yes"`

Step 6: param_value_from_file:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"e4fd841b94e411efbe540bd11b7ee3fb"`
chromInfo	`"/tmp/tmpb_plyg02/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
param_type	`"integer"`
remove_newlines	`true`

Step 7: toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"e4fd841b94e411efbe540bd11b7ee3fb"`
chromInfo	`"/tmp/tmpb_plyg02/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
components	`[{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "c3/", "select_param_type": "text"}}, {"__index__": 1, "param_type": {"__current_case__": 1, "component_value": "1988019", "select_param_type": "integer"}}]`
dbkey	`"?"`

Step 8: toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types str,int,int,int  --file '/tmp/tmpb_plyg02/job_working_directory/000/59/configs/tmp655nivfu' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmpb_plyg02/files/7/f/0/dataset_7f0e38f9-8358-4fb5-9e12-3478d3ecaf1a.dat' '/tmp/tmpb_plyg02/job_working_directory/000/59/outputs/dataset_93f5b931-1fa3-4638-a62b-5c91a69e73f3.dat'

Exit Code:

```
0
```

Standard Output:

c3/1988019
c2/1000000
c3/1000000
Computing 3 new columns with instructions ['c3/1988019;;', 'c2/1000000;;', 'c3/1000000;;']
Computed new column values for 100.00% of 81 lines written.

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"e4fd841b94e411efbe540bd11b7ee3fb"`
avoid_scientific_notation	`false`
chromInfo	`"/tmp/tmpb_plyg02/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
error_handling	`{"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}}`
ops	`{"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1988019"}, {"__index__": 1, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c2/1000000"}, {"__index__": 2, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1000000"}], "header_lines_select": "no"}`

Step 42: Data Prep Hap2:

step_state: scheduled

Subworkflow Steps

Step 1: gfa_stats:
- step_state: scheduled

Step 2: sort1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/tmpb_plyg02/galaxy-dev/tools/filters/sorter.py'  --input='/tmp/tmpb_plyg02/files/4/c/4/dataset_4c44b695-b478-4d9d-b9b3-9b4be01333ea.dat' --output='/tmp/tmpb_plyg02/job_working_directory/000/40/outputs/dataset_1f604e5e-1414-4585-8d67-b416213fe92b.dat'    --key=2,2nr   --header 0

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"e4fd841c94e411efbe540bd11b7ee3fb"`
chromInfo	`"/tmp/tmpb_plyg02/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
column	`"2"`
column_set	`[]`
dbkey	`"?"`
header_lines	`"0"`
order	`"DESC"`
style	`"num"`

Step 3: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmpb_plyg02/job_working_directory/000/41/configs/tmpo88ftjnc' '/tmp/tmpb_plyg02/files/1/f/6/dataset_1f604e5e-1414-4585-8d67-b416213fe92b.dat' > '/tmp/tmpb_plyg02/job_working_directory/000/41/outputs/dataset_29209d37-1250-4a57-93ec-c3e9abfd0f8a.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"e4fd841c94e411efbe540bd11b7ee3fb"`
chromInfo	`"/tmp/tmpb_plyg02/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
code	`"{total += $2; $3 = total}1"`
dbkey	`"?"`

Step 4: toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.8+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

datamash         absmax 3 < /tmp/tmpb_plyg02/files/2/9/2/dataset_29209d37-1250-4a57-93ec-c3e9abfd0f8a.dat > '/tmp/tmpb_plyg02/job_working_directory/000/42/outputs/dataset_3cd300c6-ce38-463b-8c6f-bb48862627a3.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"e4fd841c94e411efbe540bd11b7ee3fb"`
chromInfo	`"/tmp/tmpb_plyg02/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
grouping	`""`
header_in	`false`
header_out	`false`
ignore_case	`false`
narm	`false`
need_sort	`false`
operations	`[{"__index__": 0, "op_column": "3", "op_name": "absmax"}]`
print_full_line	`false`

Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpb_plyg02/files/2/9/2/dataset_29209d37-1250-4a57-93ec-c3e9abfd0f8a.dat" "/tmp/tmpb_plyg02/job_working_directory/000/43/outputs/dataset_a804273e-e41a-4c44-9bd6-eeb06ae542d9.dat" "1" "yes"

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"e4fd841c94e411efbe540bd11b7ee3fb"`
chromInfo	`"/tmp/tmpb_plyg02/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
exp	`"1"`
iterate	`"yes"`

Step 6: param_value_from_file:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"e4fd841c94e411efbe540bd11b7ee3fb"`
chromInfo	`"/tmp/tmpb_plyg02/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
param_type	`"integer"`
remove_newlines	`true`

Step 7: toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"e4fd841c94e411efbe540bd11b7ee3fb"`
chromInfo	`"/tmp/tmpb_plyg02/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
components	`[{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "c3/", "select_param_type": "text"}}, {"__index__": 1, "param_type": {"__current_case__": 1, "component_value": "836724", "select_param_type": "integer"}}]`
dbkey	`"?"`

Step 8: toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types str,int,int,int  --file '/tmp/tmpb_plyg02/job_working_directory/000/58/configs/tmpoa0l9ppc' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmpb_plyg02/files/a/8/0/dataset_a804273e-e41a-4c44-9bd6-eeb06ae542d9.dat' '/tmp/tmpb_plyg02/job_working_directory/000/58/outputs/dataset_45d32b70-6376-4511-be8b-2c5ced3368ec.dat'

Exit Code:

```
0
```

Standard Output:

c3/836724
c2/1000000
c3/1000000
Computing 3 new columns with instructions ['c3/836724;;', 'c2/1000000;;', 'c3/1000000;;']
Computed new column values for 100.00% of 27 lines written.

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"e4fd841c94e411efbe540bd11b7ee3fb"`
avoid_scientific_notation	`false`
chromInfo	`"/tmp/tmpb_plyg02/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
error_handling	`{"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}}`
ops	`{"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/836724"}, {"__index__": 1, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c2/1000000"}, {"__index__": 2, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1000000"}], "header_lines_select": "no"}`

Step 43: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmpb_plyg02/job_working_directory/000/45/configs/tmp89p_32wv' '/tmp/tmpb_plyg02/files/9/2/c/dataset_92c8ccae-329c-4235-91a6-ae879e56ef23.dat' > '/tmp/tmpb_plyg02/job_working_directory/000/45/outputs/dataset_b28f301c-79ab-44fd-8aa5-85b3b8b3b8e9.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"e4fd841a94e411efbe540bd11b7ee3fb"`
chromInfo	`"/tmp/tmpb_plyg02/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
code	`"BEGIN{print \"Metric\\thap2-Maternal\"}; {print}; "`
dbkey	`"?"`

Step 44: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmpb_plyg02/job_working_directory/000/46/configs/tmpikwf2o7j' '/tmp/tmpb_plyg02/files/e/9/0/dataset_e9041b3c-cd24-4e26-8ca6-b70c2f151739.dat' > '/tmp/tmpb_plyg02/job_working_directory/000/46/outputs/dataset_82e7904c-9e18-48ec-804b-415f15bd86c4.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"e4fd841a94e411efbe540bd11b7ee3fb"`
chromInfo	`"/tmp/tmpb_plyg02/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
code	`"BEGIN{print \"Metric\\thap1-Paternal\"}; {print}; "`
dbkey	`"?"`

Step 45: merqury_qv:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"e4fd841a94e411efbe540bd11b7ee3fb"`
input	`{"values": [{"id": 10, "src": "hdca"}]}`
which	`{"__current_case__": 1, "identifier": "output_merqury", "which_dataset": "by_identifier"}`

Step 46: output_merqury.spectra-cn.fl:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"e4fd841a94e411efbe540bd11b7ee3fb"`
input	`{"values": [{"id": 11, "src": "hdca"}]}`
which	`{"__current_case__": 1, "identifier": "output_merqury.spectra-cn.fl", "which_dataset": "by_identifier"}`

Step 47: output_merqury.spectra-asm.fl:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"e4fd841a94e411efbe540bd11b7ee3fb"`
input	`{"values": [{"id": 11, "src": "hdca"}]}`
which	`{"__current_case__": 1, "identifier": "output_merqury.spectra-asm.fl", "which_dataset": "by_identifier"}`

Step 48: output_merqury.assembly_01.spectra-cn.fl:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"e4fd841a94e411efbe540bd11b7ee3fb"`
input	`{"values": [{"id": 11, "src": "hdca"}]}`
which	`{"__current_case__": 1, "identifier": "output_merqury.assembly_01.spectra-cn.fl", "which_dataset": "by_identifier"}`

Step 49: output_merqury.assembly_02.spectra-cn.fl:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"e4fd841a94e411efbe540bd11b7ee3fb"`
input	`{"values": [{"id": 11, "src": "hdca"}]}`
which	`{"__current_case__": 1, "identifier": "output_merqury.assembly_02.spectra-cn.fl", "which_dataset": "by_identifier"}`

Step 50: merqury_stats:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"e4fd841a94e411efbe540bd11b7ee3fb"`
input	`{"values": [{"id": 13, "src": "hdca"}]}`
which	`{"__current_case__": 1, "identifier": "output_merqury.completeness", "which_dataset": "by_identifier"}`

Step 6: Hapmer Database : Maternal:
- step_state: scheduled

Step 51: Plots:

step_state: scheduled

Subworkflow Steps

Step 1: Primary data:
- step_state: scheduled
Step 2: Alternate data:
- step_state: scheduled

Step 11: Size Plot:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

cat '/tmp/tmpb_plyg02/job_working_directory/000/66/configs/tmplawkqeqv' && Rscript '/tmp/tmpb_plyg02/job_working_directory/000/66/configs/tmplawkqeqv'

Exit Code:

```
0
```

Standard Error:

Warning message:
In Sys.setlocale("LC_MESSAGES", "en_US.UTF-8") :
  OS reports request to set locale to "en_US.UTF-8" cannot be honored
Warning message:
package ‘ggplot2’ was built under R version 4.1.3 
Warning message:
Using `size` aesthetic for lines was deprecated in ggplot2 3.4.0.
ℹ Please use `linewidth` instead.

Standard Output:

        options(show.error.messages=F, error=function(){cat(geterrmessage(), file=stderr()); q("no",1,F)})

        loc <- Sys.setlocale("LC_MESSAGES", "en_US.UTF-8")
    

library(ggplot2)


        #Choose between automatically scaled x and y axis or user defined
            gg_scalex = NULL
            gg_scaley = NULL
    


            gg_theme = theme_bw()
    


            gg_legend = theme(legend.position="right")
    

input <- read.csv('/tmp/tmpb_plyg02/files/e/3/1/dataset_e31c87cf-ccc5-4855-894a-e033c20ae6c2.dat', sep='\t', header=TRUE)

names(input)[2] <- "xcol"
names(input)[3] <- "ycol"

    gg_facet = NULL
    gg_factor = aes(colour=factor(factor))

        gg_line = geom_line(size=1, alpha=1, gg_factor)

        color_scale = scale_color_brewer(palette='Set1', direction='1')

    names(input)[1] <- "factor"


    

    gg_axistitle = theme(axis.title = element_text(color = NULL, size = NULL, face = NULL))

    gg_axistext = theme(axis.text = element_text(color = NULL, size = NULL, face = NULL))

    gg_plottitle = theme(plot.title = element_text(color = NULL, size = NULL, face = NULL))

    gg_gridline = NULL

    gg_point = NULL

#this is the actual ggplot command to make the final plot(s)
plot_out <- ggplot(input, aes(xcol, ycol)) + gg_point + gg_line + gg_facet +
    gg_theme + gg_scalex + gg_scaley + color_scale + gg_legend + ggtitle('') + xlab('Scaffold number') + ylab('Cumulative Size (Mb)')+
    gg_axistitle + gg_axistext + gg_plottitle + gg_gridline


        gg_width <- as.double('6.0')
        gg_height <- as.double('4.0')
        gg_unit <- 'in'
        gg_dpi <- as.double('300.0')
        gg_add_device <- 'none'
        output1 <- '/tmp/tmpb_plyg02/job_working_directory/000/66/outputs/dataset_68d93efa-865e-44f9-aaeb-4507e1699068.dat'
        output2 <- 'XXXX'

        ggsave(filename = output1, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = "png")
        if(gg_add_device != "none"){
          ggsave(filename = output2, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = gg_add_device)
        }

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"e4fd841d94e411efbe540bd11b7ee3fb"`
adv	{"axis_text_customization": {"__current_case__": 0, "axis_customization": "default"}, "axis_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "factor": {"__current_case__": 1, "colororder": "1", "colors": "Set1", "factorcol": "1", "factoring": "Single"}, "gridlinecust": "default", "legend": "yes", "plot_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "scaling": {"__current_case__": 0, "plot_scaling": "Automatic"}, "theme": "bw", "transform": "none", "type_conditional": {"__current_case__": 2, "type_options": "lines"}}
chromInfo	`"/tmp/tmpb_plyg02/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
out	`{"additional_output_format": "none", "dpi_output_dim": "300.0", "height_output_dim": "4.0", "unit_output_dim": "in", "width_output_dim": "6.0"}`
title	`""`
xlab	`"Scaffold number"`
xplot	`"2"`
ylab	`"Cumulative Size (Mb)"`
yplot	`"3"`

Step 3: Name of primary assembly:
- step_state: scheduled
Step 4: Name of alternate assembly:
- step_state: scheduled

Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpb_plyg02/files/9/3/f/dataset_93f5b931-1fa3-4638-a62b-5c91a69e73f3.dat" "/tmp/tmpb_plyg02/job_working_directory/000/60/outputs/dataset_b29365f8-54cf-42a4-8199-3b64a5d84222.dat" "Hap1" "no"

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"e4fd841d94e411efbe540bd11b7ee3fb"`
chromInfo	`"/tmp/tmpb_plyg02/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
exp	`"Hap1"`
iterate	`"no"`

Step 6: toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpb_plyg02/files/4/5/d/dataset_45d32b70-6376-4511-be8b-2c5ced3368ec.dat" "/tmp/tmpb_plyg02/job_working_directory/000/61/outputs/dataset_35059f95-e3b1-41d8-8ce9-862566b038a7.dat" "Hap2" "no"

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"e4fd841d94e411efbe540bd11b7ee3fb"`
chromInfo	`"/tmp/tmpb_plyg02/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
exp	`"Hap2"`
iterate	`"no"`

Step 7: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cat/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

cat '/tmp/tmpb_plyg02/files/b/2/9/dataset_b29365f8-54cf-42a4-8199-3b64a5d84222.dat' >> '/tmp/tmpb_plyg02/job_working_directory/000/62/outputs/dataset_44a9fd2e-b863-4238-b359-b9b3f4e4fa80.dat' && cat '/tmp/tmpb_plyg02/files/3/5/0/dataset_35059f95-e3b1-41d8-8ce9-862566b038a7.dat' >> '/tmp/tmpb_plyg02/job_working_directory/000/62/outputs/dataset_44a9fd2e-b863-4238-b359-b9b3f4e4fa80.dat' && exit 0

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"e4fd841d94e411efbe540bd11b7ee3fb"`
chromInfo	`"/tmp/tmpb_plyg02/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
queries	`[{"__index__": 0, "inputs2": {"values": [{"id": 143, "src": "hda"}]}}]`

Step 8: Cut1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl '/tmp/tmpb_plyg02/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpb_plyg02/files/4/4/a/dataset_44a9fd2e-b863-4238-b359-b9b3f4e4fa80.dat' 'c8,c5,c6' T '/tmp/tmpb_plyg02/job_working_directory/000/63/outputs/dataset_8f9bb209-35fb-4191-a051-dff61a1ec4d8.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"e4fd841d94e411efbe540bd11b7ee3fb"`
chromInfo	`"/tmp/tmpb_plyg02/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
columnList	`"c8,c5,c6"`
dbkey	`"?"`
delimiter	`"T"`

Step 9: Cut1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl '/tmp/tmpb_plyg02/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpb_plyg02/files/4/4/a/dataset_44a9fd2e-b863-4238-b359-b9b3f4e4fa80.dat' 'c8,c4,c7' T '/tmp/tmpb_plyg02/job_working_directory/000/64/outputs/dataset_e31c87cf-ccc5-4855-894a-e033c20ae6c2.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"e4fd841d94e411efbe540bd11b7ee3fb"`
chromInfo	`"/tmp/tmpb_plyg02/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
columnList	`"c8,c4,c7"`
dbkey	`"?"`
delimiter	`"T"`

Step 10: Nx Plot:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

cat '/tmp/tmpb_plyg02/job_working_directory/000/65/configs/tmp1f082icl' && Rscript '/tmp/tmpb_plyg02/job_working_directory/000/65/configs/tmp1f082icl'

Exit Code:

```
0
```

Standard Error:

Warning message:
In Sys.setlocale("LC_MESSAGES", "en_US.UTF-8") :
  OS reports request to set locale to "en_US.UTF-8" cannot be honored
Warning message:
package ‘ggplot2’ was built under R version 4.1.3 
Warning message:
Using `size` aesthetic for lines was deprecated in ggplot2 3.4.0.
ℹ Please use `linewidth` instead.

Standard Output:

        options(show.error.messages=F, error=function(){cat(geterrmessage(), file=stderr()); q("no",1,F)})

        loc <- Sys.setlocale("LC_MESSAGES", "en_US.UTF-8")
    

library(ggplot2)


        #Choose between automatically scaled x and y axis or user defined
            gg_scalex = NULL
            gg_scaley = NULL
    


            gg_theme = theme_bw()
    


            gg_legend = theme(legend.position="right")
    

input <- read.csv('/tmp/tmpb_plyg02/files/8/f/9/dataset_8f9bb209-35fb-4191-a051-dff61a1ec4d8.dat', sep='\t', header=TRUE)

names(input)[2] <- "xcol"
names(input)[3] <- "ycol"

    gg_facet = NULL
    gg_factor = aes(colour=factor(factor))

        gg_line = geom_line(size=1, alpha=1, gg_factor)

        color_scale = scale_color_brewer(palette='Set1', direction='1')

    names(input)[1] <- "factor"


    

    gg_axistitle = theme(axis.title = element_text(color = NULL, size = NULL, face = NULL))

    gg_axistext = theme(axis.text = element_text(color = NULL, size = NULL, face = NULL))

    gg_plottitle = theme(plot.title = element_text(color = NULL, size = NULL, face = NULL))

    gg_gridline = NULL

    gg_point = NULL

#this is the actual ggplot command to make the final plot(s)
plot_out <- ggplot(input, aes(xcol, ycol)) + gg_point + gg_line + gg_facet +
    gg_theme + gg_scalex + gg_scaley + color_scale + gg_legend + ggtitle('') + xlab('x') + ylab('Nx (Mb)')+
    gg_axistitle + gg_axistext + gg_plottitle + gg_gridline


        gg_width <- as.double('6.0')
        gg_height <- as.double('4.0')
        gg_unit <- 'in'
        gg_dpi <- as.double('300.0')
        gg_add_device <- 'none'
        output1 <- '/tmp/tmpb_plyg02/job_working_directory/000/65/outputs/dataset_459efc33-57fb-48b3-823f-0bf1890ec606.dat'
        output2 <- 'XXXX'

        ggsave(filename = output1, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = "png")
        if(gg_add_device != "none"){
          ggsave(filename = output2, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = gg_add_device)
        }

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"e4fd841d94e411efbe540bd11b7ee3fb"`
adv	{"axis_text_customization": {"__current_case__": 0, "axis_customization": "default"}, "axis_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "factor": {"__current_case__": 1, "colororder": "1", "colors": "Set1", "factorcol": "1", "factoring": "Single"}, "gridlinecust": "default", "legend": "yes", "plot_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "scaling": {"__current_case__": 0, "plot_scaling": "Automatic"}, "theme": "bw", "transform": "none", "type_conditional": {"__current_case__": 2, "type_options": "lines"}}
chromInfo	`"/tmp/tmpb_plyg02/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
out	`{"additional_output_format": "none", "dpi_output_dim": "300.0", "height_output_dim": "4.0", "unit_output_dim": "in", "width_output_dim": "6.0"}`
title	`""`
xlab	`"x"`
xplot	`"2"`
ylab	`"Nx (Mb)"`
yplot	`"3"`

Step 52: join1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/tmpb_plyg02/galaxy-dev/tools/filters/join.py' '/tmp/tmpb_plyg02/files/8/2/e/dataset_82e7904c-9e18-48ec-804b-415f15bd86c4.dat' '/tmp/tmpb_plyg02/files/b/2/8/dataset_b28f301c-79ab-44fd-8aa5-85b3b8b3b8e9.dat' 1 1 '/tmp/tmpb_plyg02/job_working_directory/000/47/outputs/dataset_5e82c857-1c5e-4cee-8c69-2d0d5cd40e4b.dat' -u -p --index_depth=3 --buffer=50000000 --fill_options_file=/tmp/tmpb_plyg02/job_working_directory/000/47/configs/tmpx2a6afxg

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"e4fd841a94e411efbe540bd11b7ee3fb"`
chromInfo	`"/tmp/tmpb_plyg02/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
field1	`"1"`
field2	`"1"`
fill_empty_columns	`{"__current_case__": 1, "do_fill_empty_columns": {"__current_case__": 0, "column_fill_type": "single_fill_value", "fill_value": "."}, "fill_columns_by": "fill_unjoined_only", "fill_empty_columns_switch": "fill_empty"}`
header	`""`
partial	`"-p"`
unmatched	`"-u"`

Step 53: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cut_tool/9.3+galaxy2:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

cut --complement -f '3' '/tmp/tmpb_plyg02/files/5/e/8/dataset_5e82c857-1c5e-4cee-8c69-2d0d5cd40e4b.dat' > '/tmp/tmpb_plyg02/job_working_directory/000/48/outputs/dataset_b0623484-8db8-4aa9-a31b-ab8b930a6eef.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"e4fd841a94e411efbe540bd11b7ee3fb"`
chromInfo	`"/tmp/tmpb_plyg02/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
complement	`"--complement"`
cut_type_options	`{"__current_case__": 0, "colnames_option": {"__current_case__": 1, "header": "N", "list": ["3"]}, "cut_element": "-f", "delimiter": ""}`
dbkey	`"?"`

Step 54: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_find_and_replace/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/86755160afbf/text_processing/find_and_replace' -o '/tmp/tmpb_plyg02/job_working_directory/000/49/outputs/dataset_7673e1d7-e9cc-408d-b5c4-a0f443b0ad0e.dat' -g     '#' 'Number of' '/tmp/tmpb_plyg02/files/b/0/6/dataset_b0623484-8db8-4aa9-a31b-ab8b930a6eef.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"e4fd841a94e411efbe540bd11b7ee3fb"`
chromInfo	`"/tmp/tmpb_plyg02/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
find_and_replace	`[{"__index__": 0, "caseinsensitive": false, "find_pattern": "#", "global": true, "is_regex": false, "replace_pattern": "Number of", "searchwhere": {"__current_case__": 0, "searchwhere_select": "line"}, "skip_first_line": false, "wholewords": false}]`

Step 7: Bits for bloom filter:
- step_state: scheduled
Step 8: Database for Busco Lineage:
- step_state: scheduled
Step 9: Lineage:
- step_state: scheduled
Step 10: Homozygous Read Coverage:
- step_state: scheduled

Other invocation details
- history_id
  - c6dda86d5af0361e
- history_state
  - ok
- invocation_id
  - c6dda86d5af0361e
- invocation_state
  - scheduled
- workflow_id
  - 1138f313cf38c207

gxydevbot · 2024-11-04T04:18:17Z

There are new updates, they have been integrated to the PR, check the file diff.

github-actions · 2024-11-04T04:55:14Z

Test Results (powered by Planemo)

Test Summary

Test State	Count
Total	1
Passed	0
Error	0
Failure	1
Skipped	0

Failed Tests

❌ Assembly-Hifi-Trio-phasing-VGP5.ga_0

Problems:

Output with path /tmp/tmpboxmool0/Assembly statistics for Hap1 and Hap2__23c4702f-2735-4469-a20e-a849f097c969 different than expected
Expected line '# contigs	85	23' in output ('Metric	hap1-Paternal	hap2-Maternal
Expected genome size	2,288,021	2,288,021
# scaffolds	81	27
Total scaffold length	1,988,019	836,724
Average scaffold length	24,543.44	30,989.78
Scaffold N50	22,011	31,085
Scaffold N50	22,011	31,085
Scaffold auN	34,607.62	51,544.22
Scaffold L50	29	7
Scaffold L50	29	7
Scaffold NG50	20,749	0
Scaffold NG50	20,749	0
Scaffold auNG	30,069.92	18,849.60
Scaffold LG50	36	0
Scaffold LG50	36	0
Largest scaffold	132,684	132,684
Smallest scaffold	15,406	16,240
# contigs	81	27
Total contig length	1,988,019	836,724
Average contig length	24,543.44	30,989.78
Contig N50	22,011	31,085
Contig N50	22,011	31,085
Contig auN	34,607.62	51,544.22
Contig L50	29	7
Contig L50	29	7
Contig NG50	20,749	0
Contig NG50	20,749	0
Contig auNG	30,069.92	18,849.60
Contig LG50	36	0
Contig LG50	36	0
Largest contig	132,684	132,684
Smallest contig	15,406	16,240
# gaps in scaffolds	0	0
Total gap length in scaffolds	0	0
Average gap length in scaffolds	0.00	0.00
Gap N50 in scaffolds	0	0
Gap auN in scaffolds	0.00	0.00
Gap L50 in scaffolds	0	0
Largest gap in scaffolds	0	0
Smallest gap in scaffolds	0	0
Base composition (A:C:G:T)	606,195:384,545:388,054:609,225	252,099:164,572:166,355:253,698
GC content %	38.86	39.55
# soft-masked bases	0	0
# segments	81	27
Total segment length	1,988,019	836,724
Average segment length	24,543.44	30,989.78
# gaps	0	0
# paths	81	27
# edges	4	.
Average degree	0.05	.
# connected components	1	.
Largest connected component length	89,366	.
# dead ends	159	.
# disconnected components	78	.
Total length disconnected components	1,898,653	.
# separated components	79	.
# bubbles	0	.
# circular segments	0	.
# circular paths	0	.
Scaffold N10	93,875	132,684
Scaffold N20	39,024	93,875
Scaffold N30	26,760	46,449
Scaffold N40	24,154	43,611
Scaffold N50	22,011	31,085
Scaffold N50	22,011	31,085
Scaffold N60	20,442	24,012
Scaffold N70	19,760	21,778
Scaffold N80	19,051	19,871
Scaffold N90	17,544	17,885
Scaffold N100	15,406	16,240
Scaffold L10	2	1
Scaffold L20	6	2
Scaffold L30	13	3
Scaffold L40	21	5
Scaffold L50	29	7
Scaffold L50	29	7
Scaffold L60	39	11
Scaffold L70	49	14
Scaffold L80	59	18
Scaffold L90	70	23
Scaffold L100	81	27
Scaffold NG10	46,449	46,449
Scaffold NG20	33,978	24,991
Scaffold NG30	25,221	19,760
Scaffold NG40	23,338	0
Scaffold NG50	20,749	0
Scaffold NG50	20,749	0
Scaffold NG60	19,814	0
Scaffold NG70	19,045	0
Scaffold NG80	17,501	0
Scaffold NG90	0	0
Scaffold NG100	0	0
Scaffold LG10	3	3
Scaffold LG20	8	9
Scaffold LG30	16	19
Scaffold LG40	26	0
Scaffold LG50	36	0
Scaffold LG50	36	0
Scaffold LG60	48	0
Scaffold LG70	60	0
Scaffold LG80	72	0
Scaffold LG90	0	0
Scaffold LG100	0	0
Contig N10	93,875	132,684
Contig N20	39,024	93,875
Contig N30	26,760	46,449
Contig N40	24,154	43,611
Contig N50	22,011	31,085
Contig N50	22,011	31,085
Contig N60	20,442	24,012
Contig N70	19,760	21,778
Contig N80	19,051	19,871
Contig N90	17,544	17,885
Contig N100	15,406	16,240
Contig L10	2	1
Contig L20	6	2
Contig L30	13	3
Contig L40	21	5
Contig L50	29	7
Contig L50	29	7
Contig L60	39	11
Contig L70	49	14
Contig L80	59	18
Contig L90	70	23
Contig L100	81	27
Contig NG10	46,449	46,449
Contig NG20	33,978	24,991
Contig NG30	25,221	19,760
Contig NG40	23,338	0
Contig NG50	20,749	0
Contig NG50	20,749	0
Contig NG60	19,814	0
Contig NG70	19,045	0
Contig NG80	17,501	0
Contig NG90	0	0
Contig NG100	0	0
Contig LG10	3	3
Contig LG20	8	9
Contig LG30	16	19
Contig LG40	26	0
Contig LG50	36	0
Contig LG50	36	0
Contig LG60	48	0
Contig LG70	60	0
Contig LG80	72	0
Contig LG90	0	0
Contig LG100	0	0
Gap N10	0	0
Gap N20	0	0
Gap N30	0	0
Gap N40	0	0
Gap N50	0	0
Gap N60	0	0
Gap N70	0	0
Gap N80	0	0
Gap N90	0	0
Gap N100	0	0
Gap L10	0	0
Gap L20	0	0
Gap L30	0	0
Gap L40	0	0
Gap L50	0	0
Gap L60	0	0
Gap L70	0	0
Gap L80	0	0
Gap L90	0	0
Gap L100	0	0
')

Output with path /tmp/tmp3_ql6hsw/usable hap1 gfa__b91df70d-8082-433c-b29f-286cc033003a different than expected
Expected 175+-0 lines in the output found 167

Output with path /tmp/tmpdtieufxx/Hifiasm Trio hap1__e2c03563-0457-4264-a408-987ff94854ad different than expected
Expected 170+-0 lines in the output found 162

Output with path /tmp/tmpc4a2krj1/Busco on data 40 short summary__7a7f7331-754b-4454-8007-1ba85ebe560d different than expected
Expected text 'C:1.2%[S:1.2%,D:0.0%],F:0.4%,M:98.4%,n:3354' in output ('# BUSCO version is: 5.8.0 
# The lineage dataset is: vertebrata_odb10 (Creation date: 2021-02-19, number of genomes: 67, number of BUSCOs: 3354)
# Summarized benchmarking in BUSCO notation for file /tmp/tmpncnnfuyd/files/e/2/c/dataset_e2c03563-0457-4264-a408-987ff94854ad.dat
# BUSCO was run in mode: euk_genome_min
# Gene predictor used: miniprot

	***** Results: *****

	C:1.1%[S:1.1%,D:0.0%],F:0.1%,M:98.7%,n:3354,E:5.3%	   
	38	Complete BUSCOs (C)	(of which 2 contain internal stop codons)		   
	37	Complete and single-copy BUSCOs (S)	   
	1	Complete and duplicated BUSCOs (D)	   
	4	Fragmented BUSCOs (F)			   
	3312	Missing BUSCOs (M)			   
	3354	Total BUSCO groups searched		   

Assembly Statistics:
	81	Number of scaffolds
	81	Number of contigs
	1988019	Total length
	0.000%	Percent gaps
	22 KB	Scaffold N50
	22 KB	Contigs N50


Dependencies and versions:
	hmmsearch: 3.4
	bbtools: None
	miniprot_index: 0.13-r248
	miniprot_align: 0.13-r248
	python: sys.version_info(major=3, minor=10, micro=15, releaselevel='final', serial=0)
	busco: 5.8.0
')

Workflow invocation details

Invocation Messages

Steps

Step 1: Pacbio Reads Collection : child:
- step_state: scheduled
Step 2: Paternal Illumina reads (hap1):
- step_state: scheduled
Step 11: Genomescope Model Parameters:
- step_state: scheduled
Step 12: Genomescope Summary:
- step_state: scheduled
Step 13: Utilize homology information to correct trio-phasing errors:
- step_state: scheduled
Step 14: SAK input file (Optional):
- step_state: scheduled
Step 15: Name for Haplotype 1:
- step_state: scheduled
Step 16: Name for Haplotype 2:
- step_state: scheduled

Step 17: toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.9+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -f -s '/tmp/tmpncnnfuyd/files/c/f/4/dataset_cf479c8f-37c0-491c-ad73-8dc3d356839d.dat' 'yeast_reads_sub1_fastq_gz.fq.gz' &&  cutadapt  -j=${GALAXY_SLOTS:-4}   -b 'ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT'   -b 'ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT'    --error-rate=0.1 --times=1 --overlap=35    --action=trim --rc     --discard-trimmed   --minimum-length=1      --json=stats.json -o 'out1.fq.gz'  'yeast_reads_sub1_fastq_gz.fq.gz'  > report.txt

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"507b23709a6511efbdb11d9d2ea5f43f"`
adapter_options	`{"action": "trim", "error_rate": "0.1", "match_read_wildcards": false, "no_indels": false, "no_match_adapter_wildcards": true, "overlap": "35", "revcomp": true, "times": "1"}`
chromInfo	`"/tmp/tmpncnnfuyd/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter_options	`{"discard_casava": false, "discard_trimmed": true, "discard_untrimmed": false, "max_average_error_rate": null, "max_expected_errors": null, "max_n": null, "maximum_length": null, "maximum_length2": null, "minimum_length": "1", "minimum_length2": null, "pair_filter": "any"}`
library	{"__current_case__": 0, "input_1": {"values": [{"id": 1, "src": "dce"}]}, "r1": {"adapters": [], "anywhere_adapters": [{"__index__": 0, "adapter_source": {"__current_case__": 0, "adapter": "ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT", "adapter_name": "", "adapter_source_list": "user"}, "single_noindels": false}, {"__index__": 1, "adapter_source": {"__current_case__": 0, "adapter": "ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT", "adapter_name": "", "adapter_source_list": "user"}, "single_noindels": false}], "front_adapters": []}, "type": "single"}
other_trimming_options	`{"cut": "0", "cut2": "0", "nextseq_trim": "0", "poly_a": false, "quality_cutoff": "0", "quality_cutoff2": "", "shorten_options": {"__current_case__": 1, "shorten_values": "False"}, "shorten_options_r2": {"__current_case__": 1, "shorten_values_r2": "False"}, "trim_n": false}`
output_selector	`["json_stats", "report"]`
read_mod_options	`{"length_tag": "", "rename": "", "strip_suffix": "", "zero_cap": false}`

Step 18: toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types float,float,float,float,float,int  --file '/tmp/tmpncnnfuyd/job_working_directory/000/12/configs/tmpmz5fyngo' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmpncnnfuyd/files/3/6/e/dataset_36e4aff7-efa1-4b08-8909-b9e66cd98069.dat' '/tmp/tmpncnnfuyd/job_working_directory/000/12/outputs/dataset_a1eb572f-1594-4f91-8932-ea69c1ce93ef.dat'

Exit Code:

```
0
```

Standard Output:

c3*2
Computing 1 new columns with instructions ['c3*2;;']
Computed new column values for 100.00% of 1 lines written.

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"507b23709a6511efbdb11d9d2ea5f43f"`
avoid_scientific_notation	`false`
chromInfo	`"/tmp/tmpncnnfuyd/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
error_handling	`{"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}}`
ops	`{"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3*2"}], "header_lines_select": "no"}`

Step 19: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

grep -G -A 0 -B 0 --no-group-separator  -i -- 'Haploid' '/tmp/tmpncnnfuyd/files/0/7/3/dataset_0738707a-a88a-41cc-9976-1fba0fcde713.dat' > '/tmp/tmpncnnfuyd/job_working_directory/000/13/outputs/dataset_9db58a97-543d-4e32-8f11-caaa63c51329.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"507b23709a6511efbdb11d9d2ea5f43f"`
case_sensitive	`"-i"`
chromInfo	`"/tmp/tmpncnnfuyd/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
color	`"NOCOLOR"`
dbkey	`"?"`
invert	`""`
lines_after	`"0"`
lines_before	`"0"`
regex_type	`"-G"`
url_paste	`"Haploid"`

Step 20: toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

die() { echo "$@" 1>&2 ; exit 1; } &&  mkdir multiqc_WDir &&   mkdir multiqc_WDir/cutadapt_0 &&     ln -s '/tmp/tmpncnnfuyd/files/4/6/0/dataset_4607f053-1225-4f45-aae8-57f5e9bcf64d.dat' 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' && sed -i.old 's/You are running/This is/' 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' && grep -q "This is cutadapt" 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' || die "'This is cutadapt' or 'You are running cutadapt' not found in the file" &&   multiqc multiqc_WDir --filename 'report'       && mkdir -p ./plots && ls -l ./report_data/ && cp ./report_data/*plot*.txt ./plots/ | true

Exit Code:

```
0
```

Standard Error:

/// MultiQC 🔍 v1.24.1

     version_check | MultiQC Version v1.25.1 now available!
       file_search | Search path: /tmp/tmpncnnfuyd/job_working_directory/000/14/working/multiqc_WDir

          cutadapt | Found 1 reports

     write_results | Data        : report_data
     write_results | Report      : report.html
           multiqc | MultiQC complete

Standard Output:

total 72
-rw-r--r-- 1 1001 127    93 Nov  4 04:30 cutadapt_filtered_reads_plot.txt
-rw-r--r-- 1 1001 127    66 Nov  4 04:30 cutadapt_trimmed_sequences_plot_default_Counts.txt
-rw-r--r-- 1 1001 127    70 Nov  4 04:30 cutadapt_trimmed_sequences_plot_default_Obs_Exp.txt
-rw-r--r-- 1 1001 127   124 Nov  4 04:30 multiqc_citations.txt
-rw-r--r-- 1 1001 127   222 Nov  4 04:30 multiqc_cutadapt.txt
-rw-r--r-- 1 1001 127 39114 Nov  4 04:30 multiqc_data.json
-rw-r--r-- 1 1001 127   105 Nov  4 04:30 multiqc_general_stats.txt
-rw-r--r-- 1 1001 127    29 Nov  4 04:30 multiqc_software_versions.txt
-rw-r--r-- 1 1001 127   194 Nov  4 04:30 multiqc_sources.txt

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"507b23709a6511efbdb11d9d2ea5f43f"`
chromInfo	`"/tmp/tmpncnnfuyd/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
comment	`""`
dbkey	`"?"`
export	`false`
flat	`false`
results	`[{"__index__": 0, "software_cond": {"__current_case__": 5, "input": {"values": [{"id": 5, "src": "hdca"}]}, "software": "cutadapt"}}]`
saveLog	`"false"`
title	`""`

Step 3: Maternal Illumina reads (hap2):
- step_state: scheduled

Step 21: Cut1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl '/tmp/tmpncnnfuyd/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpncnnfuyd/files/a/1/e/dataset_a1eb572f-1594-4f91-8932-ea69c1ce93ef.dat' 'c7' T '/tmp/tmpncnnfuyd/job_working_directory/000/15/outputs/dataset_ad74e882-e4c4-4ce7-893e-98b29362c3c2.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"507b23709a6511efbdb11d9d2ea5f43f"`
chromInfo	`"/tmp/tmpncnnfuyd/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
columnList	`"c7"`
dbkey	`"?"`
delimiter	`"T"`

Step 22: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

sed -r --sandbox -e 's/bp//g' -e 's/,//g' -e 's/([a-z])\s+([A-Z])/\1_\2/g' '/tmp/tmpncnnfuyd/files/9/d/b/dataset_9db58a97-543d-4e32-8f11-caaa63c51329.dat' > '/tmp/tmpncnnfuyd/job_working_directory/000/16/outputs/dataset_95630c29-7447-4377-a874-5688c0e0644f.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"507b23709a6511efbdb11d9d2ea5f43f"`
chromInfo	`"/tmp/tmpncnnfuyd/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
replacements	`[{"__index__": 0, "find_pattern": "bp", "replace_pattern": ""}, {"__index__": 1, "find_pattern": ",", "replace_pattern": ""}, {"__index__": 2, "find_pattern": "([a-z])\\s+([A-Z])", "replace_pattern": "\\1_\\2"}]`

Step 23: param_value_from_file:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"507b23709a6511efbdb11d9d2ea5f43f"`
chromInfo	`"/tmp/tmpncnnfuyd/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
param_type	`"integer"`
remove_newlines	`true`

Step 24: Convert characters1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python /tmp/tmpncnnfuyd/galaxy-dev/tools/filters/convert_characters.py --strip --condense /tmp/tmpncnnfuyd/files/9/5/6/dataset_95630c29-7447-4377-a874-5688c0e0644f.dat s /tmp/tmpncnnfuyd/job_working_directory/000/18/outputs/dataset_03927088-d6bf-4126-a01b-e53a1bcea1ed.dat

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"txt"`
__workflow_invocation_uuid__	`"507b23709a6511efbdb11d9d2ea5f43f"`
chromInfo	`"/tmp/tmpncnnfuyd/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
condense	`true`
convert_from	`"s"`
dbkey	`"?"`
strip	`true`

Step 25: Homozygous read coverage for Hifiasm:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"507b23709a6511efbdb11d9d2ea5f43f"`
chromInfo	`"/tmp/tmpncnnfuyd/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
style_cond	`{"__current_case__": 0, "pick_style": "first", "type_cond": {"__current_case__": 1, "param_type": "integer", "pick_from": [{"__index__": 0, "value": null}, {"__index__": 1, "value": "21"}]}}`

Step 26: Cut1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl '/tmp/tmpncnnfuyd/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpncnnfuyd/files/0/3/9/dataset_03927088-d6bf-4126-a01b-e53a1bcea1ed.dat' 'c3' T '/tmp/tmpncnnfuyd/job_working_directory/000/19/outputs/dataset_fbc9239b-01b4-4b31-a15c-791e27e538eb.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"507b23709a6511efbdb11d9d2ea5f43f"`
chromInfo	`"/tmp/tmpncnnfuyd/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
columnList	`"c3"`
dbkey	`"?"`
delimiter	`"T"`

Step 27: toolshed.g2.bx.psu.edu/repos/bgruening/hifiasm/hifiasm/0.20.0+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -s '/tmp/tmpncnnfuyd/files/8/e/d/dataset_8eddb360-e632-415e-a450-ca30be5ddbfd.dat' input_0.fastq.gz &&  ln -s '/tmp/tmpncnnfuyd/files/c/1/9/dataset_c198a101-ec3f-4c91-9c5d-6de7e554f295.dat' hap1_input_0.fastqsanger &&  ln -s '/tmp/tmpncnnfuyd/files/0/2/e/dataset_02e36bab-d5a8-4a85-b644-faa7085a1752.dat' hap1_input_1.fastqsanger &&  ln -s '/tmp/tmpncnnfuyd/files/7/7/5/dataset_775aa54a-c03c-4954-8745-886de428e5c6.dat' hap2_input_0.fastqsanger &&  ln -s '/tmp/tmpncnnfuyd/files/a/2/4/dataset_a2465d4b-a7e3-4b13-97c4-ee9c6e5f08dd.dat' hap2_input_1.fastqsanger &&  yak count -k31 -b32 -t${GALAXY_SLOTS:-1} -o hap1.yak hap1_input_0.fastqsanger hap1_input_1.fastqsanger && yak count -k31 -b32 -t${GALAXY_SLOTS:-1} -o hap2.yak hap2_input_0.fastqsanger hap2_input_1.fastqsanger && hifiasm -t ${GALAXY_SLOTS:-1} -o output -f 32 -a 4 -z 0 -m 10000000 -p 100000 -n 3 -x 0.8 -y 0.2   --hom-cov 21 -1 hap1.yak -2 hap2.yak -c 2 -d 5 --trio-dual    --primary input_0.fastq.gz 2> output.log  && mkdir noseq_files && mv *.noseq.gfa noseq_files

Exit Code:

```
0
```

Standard Error:

[M::worker_pipeline::0.271*1.00] processed 10 sequences; 0 distinct k-mers in the hash table
[M::worker_pipeline::0.328*1.00] processed 10 sequences; 0 distinct k-mers in the hash table
[M::main_count] 0 distinct k-mers after shrinking
[M::yak_ch_dump] dumpped the hash table to file 'hap1.yak'.
[M::main] Version: 0.1-r69-dirty
[M::main] CMD: yak count -k31 -b32 -t1 -o hap1.yak hap1_input_0.fastqsanger hap1_input_1.fastqsanger
[M::main] Real time: 0.329 sec; CPU: 0.329 sec; Peak RSS: 0.506 GB
[M::worker_pipeline::0.263*0.99] processed 10 sequences; 0 distinct k-mers in the hash table
[M::worker_pipeline::0.327*0.95] processed 10 sequences; 0 distinct k-mers in the hash table
[M::main_count] 0 distinct k-mers after shrinking
[M::yak_ch_dump] dumpped the hash table to file 'hap2.yak'.
[M::main] Version: 0.1-r69-dirty
[M::main] CMD: yak count -k31 -b32 -t1 -o hap2.yak hap2_input_0.fastqsanger hap2_input_1.fastqsanger
[M::main] Real time: 0.338 sec; CPU: 0.312 sec; Peak RSS: 0.506 GB

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"fastq.gz"`
__workflow_invocation_uuid__	`"507b23709a6511efbdb11d9d2ea5f43f"`
advanced_options	`{"__current_case__": 0, "advanced_selector": "blank"}`
assembly_options	`{"__current_case__": 1, "adapter_length": "0", "assembly_selector": "set", "cleaning_rounds": "4", "disable_post_join": false, "hom_cov": "21", "ignore_error_corrected": false, "max_overlap": "0.8", "min_overlap": "0.2", "pop_contigs": "10000000", "pop_unitigs": "100000", "remove_tips": "3"}`
bins_out	`false`
chromInfo	`"/tmp/tmpncnnfuyd/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter_bits	`"32"`
hic_partition	`{"__current_case__": 0, "hic_partition_selector": "blank"}`
log_out	`true`
mode	`{"__current_case__": 1, "max_kmers": "2", "min_kmers": "5", "mode_selector": "trio", "reads": {"values": [{"id": 4, "src": "hdca"}]}, "trio_dual": true, "trioinput": {"__current_case__": 0, "hap1_reads": {"values": [{"id": 2, "src": "hdca"}]}, "hap2_reads": {"values": [{"id": 3, "src": "hdca"}]}, "trio_input_selector": "reads"}, "yak_kmer_length": "31"}`
ont_integration	`{"__current_case__": 0, "ont_integration_selector": "blank"}`
purge_options	`{"__current_case__": 0, "purge_selector": "blank"}`
scaffolding_options	`{"__current_case__": 0, "scaffold_selector": "blank"}`

Step 28: Estimated genome size:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"507b23709a6511efbdb11d9d2ea5f43f"`
chromInfo	`"/tmp/tmpncnnfuyd/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
param_type	`"integer"`
remove_newlines	`true`

Step 29: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmpncnnfuyd/files/4/e/b/dataset_4eb140d0-45ef-45b7-9c32-7368c1b7e965.dat' --discover-paths  -o dataset.gfa --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset

Exit Code:

```
0
```

Standard Output:

+++Assembly summary+++: 
# scaffolds: 81
Total scaffold length: 1988019
Average scaffold length: 24543.44
Scaffold N50: 22011
Scaffold auN: 34607.62
Scaffold L50: 29
Largest scaffold: 132684
Smallest scaffold: 15406
# contigs: 81
Total contig length: 1988019
Average contig length: 24543.44
Contig N50: 22011
Contig auN: 34607.62
Contig L50: 29
Largest contig: 132684
Smallest contig: 15406
# gaps in scaffolds: 0
Total gap length in scaffolds: 0
Average gap length in scaffolds: 0.00
Gap N50 in scaffolds: 0
Gap auN in scaffolds: 0.00
Gap L50 in scaffolds: 0
Largest gap in scaffolds: 0
Smallest gap in scaffolds: 0
Base composition (A:C:G:T): 606195:384545:388054:609225
GC content %: 38.86
# soft-masked bases: 0
# segments: 81
Total segment length: 1988019
Average segment length: 24543.44
# gaps: 0
# paths: 81
# edges: 4
Average degree: 0.05
# connected components: 1
Largest connected component length: 89366
# dead ends: 159
# disconnected components: 78
Total length disconnected components: 1898653
# separated components: 79
# bubbles: 0
# circular segments: 0
# circular paths: 0

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"507b23709a6511efbdb11d9d2ea5f43f"`
chromInfo	`"/tmp/tmpncnnfuyd/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 4, "out_format": "gfa", "terminal_overlaps_condition": {"__current_case__": 0, "terminal_overlaps_select": "no"}}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 30: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmpncnnfuyd/files/4/3/0/dataset_4301c725-2a72-4dd5-b40a-83dbafa5ff4b.dat' --discover-paths  -o dataset.gfa --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset

Exit Code:

```
0
```

Standard Output:

+++Assembly summary+++: 
# scaffolds: 27
Total scaffold length: 836724
Average scaffold length: 30989.78
Scaffold N50: 31085
Scaffold auN: 51544.22
Scaffold L50: 7
Largest scaffold: 132684
Smallest scaffold: 16240
# contigs: 27
Total contig length: 836724
Average contig length: 30989.78
Contig N50: 31085
Contig auN: 51544.22
Contig L50: 7
Largest contig: 132684
Smallest contig: 16240
# gaps in scaffolds: 0
Total gap length in scaffolds: 0
Average gap length in scaffolds: 0.00
Gap N50 in scaffolds: 0
Gap auN in scaffolds: 0.00
Gap L50 in scaffolds: 0
Largest gap in scaffolds: 0
Smallest gap in scaffolds: 0
Base composition (A:C:G:T): 252099:164572:166355:253698
GC content %: 39.55
# soft-masked bases: 0
# segments: 27
Total segment length: 836724
Average segment length: 30989.78
# gaps: 0
# paths: 27

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"507b23709a6511efbdb11d9d2ea5f43f"`
chromInfo	`"/tmp/tmpncnnfuyd/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 4, "out_format": "gfa", "terminal_overlaps_condition": {"__current_case__": 0, "terminal_overlaps_select": "no"}}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 4: Meryl Database : Child:
- step_state: scheduled

Step 31: Raw Unitig Image:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -s '/tmp/tmpncnnfuyd/files/c/9/0/dataset_c9024b80-7901-43f0-95ca-3d263f3508af.dat' input.gfa &&  export QT_QPA_PLATFORM='offscreen' && Bandage image input.gfa 'out.png' --height '2000' --nodewidth '25.0'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"507b23709a6511efbdb11d9d2ea5f43f"`
chromInfo	`"/tmp/tmpncnnfuyd/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
fontsize	`None`
height	`"2000"`
lengths	`false`
names	`false`
nodewidth	`"25.0"`
output_format	`"png"`
width	`None`

Step 32: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmpncnnfuyd/files/4/e/b/dataset_4eb140d0-45ef-45b7-9c32-7368c1b7e965.dat' --discover-paths  -o dataset.fasta --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset

Exit Code:

```
0
```

Standard Output:

+++Assembly summary+++: 
# scaffolds: 81
Total scaffold length: 1988019
Average scaffold length: 24543.44
Scaffold N50: 22011
Scaffold auN: 34607.62
Scaffold L50: 29
Largest scaffold: 132684
Smallest scaffold: 15406
# contigs: 81
Total contig length: 1988019
Average contig length: 24543.44
Contig N50: 22011
Contig auN: 34607.62
Contig L50: 29
Largest contig: 132684
Smallest contig: 15406
# gaps in scaffolds: 0
Total gap length in scaffolds: 0
Average gap length in scaffolds: 0.00
Gap N50 in scaffolds: 0
Gap auN in scaffolds: 0.00
Gap L50 in scaffolds: 0
Largest gap in scaffolds: 0
Smallest gap in scaffolds: 0
Base composition (A:C:G:T): 606195:384545:388054:609225
GC content %: 38.86
# soft-masked bases: 0
# segments: 81
Total segment length: 1988019
Average segment length: 24543.44
# gaps: 0
# paths: 81
# edges: 4
Average degree: 0.05
# connected components: 1
Largest connected component length: 89366
# dead ends: 159
# disconnected components: 78
Total length disconnected components: 1898653
# separated components: 79
# bubbles: 0
# circular segments: 0
# circular paths: 0

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"507b23709a6511efbdb11d9d2ea5f43f"`
chromInfo	`"/tmp/tmpncnnfuyd/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 0, "line_length": null, "out_format": "fasta"}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 33: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmpncnnfuyd/files/4/3/0/dataset_4301c725-2a72-4dd5-b40a-83dbafa5ff4b.dat' --discover-paths  -o dataset.fasta --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset

Exit Code:

```
0
```

Standard Output:

+++Assembly summary+++: 
# scaffolds: 27
Total scaffold length: 836724
Average scaffold length: 30989.78
Scaffold N50: 31085
Scaffold auN: 51544.22
Scaffold L50: 7
Largest scaffold: 132684
Smallest scaffold: 16240
# contigs: 27
Total contig length: 836724
Average contig length: 30989.78
Contig N50: 31085
Contig auN: 51544.22
Contig L50: 7
Largest contig: 132684
Smallest contig: 16240
# gaps in scaffolds: 0
Total gap length in scaffolds: 0
Average gap length in scaffolds: 0.00
Gap N50 in scaffolds: 0
Gap auN in scaffolds: 0.00
Gap L50 in scaffolds: 0
Largest gap in scaffolds: 0
Smallest gap in scaffolds: 0
Base composition (A:C:G:T): 252099:164572:166355:253698
GC content %: 39.55
# soft-masked bases: 0
# segments: 27
Total segment length: 836724
Average segment length: 30989.78
# gaps: 0
# paths: 27

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"507b23709a6511efbdb11d9d2ea5f43f"`
chromInfo	`"/tmp/tmpncnnfuyd/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 0, "line_length": null, "out_format": "fasta"}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 34: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmpncnnfuyd/files/4/e/b/dataset_4eb140d0-45ef-45b7-9c32-7368c1b7e965.dat' --out-size c  --discover-paths --tabular > '/tmp/tmpncnnfuyd/job_working_directory/000/28/outputs/dataset_2b60c51c-9fb1-4c4d-8a21-f47ba8ffe134.dat' --threads ${GALAXY_SLOTS:-8}

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"507b23709a6511efbdb11d9d2ea5f43f"`
chromInfo	`"/tmp/tmpncnnfuyd/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 1, "discover_paths": true, "locale": false, "selector": "statistics", "statistics_condition": {"__current_case__": 0, "out_size": "c", "selector": "size"}, "tabular": true}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 35: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmpncnnfuyd/files/4/3/0/dataset_4301c725-2a72-4dd5-b40a-83dbafa5ff4b.dat' --out-size c  --discover-paths --tabular > '/tmp/tmpncnnfuyd/job_working_directory/000/29/outputs/dataset_b0afe846-9a72-4db8-925a-de4bd194daaf.dat' --threads ${GALAXY_SLOTS:-8}

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"507b23709a6511efbdb11d9d2ea5f43f"`
chromInfo	`"/tmp/tmpncnnfuyd/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 1, "discover_paths": true, "locale": false, "selector": "statistics", "statistics_condition": {"__current_case__": 0, "out_size": "c", "selector": "size"}, "tabular": true}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 36: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmpncnnfuyd/files/4/3/0/dataset_4301c725-2a72-4dd5-b40a-83dbafa5ff4b.dat' 2288021 --nstar-report --locale en_US.UTF-8 --discover-paths --tabular > '/tmp/tmpncnnfuyd/job_working_directory/000/30/outputs/dataset_03069ad0-644d-4f25-bafd-9f2e181effb9.dat' --threads ${GALAXY_SLOTS:-8}

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"507b23709a6511efbdb11d9d2ea5f43f"`
chromInfo	`"/tmp/tmpncnnfuyd/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 1, "discover_paths": true, "locale": true, "selector": "statistics", "statistics_condition": {"__current_case__": 2, "expected_genomesize": "2288021", "selector": "assembly"}, "tabular": true}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 37: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmpncnnfuyd/files/4/e/b/dataset_4eb140d0-45ef-45b7-9c32-7368c1b7e965.dat' 2288021 --nstar-report --locale en_US.UTF-8 --discover-paths --tabular > '/tmp/tmpncnnfuyd/job_working_directory/000/31/outputs/dataset_f5e0655a-4ee0-4688-a010-f38a9f1e3cd9.dat' --threads ${GALAXY_SLOTS:-8}

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"507b23709a6511efbdb11d9d2ea5f43f"`
chromInfo	`"/tmp/tmpncnnfuyd/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 1, "discover_paths": true, "locale": true, "selector": "statistics", "statistics_condition": {"__current_case__": 2, "expected_genomesize": "2288021", "selector": "assembly"}, "tabular": true}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 38: toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.8.0+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

busco --in '/tmp/tmpncnnfuyd/files/e/2/c/dataset_e2c03563-0457-4264-a408-987ff94854ad.dat' --mode 'geno' --out busco_galaxy --cpu ${GALAXY_SLOTS:-4} --evalue 0.001 --limit 3 --contig_break 10  --offline --download_path /cvmfs/data.galaxyproject.org/byhand/busco/v5  --lineage_dataset 'vertebrata_odb10'  --miniprot  && mkdir BUSCO_summaries && ls -l busco_galaxy/run_*/ && cp busco_galaxy/short_summary.*.txt BUSCO_summaries/ && generate_plot.py -wd BUSCO_summaries -rt specific  && echo "##gff-version 3" > busco_output.gff && cat busco_galaxy/run_*/busco_sequences/*busco_sequences/*.gff >> busco_output.gff 2> /dev/null || true

Exit Code:

```
0
```

Standard Error:

2024-11-04 04:53:54 ERROR:	
Warning message:
The `size` argument of `element_line()` is deprecated as of ggplot2 3.4.0.
ℹ Please use the `linewidth` argument instead.

Standard Output:

2024-11-04 04:35:37 INFO:	***** Start a BUSCO v5.8.0 analysis, current time: 11/04/2024 04:35:37 *****
2024-11-04 04:35:37 INFO:	Configuring BUSCO with local environment
2024-11-04 04:35:37 INFO:	Running genome mode
2024-11-04 04:35:39 INFO:	Input file is /tmp/tmpncnnfuyd/files/e/2/c/dataset_e2c03563-0457-4264-a408-987ff94854ad.dat
2024-11-04 04:35:45 WARNING:	Option evalue was provided but is not used in the selected run mode, euk_genome_min
2024-11-04 04:35:45 WARNING:	Option limit was provided but is not used in the selected run mode, euk_genome_min
2024-11-04 04:35:46 INFO:	Running BUSCO using lineage dataset vertebrata_odb10 (eukaryota, 2021-02-19)
2024-11-04 04:35:46 INFO:	Running 1 job(s) on bbtools, starting at 11/04/2024 04:35:46
2024-11-04 04:35:47 INFO:	[bbtools]	1 of 1 task(s) completed
2024-11-04 04:35:47 INFO:	Running 1 job(s) on miniprot_index, starting at 11/04/2024 04:35:47
2024-11-04 04:35:48 INFO:	[miniprot_index]	1 of 1 task(s) completed
2024-11-04 04:35:48 INFO:	Running 1 job(s) on miniprot_align, starting at 11/04/2024 04:35:48
2024-11-04 04:53:14 INFO:	[miniprot_align]	1 of 1 task(s) completed
2024-11-04 04:53:20 INFO:	***** Run HMMER on gene sequences *****
2024-11-04 04:53:21 INFO:	Running 617 job(s) on hmmsearch, starting at 11/04/2024 04:53:21
2024-11-04 04:53:26 INFO:	[hmmsearch]	62 of 617 task(s) completed
2024-11-04 04:53:29 INFO:	[hmmsearch]	124 of 617 task(s) completed
2024-11-04 04:53:32 INFO:	[hmmsearch]	186 of 617 task(s) completed
2024-11-04 04:53:34 INFO:	[hmmsearch]	247 of 617 task(s) completed
2024-11-04 04:53:37 INFO:	[hmmsearch]	309 of 617 task(s) completed
2024-11-04 04:53:40 INFO:	[hmmsearch]	371 of 617 task(s) completed
2024-11-04 04:53:42 INFO:	[hmmsearch]	432 of 617 task(s) completed
2024-11-04 04:53:45 INFO:	[hmmsearch]	494 of 617 task(s) completed
2024-11-04 04:53:48 INFO:	[hmmsearch]	556 of 617 task(s) completed
2024-11-04 04:53:50 INFO:	[hmmsearch]	617 of 617 task(s) completed
2024-11-04 04:53:50 INFO:	48 exons in total
2024-11-04 04:53:50 WARNING:	2 of 38 Complete matches (5.3%) contain internal stop codons in Miniprot gene predictions
2024-11-04 04:53:50 WARNING:	BUSCO gene predictions from Miniprot have low average identity (0.46). You may want to repeat the analysis using the Metaeuk pipeline.
2024-11-04 04:53:51 INFO:	

    -------------------------------------------------------------------------------------------
    |Results from dataset vertebrata_odb10                                                     |
    -------------------------------------------------------------------------------------------
    |C:1.1%[S:1.1%,D:0.0%],F:0.1%,M:98.7%,n:3354,E:5.3%                                        |
    |38    Complete BUSCOs (C)    (of which 2 contain internal stop codons)                    |
    |37    Complete and single-copy BUSCOs (S)                                                 |
    |1    Complete and duplicated BUSCOs (D)                                                   |
    |4    Fragmented BUSCOs (F)                                                                |
    |3312    Missing BUSCOs (M)                                                                |
    |3354    Total BUSCO groups searched                                                       |
    -------------------------------------------------------------------------------------------
2024-11-04 04:53:51 INFO:	BUSCO analysis done with WARNING(s). Total running time: 1091 seconds

***** Summary of warnings: *****
2024-11-04 04:35:45 WARNING:busco.BuscoConfig	Option evalue was provided but is not used in the selected run mode, euk_genome_min
2024-11-04 04:35:45 WARNING:busco.BuscoConfig	Option limit was provided but is not used in the selected run mode, euk_genome_min
2024-11-04 04:53:50 WARNING:busco.busco_tools.hmmer	2 of 38 Complete matches (5.3%) contain internal stop codons in Miniprot gene predictions
2024-11-04 04:53:50 WARNING:busco.busco_tools.hmmer	BUSCO gene predictions from Miniprot have low average identity (0.46). You may want to repeat the analysis using the Metaeuk pipeline.

2024-11-04 04:53:51 INFO:	Results written in /tmp/tmpncnnfuyd/job_working_directory/000/32/working/busco_galaxy
2024-11-04 04:53:51 INFO:	For assistance with interpreting the results, please consult the userguide: https://busco.ezlab.org/busco_userguide.html

2024-11-04 04:53:51 INFO:	Visit this page https://gitlab.com/ezlab/busco#how-to-cite-busco to see how to cite BUSCO
total 156
drwxr-xr-x 5 1001 127  4096 Nov  4 04:35 busco_sequences
-rw-r--r-- 1 1001 127 75300 Nov  4 04:53 full_table.tsv
drwxr-xr-x 2 1001 127 20480 Nov  4 04:53 hmmer_output
drwxr-xr-x 3 1001 127  4096 Nov  4 04:53 miniprot_output
-rw-r--r-- 1 1001 127 42493 Nov  4 04:53 missing_busco_list.tsv
-rw-r--r-- 1 1001 127  2869 Nov  4 04:53 short_summary.json
-rw-r--r-- 1 1001 127  1051 Nov  4 04:53 short_summary.txt
2024-11-04 04:53:52 INFO:	****************** Start plot generation at 11/04/2024 04:53:52 ******************
2024-11-04 04:53:52 INFO:	Load data ...
2024-11-04 04:53:52 INFO:	Loaded BUSCO_summaries/short_summary.specific.vertebrata_odb10.busco_galaxy.txt successfully
2024-11-04 04:53:52 INFO:	Generate the R code ...
2024-11-04 04:53:52 INFO:	Run the R code ...
2024-11-04 04:53:54 INFO:	
[1] "Plotting the figure ..."
[1] "Done"

2024-11-04 04:53:54 INFO:	Plot generation done. Total running time: 2.1725406646728516 seconds
2024-11-04 04:53:54 INFO:	Results written in BUSCO_summaries/

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"507b23709a6511efbdb11d9d2ea5f43f"`
adv	`{"contig_break": "10", "evalue": "0.001", "limit": "3"}`
busco_mode	`{"__current_case__": 0, "mode": "geno", "use_augustus": {"__current_case__": 1, "use_augustus_selector": "miniprot"}}`
chromInfo	`"/tmp/tmpncnnfuyd/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
lineage	`{"__current_case__": 1, "lineage_dataset": "vertebrata_odb10", "lineage_mode": "select_lineage"}`
lineage_conditional	`{"__current_case__": 0, "cached_db": "v5", "selector": "cached"}`
outputs	`["short_summary", "missing", "image", "gff"]`

Step 39: toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.8.0+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

busco --in '/tmp/tmpncnnfuyd/files/f/d/d/dataset_fdd99b9d-ca60-4112-82a1-4b6ca0a70517.dat' --mode 'geno' --out busco_galaxy --cpu ${GALAXY_SLOTS:-4} --evalue 0.001 --limit 3 --contig_break 10  --offline --download_path /cvmfs/data.galaxyproject.org/byhand/busco/v5  --lineage_dataset 'vertebrata_odb10'  --miniprot  && mkdir BUSCO_summaries && ls -l busco_galaxy/run_*/ && cp busco_galaxy/short_summary.*.txt BUSCO_summaries/ && generate_plot.py -wd BUSCO_summaries -rt specific  && echo "##gff-version 3" > busco_output.gff && cat busco_galaxy/run_*/busco_sequences/*busco_sequences/*.gff >> busco_output.gff 2> /dev/null || true

Exit Code:

```
0
```

Standard Error:

2024-11-04 04:46:34 ERROR:	
Warning message:
The `size` argument of `element_line()` is deprecated as of ggplot2 3.4.0.
ℹ Please use the `linewidth` argument instead.

Standard Output:

2024-11-04 04:35:37 INFO:	***** Start a BUSCO v5.8.0 analysis, current time: 11/04/2024 04:35:37 *****
2024-11-04 04:35:37 INFO:	Configuring BUSCO with local environment
2024-11-04 04:35:37 INFO:	Running genome mode
2024-11-04 04:35:39 INFO:	Input file is /tmp/tmpncnnfuyd/files/f/d/d/dataset_fdd99b9d-ca60-4112-82a1-4b6ca0a70517.dat
2024-11-04 04:35:45 WARNING:	Option evalue was provided but is not used in the selected run mode, euk_genome_min
2024-11-04 04:35:45 WARNING:	Option limit was provided but is not used in the selected run mode, euk_genome_min
2024-11-04 04:35:46 INFO:	Running BUSCO using lineage dataset vertebrata_odb10 (eukaryota, 2021-02-19)
2024-11-04 04:35:46 INFO:	Running 1 job(s) on bbtools, starting at 11/04/2024 04:35:46
2024-11-04 04:35:47 INFO:	[bbtools]	1 of 1 task(s) completed
2024-11-04 04:35:47 INFO:	Running 1 job(s) on miniprot_index, starting at 11/04/2024 04:35:47
2024-11-04 04:35:48 INFO:	[miniprot_index]	1 of 1 task(s) completed
2024-11-04 04:35:48 INFO:	Running 1 job(s) on miniprot_align, starting at 11/04/2024 04:35:48
2024-11-04 04:45:51 INFO:	[miniprot_align]	1 of 1 task(s) completed
2024-11-04 04:45:53 INFO:	***** Run HMMER on gene sequences *****
2024-11-04 04:45:54 INFO:	Running 383 job(s) on hmmsearch, starting at 11/04/2024 04:45:54
2024-11-04 04:45:59 INFO:	[hmmsearch]	39 of 383 task(s) completed
2024-11-04 04:46:02 INFO:	[hmmsearch]	77 of 383 task(s) completed
2024-11-04 04:46:06 INFO:	[hmmsearch]	115 of 383 task(s) completed
2024-11-04 04:46:09 INFO:	[hmmsearch]	154 of 383 task(s) completed
2024-11-04 04:46:13 INFO:	[hmmsearch]	192 of 383 task(s) completed
2024-11-04 04:46:17 INFO:	[hmmsearch]	230 of 383 task(s) completed
2024-11-04 04:46:20 INFO:	[hmmsearch]	269 of 383 task(s) completed
2024-11-04 04:46:23 INFO:	[hmmsearch]	307 of 383 task(s) completed
2024-11-04 04:46:27 INFO:	[hmmsearch]	345 of 383 task(s) completed
2024-11-04 04:46:31 INFO:	[hmmsearch]	383 of 383 task(s) completed
2024-11-04 04:46:31 INFO:	14 exons in total
2024-11-04 04:46:31 WARNING:	1 of 10 Complete matches (10.0%) contain internal stop codons in Miniprot gene predictions
2024-11-04 04:46:31 INFO:	

    -------------------------------------------------------------------------------------------
    |Results from dataset vertebrata_odb10                                                     |
    -------------------------------------------------------------------------------------------
    |C:0.3%[S:0.3%,D:0.0%],F:0.0%,M:99.7%,n:3354,E:10.0%                                       |
    |10    Complete BUSCOs (C)    (of which 1 contain internal stop codons)                    |
    |9    Complete and single-copy BUSCOs (S)                                                  |
    |1    Complete and duplicated BUSCOs (D)                                                   |
    |1    Fragmented BUSCOs (F)                                                                |
    |3343    Missing BUSCOs (M)                                                                |
    |3354    Total BUSCO groups searched                                                       |
    -------------------------------------------------------------------------------------------
2024-11-04 04:46:31 INFO:	BUSCO analysis done with WARNING(s). Total running time: 652 seconds

***** Summary of warnings: *****
2024-11-04 04:35:45 WARNING:busco.BuscoConfig	Option evalue was provided but is not used in the selected run mode, euk_genome_min
2024-11-04 04:35:45 WARNING:busco.BuscoConfig	Option limit was provided but is not used in the selected run mode, euk_genome_min
2024-11-04 04:46:31 WARNING:busco.busco_tools.hmmer	1 of 10 Complete matches (10.0%) contain internal stop codons in Miniprot gene predictions

2024-11-04 04:46:31 INFO:	Results written in /tmp/tmpncnnfuyd/job_working_directory/000/33/working/busco_galaxy
2024-11-04 04:46:31 INFO:	For assistance with interpreting the results, please consult the userguide: https://busco.ezlab.org/busco_userguide.html

2024-11-04 04:46:31 INFO:	Visit this page https://gitlab.com/ezlab/busco#how-to-cite-busco to see how to cite BUSCO
total 152
drwxr-xr-x 5 1001 127  4096 Nov  4 04:35 busco_sequences
-rw-r--r-- 1 1001 127 71390 Nov  4 04:46 full_table.tsv
drwxr-xr-x 2 1001 127 20480 Nov  4 04:46 hmmer_output
drwxr-xr-x 3 1001 127  4096 Nov  4 04:45 miniprot_output
-rw-r--r-- 1 1001 127 42890 Nov  4 04:46 missing_busco_list.tsv
-rw-r--r-- 1 1001 127  2867 Nov  4 04:46 short_summary.json
-rw-r--r-- 1 1001 127  1050 Nov  4 04:46 short_summary.txt
2024-11-04 04:46:32 INFO:	****************** Start plot generation at 11/04/2024 04:46:32 ******************
2024-11-04 04:46:32 INFO:	Load data ...
2024-11-04 04:46:32 INFO:	Loaded BUSCO_summaries/short_summary.specific.vertebrata_odb10.busco_galaxy.txt successfully
2024-11-04 04:46:32 INFO:	Generate the R code ...
2024-11-04 04:46:32 INFO:	Run the R code ...
2024-11-04 04:46:34 INFO:	
[1] "Plotting the figure ..."
[1] "Done"

2024-11-04 04:46:34 INFO:	Plot generation done. Total running time: 2.2332518100738525 seconds
2024-11-04 04:46:34 INFO:	Results written in BUSCO_summaries/

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"507b23709a6511efbdb11d9d2ea5f43f"`
adv	`{"contig_break": "10", "evalue": "0.001", "limit": "3"}`
busco_mode	`{"__current_case__": 0, "mode": "geno", "use_augustus": {"__current_case__": 1, "use_augustus_selector": "miniprot"}}`
chromInfo	`"/tmp/tmpncnnfuyd/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
lineage	`{"__current_case__": 1, "lineage_dataset": "vertebrata_odb10", "lineage_mode": "select_lineage"}`
lineage_conditional	`{"__current_case__": 0, "cached_db": "v5", "selector": "cached"}`
outputs	`["short_summary", "missing", "image", "gff"]`

Step 40: toolshed.g2.bx.psu.edu/repos/iuc/merqury/merqury/1.3+galaxy4:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

mkdir -p output_files && mkdir -p read-db.meryl pat.meryl mat.meryl && tar -zxf /tmp/tmpncnnfuyd/files/6/5/6/dataset_6567178c-b9c3-42d8-9eb1-cc1de8f80aab.dat -C read-db.meryl --strip-components=1 && tar -zxf /tmp/tmpncnnfuyd/files/0/9/6/dataset_09688a6c-3827-4f69-9c5c-28bfbfafd46e.dat -C pat.meryl --strip-components=1 && tar -zxf /tmp/tmpncnnfuyd/files/2/b/a/dataset_2bae105f-5f0a-444d-bd50-c8ff40f57188.dat -C mat.meryl --strip-components=1 && ln -s '/tmp/tmpncnnfuyd/files/e/2/c/dataset_e2c03563-0457-4264-a408-987ff94854ad.dat' assembly_01.fasta && ln -s '/tmp/tmpncnnfuyd/files/f/d/d/dataset_fdd99b9d-ca60-4112-82a1-4b6ca0a70517.dat' assembly_02.fasta && merqury.sh read-db.meryl pat.meryl mat.meryl assembly_01.fasta assembly_02.fasta output_merqury &> /tmp/tmpncnnfuyd/job_working_directory/000/34/outputs/dataset_bd7b006a-da53-4482-af18-daa527bc5f1b.dat && mv output_merqury* output_files && find . -maxdepth 1 -name 'assembly_only*' -type f -print0 | xargs -0r mv -t output_files  && sed -i '1s/^/assembly\tk-mer set\tsolid k-mers in assembly\tsolid k-mers in reads\tcompleteness %\n/' 'output_files/output_merqury.completeness.stats' && sed -i '1s/^/assembly\tunique k-mers\tcommon k-mers\tQV\terror rate\n/' 'output_files/output_merqury.qv'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"507b23709a6511efbdb11d9d2ea5f43f"`
chromInfo	`"/tmp/tmpncnnfuyd/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
label	`"output_merqury"`
mode	`{"__current_case__": 1, "assembly_options": {"__current_case__": 1, "assembly_01": {"values": [{"id": 33, "src": "hda"}]}, "assembly_02": {"values": [{"id": 34, "src": "hda"}]}, "number_assemblies": "two"}, "meryldb_F1": {"values": [{"id": 1, "src": "hda"}]}, "meryldb_MAT": {"values": [{"id": 3, "src": "hda"}]}, "meryldb_PAT": {"values": [{"id": 2, "src": "hda"}]}, "options": "trio"}`
output_add_headers	`true`
output_selector	`["qv", "plots", "sizes", "stats", "bed", "wig", "log", "hist"]`

Step 5: Hapmer Database : Paternal:
- step_state: scheduled

Step 41: Data prep Hap1:

step_state: scheduled

Subworkflow Steps

Step 1: gfa_stats:
- step_state: scheduled

Step 2: sort1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/tmpncnnfuyd/galaxy-dev/tools/filters/sorter.py'  --input='/tmp/tmpncnnfuyd/files/2/b/6/dataset_2b60c51c-9fb1-4c4d-8a21-f47ba8ffe134.dat' --output='/tmp/tmpncnnfuyd/job_working_directory/000/35/outputs/dataset_6c180d37-50b1-4bc7-bbba-24040c8686bb.dat'    --key=2,2nr   --header 0

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"507b23719a6511efbdb11d9d2ea5f43f"`
chromInfo	`"/tmp/tmpncnnfuyd/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
column	`"2"`
column_set	`[]`
dbkey	`"?"`
header_lines	`"0"`
order	`"DESC"`
style	`"num"`

Step 3: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmpncnnfuyd/job_working_directory/000/36/configs/tmpzltkrupz' '/tmp/tmpncnnfuyd/files/6/c/1/dataset_6c180d37-50b1-4bc7-bbba-24040c8686bb.dat' > '/tmp/tmpncnnfuyd/job_working_directory/000/36/outputs/dataset_cf1b05d9-2caf-43e9-8708-34cc17e39358.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"507b23719a6511efbdb11d9d2ea5f43f"`
chromInfo	`"/tmp/tmpncnnfuyd/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
code	`"{total += $2; $3 = total}1"`
dbkey	`"?"`

Step 4: toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.8+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

datamash         absmax 3 < /tmp/tmpncnnfuyd/files/c/f/1/dataset_cf1b05d9-2caf-43e9-8708-34cc17e39358.dat > '/tmp/tmpncnnfuyd/job_working_directory/000/37/outputs/dataset_2be1b7cc-b061-495f-ad86-9209022d8564.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"507b23719a6511efbdb11d9d2ea5f43f"`
chromInfo	`"/tmp/tmpncnnfuyd/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
grouping	`""`
header_in	`false`
header_out	`false`
ignore_case	`false`
narm	`false`
need_sort	`false`
operations	`[{"__index__": 0, "op_column": "3", "op_name": "absmax"}]`
print_full_line	`false`

Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpncnnfuyd/files/c/f/1/dataset_cf1b05d9-2caf-43e9-8708-34cc17e39358.dat" "/tmp/tmpncnnfuyd/job_working_directory/000/38/outputs/dataset_3e0744fe-d71d-44dc-8127-1e86a4838e57.dat" "1" "yes"

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"507b23719a6511efbdb11d9d2ea5f43f"`
chromInfo	`"/tmp/tmpncnnfuyd/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
exp	`"1"`
iterate	`"yes"`

Step 6: param_value_from_file:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"507b23719a6511efbdb11d9d2ea5f43f"`
chromInfo	`"/tmp/tmpncnnfuyd/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
param_type	`"integer"`
remove_newlines	`true`

Step 7: toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"507b23719a6511efbdb11d9d2ea5f43f"`
chromInfo	`"/tmp/tmpncnnfuyd/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
components	`[{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "c3/", "select_param_type": "text"}}, {"__index__": 1, "param_type": {"__current_case__": 1, "component_value": "1988019", "select_param_type": "integer"}}]`
dbkey	`"?"`

Step 8: toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types str,int,int,int  --file '/tmp/tmpncnnfuyd/job_working_directory/000/58/configs/tmp6x376dec' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmpncnnfuyd/files/3/e/0/dataset_3e0744fe-d71d-44dc-8127-1e86a4838e57.dat' '/tmp/tmpncnnfuyd/job_working_directory/000/58/outputs/dataset_682fc880-c28f-4789-bb8a-8ede70cd7bdf.dat'

Exit Code:

```
0
```

Standard Output:

c3/1988019
c2/1000000
c3/1000000
Computing 3 new columns with instructions ['c3/1988019;;', 'c2/1000000;;', 'c3/1000000;;']
Computed new column values for 100.00% of 81 lines written.

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"507b23719a6511efbdb11d9d2ea5f43f"`
avoid_scientific_notation	`false`
chromInfo	`"/tmp/tmpncnnfuyd/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
error_handling	`{"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}}`
ops	`{"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1988019"}, {"__index__": 1, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c2/1000000"}, {"__index__": 2, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1000000"}], "header_lines_select": "no"}`

Step 42: Data Prep Hap2:

step_state: scheduled

Subworkflow Steps

Step 1: gfa_stats:
- step_state: scheduled

Step 2: sort1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/tmpncnnfuyd/galaxy-dev/tools/filters/sorter.py'  --input='/tmp/tmpncnnfuyd/files/b/0/a/dataset_b0afe846-9a72-4db8-925a-de4bd194daaf.dat' --output='/tmp/tmpncnnfuyd/job_working_directory/000/40/outputs/dataset_725f38b1-203c-46c7-a249-3710880d08ea.dat'    --key=2,2nr   --header 0

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"507b23729a6511efbdb11d9d2ea5f43f"`
chromInfo	`"/tmp/tmpncnnfuyd/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
column	`"2"`
column_set	`[]`
dbkey	`"?"`
header_lines	`"0"`
order	`"DESC"`
style	`"num"`

Step 3: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmpncnnfuyd/job_working_directory/000/41/configs/tmprdretvs8' '/tmp/tmpncnnfuyd/files/7/2/5/dataset_725f38b1-203c-46c7-a249-3710880d08ea.dat' > '/tmp/tmpncnnfuyd/job_working_directory/000/41/outputs/dataset_f1103a1d-643a-4c3f-8c91-9114efdc801c.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"507b23729a6511efbdb11d9d2ea5f43f"`
chromInfo	`"/tmp/tmpncnnfuyd/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
code	`"{total += $2; $3 = total}1"`
dbkey	`"?"`

Step 4: toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.8+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

datamash         absmax 3 < /tmp/tmpncnnfuyd/files/f/1/1/dataset_f1103a1d-643a-4c3f-8c91-9114efdc801c.dat > '/tmp/tmpncnnfuyd/job_working_directory/000/42/outputs/dataset_1b6829c6-cfc2-4437-8a19-9346d2b11363.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"507b23729a6511efbdb11d9d2ea5f43f"`
chromInfo	`"/tmp/tmpncnnfuyd/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
grouping	`""`
header_in	`false`
header_out	`false`
ignore_case	`false`
narm	`false`
need_sort	`false`
operations	`[{"__index__": 0, "op_column": "3", "op_name": "absmax"}]`
print_full_line	`false`

Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpncnnfuyd/files/f/1/1/dataset_f1103a1d-643a-4c3f-8c91-9114efdc801c.dat" "/tmp/tmpncnnfuyd/job_working_directory/000/43/outputs/dataset_596b2e10-022b-4b53-9552-a0f7b545cd07.dat" "1" "yes"

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"507b23729a6511efbdb11d9d2ea5f43f"`
chromInfo	`"/tmp/tmpncnnfuyd/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
exp	`"1"`
iterate	`"yes"`

Step 6: param_value_from_file:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"507b23729a6511efbdb11d9d2ea5f43f"`
chromInfo	`"/tmp/tmpncnnfuyd/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
param_type	`"integer"`
remove_newlines	`true`

Step 7: toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"507b23729a6511efbdb11d9d2ea5f43f"`
chromInfo	`"/tmp/tmpncnnfuyd/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
components	`[{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "c3/", "select_param_type": "text"}}, {"__index__": 1, "param_type": {"__current_case__": 1, "component_value": "836724", "select_param_type": "integer"}}]`
dbkey	`"?"`

Step 8: toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types str,int,int,int  --file '/tmp/tmpncnnfuyd/job_working_directory/000/59/configs/tmp6hr47reb' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmpncnnfuyd/files/5/9/6/dataset_596b2e10-022b-4b53-9552-a0f7b545cd07.dat' '/tmp/tmpncnnfuyd/job_working_directory/000/59/outputs/dataset_e93d24b5-2746-4f06-9e4b-61853004595f.dat'

Exit Code:

```
0
```

Standard Output:

c3/836724
c2/1000000
c3/1000000
Computing 3 new columns with instructions ['c3/836724;;', 'c2/1000000;;', 'c3/1000000;;']
Computed new column values for 100.00% of 27 lines written.

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"507b23729a6511efbdb11d9d2ea5f43f"`
avoid_scientific_notation	`false`
chromInfo	`"/tmp/tmpncnnfuyd/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
error_handling	`{"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}}`
ops	`{"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/836724"}, {"__index__": 1, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c2/1000000"}, {"__index__": 2, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1000000"}], "header_lines_select": "no"}`

Step 43: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmpncnnfuyd/job_working_directory/000/45/configs/tmp4rl1nesb' '/tmp/tmpncnnfuyd/files/0/3/0/dataset_03069ad0-644d-4f25-bafd-9f2e181effb9.dat' > '/tmp/tmpncnnfuyd/job_working_directory/000/45/outputs/dataset_cd47057f-47ae-44c2-8ba9-678dbdb2753f.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"507b23709a6511efbdb11d9d2ea5f43f"`
chromInfo	`"/tmp/tmpncnnfuyd/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
code	`"BEGIN{print \"Metric\\thap2-Maternal\"}; {print}; "`
dbkey	`"?"`

Step 44: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmpncnnfuyd/job_working_directory/000/46/configs/tmp73m3ebcs' '/tmp/tmpncnnfuyd/files/f/5/e/dataset_f5e0655a-4ee0-4688-a010-f38a9f1e3cd9.dat' > '/tmp/tmpncnnfuyd/job_working_directory/000/46/outputs/dataset_d9d0306d-0dd0-47f4-90d4-3275120a3a20.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"507b23709a6511efbdb11d9d2ea5f43f"`
chromInfo	`"/tmp/tmpncnnfuyd/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
code	`"BEGIN{print \"Metric\\thap1-Paternal\"}; {print}; "`
dbkey	`"?"`

Step 45: merqury_qv:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"507b23709a6511efbdb11d9d2ea5f43f"`
input	`{"values": [{"id": 10, "src": "hdca"}]}`
which	`{"__current_case__": 1, "identifier": "output_merqury", "which_dataset": "by_identifier"}`

Step 46: output_merqury.spectra-cn.fl:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"507b23709a6511efbdb11d9d2ea5f43f"`
input	`{"values": [{"id": 11, "src": "hdca"}]}`
which	`{"__current_case__": 1, "identifier": "output_merqury.spectra-cn.fl", "which_dataset": "by_identifier"}`

Step 47: output_merqury.spectra-asm.fl:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"507b23709a6511efbdb11d9d2ea5f43f"`
input	`{"values": [{"id": 11, "src": "hdca"}]}`
which	`{"__current_case__": 1, "identifier": "output_merqury.spectra-asm.fl", "which_dataset": "by_identifier"}`

Step 48: output_merqury.assembly_01.spectra-cn.fl:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"507b23709a6511efbdb11d9d2ea5f43f"`
input	`{"values": [{"id": 11, "src": "hdca"}]}`
which	`{"__current_case__": 1, "identifier": "output_merqury.assembly_01.spectra-cn.fl", "which_dataset": "by_identifier"}`

Step 49: output_merqury.assembly_02.spectra-cn.fl:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"507b23709a6511efbdb11d9d2ea5f43f"`
input	`{"values": [{"id": 11, "src": "hdca"}]}`
which	`{"__current_case__": 1, "identifier": "output_merqury.assembly_02.spectra-cn.fl", "which_dataset": "by_identifier"}`

Step 50: merqury_stats:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"507b23709a6511efbdb11d9d2ea5f43f"`
input	`{"values": [{"id": 13, "src": "hdca"}]}`
which	`{"__current_case__": 1, "identifier": "output_merqury.completeness", "which_dataset": "by_identifier"}`

Step 6: Hapmer Database : Maternal:
- step_state: scheduled

Step 51: Plots:

step_state: scheduled

Subworkflow Steps

Step 1: Primary data:
- step_state: scheduled
Step 2: Alternate data:
- step_state: scheduled

Step 11: Size Plot:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

cat '/tmp/tmpncnnfuyd/job_working_directory/000/66/configs/tmpj1oqvbl8' && Rscript '/tmp/tmpncnnfuyd/job_working_directory/000/66/configs/tmpj1oqvbl8'

Exit Code:

```
0
```

Standard Error:

Warning message:
In Sys.setlocale("LC_MESSAGES", "en_US.UTF-8") :
  OS reports request to set locale to "en_US.UTF-8" cannot be honored
Warning message:
package ‘ggplot2’ was built under R version 4.1.3 
Warning message:
Using `size` aesthetic for lines was deprecated in ggplot2 3.4.0.
ℹ Please use `linewidth` instead.

Standard Output:

        options(show.error.messages=F, error=function(){cat(geterrmessage(), file=stderr()); q("no",1,F)})

        loc <- Sys.setlocale("LC_MESSAGES", "en_US.UTF-8")
    

library(ggplot2)


        #Choose between automatically scaled x and y axis or user defined
            gg_scalex = NULL
            gg_scaley = NULL
    


            gg_theme = theme_bw()
    


            gg_legend = theme(legend.position="right")
    

input <- read.csv('/tmp/tmpncnnfuyd/files/d/1/a/dataset_d1aea130-9026-4651-96ef-d2ce78947ec7.dat', sep='\t', header=TRUE)

names(input)[2] <- "xcol"
names(input)[3] <- "ycol"

    gg_facet = NULL
    gg_factor = aes(colour=factor(factor))

        gg_line = geom_line(size=1, alpha=1, gg_factor)

        color_scale = scale_color_brewer(palette='Set1', direction='1')

    names(input)[1] <- "factor"


    

    gg_axistitle = theme(axis.title = element_text(color = NULL, size = NULL, face = NULL))

    gg_axistext = theme(axis.text = element_text(color = NULL, size = NULL, face = NULL))

    gg_plottitle = theme(plot.title = element_text(color = NULL, size = NULL, face = NULL))

    gg_gridline = NULL

    gg_point = NULL

#this is the actual ggplot command to make the final plot(s)
plot_out <- ggplot(input, aes(xcol, ycol)) + gg_point + gg_line + gg_facet +
    gg_theme + gg_scalex + gg_scaley + color_scale + gg_legend + ggtitle('') + xlab('Scaffold number') + ylab('Cumulative Size (Mb)')+
    gg_axistitle + gg_axistext + gg_plottitle + gg_gridline


        gg_width <- as.double('6.0')
        gg_height <- as.double('4.0')
        gg_unit <- 'in'
        gg_dpi <- as.double('300.0')
        gg_add_device <- 'none'
        output1 <- '/tmp/tmpncnnfuyd/job_working_directory/000/66/outputs/dataset_bcd69619-2640-4d37-ae7d-d489d944dc51.dat'
        output2 <- 'XXXX'

        ggsave(filename = output1, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = "png")
        if(gg_add_device != "none"){
          ggsave(filename = output2, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = gg_add_device)
        }

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"507b23739a6511efbdb11d9d2ea5f43f"`
adv	{"axis_text_customization": {"__current_case__": 0, "axis_customization": "default"}, "axis_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "factor": {"__current_case__": 1, "colororder": "1", "colors": "Set1", "factorcol": "1", "factoring": "Single"}, "gridlinecust": "default", "legend": "yes", "plot_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "scaling": {"__current_case__": 0, "plot_scaling": "Automatic"}, "theme": "bw", "transform": "none", "type_conditional": {"__current_case__": 2, "type_options": "lines"}}
chromInfo	`"/tmp/tmpncnnfuyd/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
out	`{"additional_output_format": "none", "dpi_output_dim": "300.0", "height_output_dim": "4.0", "unit_output_dim": "in", "width_output_dim": "6.0"}`
title	`""`
xlab	`"Scaffold number"`
xplot	`"2"`
ylab	`"Cumulative Size (Mb)"`
yplot	`"3"`

Step 3: Name of primary assembly:
- step_state: scheduled
Step 4: Name of alternate assembly:
- step_state: scheduled

Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpncnnfuyd/files/6/8/2/dataset_682fc880-c28f-4789-bb8a-8ede70cd7bdf.dat" "/tmp/tmpncnnfuyd/job_working_directory/000/60/outputs/dataset_f23e9f42-d23e-431f-a8a6-e380ba48eca9.dat" "Hap1" "no"

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"507b23739a6511efbdb11d9d2ea5f43f"`
chromInfo	`"/tmp/tmpncnnfuyd/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
exp	`"Hap1"`
iterate	`"no"`

Step 6: toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpncnnfuyd/files/e/9/3/dataset_e93d24b5-2746-4f06-9e4b-61853004595f.dat" "/tmp/tmpncnnfuyd/job_working_directory/000/61/outputs/dataset_54732727-0a81-4a16-8a54-d5fe2057dc5b.dat" "Hap2" "no"

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"507b23739a6511efbdb11d9d2ea5f43f"`
chromInfo	`"/tmp/tmpncnnfuyd/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
exp	`"Hap2"`
iterate	`"no"`

Step 7: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cat/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

cat '/tmp/tmpncnnfuyd/files/f/2/3/dataset_f23e9f42-d23e-431f-a8a6-e380ba48eca9.dat' >> '/tmp/tmpncnnfuyd/job_working_directory/000/62/outputs/dataset_6ef4903b-4278-40a7-b6b6-d50677c9b4cc.dat' && cat '/tmp/tmpncnnfuyd/files/5/4/7/dataset_54732727-0a81-4a16-8a54-d5fe2057dc5b.dat' >> '/tmp/tmpncnnfuyd/job_working_directory/000/62/outputs/dataset_6ef4903b-4278-40a7-b6b6-d50677c9b4cc.dat' && exit 0

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"507b23739a6511efbdb11d9d2ea5f43f"`
chromInfo	`"/tmp/tmpncnnfuyd/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
queries	`[{"__index__": 0, "inputs2": {"values": [{"id": 143, "src": "hda"}]}}]`

Step 8: Cut1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl '/tmp/tmpncnnfuyd/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpncnnfuyd/files/6/e/f/dataset_6ef4903b-4278-40a7-b6b6-d50677c9b4cc.dat' 'c8,c5,c6' T '/tmp/tmpncnnfuyd/job_working_directory/000/63/outputs/dataset_e535cdb9-91bf-42b2-b776-b2e450e5f7a8.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"507b23739a6511efbdb11d9d2ea5f43f"`
chromInfo	`"/tmp/tmpncnnfuyd/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
columnList	`"c8,c5,c6"`
dbkey	`"?"`
delimiter	`"T"`

Step 9: Cut1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl '/tmp/tmpncnnfuyd/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpncnnfuyd/files/6/e/f/dataset_6ef4903b-4278-40a7-b6b6-d50677c9b4cc.dat' 'c8,c4,c7' T '/tmp/tmpncnnfuyd/job_working_directory/000/64/outputs/dataset_d1aea130-9026-4651-96ef-d2ce78947ec7.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"507b23739a6511efbdb11d9d2ea5f43f"`
chromInfo	`"/tmp/tmpncnnfuyd/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
columnList	`"c8,c4,c7"`
dbkey	`"?"`
delimiter	`"T"`

Step 10: Nx Plot:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

cat '/tmp/tmpncnnfuyd/job_working_directory/000/65/configs/tmpbo244058' && Rscript '/tmp/tmpncnnfuyd/job_working_directory/000/65/configs/tmpbo244058'

Exit Code:

```
0
```

Standard Error:

Warning message:
In Sys.setlocale("LC_MESSAGES", "en_US.UTF-8") :
  OS reports request to set locale to "en_US.UTF-8" cannot be honored
Warning message:
package ‘ggplot2’ was built under R version 4.1.3 
Warning message:
Using `size` aesthetic for lines was deprecated in ggplot2 3.4.0.
ℹ Please use `linewidth` instead.

Standard Output:

        options(show.error.messages=F, error=function(){cat(geterrmessage(), file=stderr()); q("no",1,F)})

        loc <- Sys.setlocale("LC_MESSAGES", "en_US.UTF-8")
    

library(ggplot2)


        #Choose between automatically scaled x and y axis or user defined
            gg_scalex = NULL
            gg_scaley = NULL
    


            gg_theme = theme_bw()
    


            gg_legend = theme(legend.position="right")
    

input <- read.csv('/tmp/tmpncnnfuyd/files/e/5/3/dataset_e535cdb9-91bf-42b2-b776-b2e450e5f7a8.dat', sep='\t', header=TRUE)

names(input)[2] <- "xcol"
names(input)[3] <- "ycol"

    gg_facet = NULL
    gg_factor = aes(colour=factor(factor))

        gg_line = geom_line(size=1, alpha=1, gg_factor)

        color_scale = scale_color_brewer(palette='Set1', direction='1')

    names(input)[1] <- "factor"


    

    gg_axistitle = theme(axis.title = element_text(color = NULL, size = NULL, face = NULL))

    gg_axistext = theme(axis.text = element_text(color = NULL, size = NULL, face = NULL))

    gg_plottitle = theme(plot.title = element_text(color = NULL, size = NULL, face = NULL))

    gg_gridline = NULL

    gg_point = NULL

#this is the actual ggplot command to make the final plot(s)
plot_out <- ggplot(input, aes(xcol, ycol)) + gg_point + gg_line + gg_facet +
    gg_theme + gg_scalex + gg_scaley + color_scale + gg_legend + ggtitle('') + xlab('x') + ylab('Nx (Mb)')+
    gg_axistitle + gg_axistext + gg_plottitle + gg_gridline


        gg_width <- as.double('6.0')
        gg_height <- as.double('4.0')
        gg_unit <- 'in'
        gg_dpi <- as.double('300.0')
        gg_add_device <- 'none'
        output1 <- '/tmp/tmpncnnfuyd/job_working_directory/000/65/outputs/dataset_82b51171-b940-4c79-94e5-501b2ff911d4.dat'
        output2 <- 'XXXX'

        ggsave(filename = output1, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = "png")
        if(gg_add_device != "none"){
          ggsave(filename = output2, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = gg_add_device)
        }

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"507b23739a6511efbdb11d9d2ea5f43f"`
adv	{"axis_text_customization": {"__current_case__": 0, "axis_customization": "default"}, "axis_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "factor": {"__current_case__": 1, "colororder": "1", "colors": "Set1", "factorcol": "1", "factoring": "Single"}, "gridlinecust": "default", "legend": "yes", "plot_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "scaling": {"__current_case__": 0, "plot_scaling": "Automatic"}, "theme": "bw", "transform": "none", "type_conditional": {"__current_case__": 2, "type_options": "lines"}}
chromInfo	`"/tmp/tmpncnnfuyd/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
out	`{"additional_output_format": "none", "dpi_output_dim": "300.0", "height_output_dim": "4.0", "unit_output_dim": "in", "width_output_dim": "6.0"}`
title	`""`
xlab	`"x"`
xplot	`"2"`
ylab	`"Nx (Mb)"`
yplot	`"3"`

Step 52: join1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/tmpncnnfuyd/galaxy-dev/tools/filters/join.py' '/tmp/tmpncnnfuyd/files/d/9/d/dataset_d9d0306d-0dd0-47f4-90d4-3275120a3a20.dat' '/tmp/tmpncnnfuyd/files/c/d/4/dataset_cd47057f-47ae-44c2-8ba9-678dbdb2753f.dat' 1 1 '/tmp/tmpncnnfuyd/job_working_directory/000/47/outputs/dataset_20332b74-d62e-40f0-a88a-1b8af6958114.dat' -u -p --index_depth=3 --buffer=50000000 --fill_options_file=/tmp/tmpncnnfuyd/job_working_directory/000/47/configs/tmp9yhlycbm

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"507b23709a6511efbdb11d9d2ea5f43f"`
chromInfo	`"/tmp/tmpncnnfuyd/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
field1	`"1"`
field2	`"1"`
fill_empty_columns	`{"__current_case__": 1, "do_fill_empty_columns": {"__current_case__": 0, "column_fill_type": "single_fill_value", "fill_value": "."}, "fill_columns_by": "fill_unjoined_only", "fill_empty_columns_switch": "fill_empty"}`
header	`""`
partial	`"-p"`
unmatched	`"-u"`

Step 53: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cut_tool/9.3+galaxy2:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

cut --complement -f '3' '/tmp/tmpncnnfuyd/files/2/0/3/dataset_20332b74-d62e-40f0-a88a-1b8af6958114.dat' > '/tmp/tmpncnnfuyd/job_working_directory/000/48/outputs/dataset_23c4702f-2735-4469-a20e-a849f097c969.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"507b23709a6511efbdb11d9d2ea5f43f"`
chromInfo	`"/tmp/tmpncnnfuyd/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
complement	`"--complement"`
cut_type_options	`{"__current_case__": 0, "colnames_option": {"__current_case__": 1, "header": "N", "list": ["3"]}, "cut_element": "-f", "delimiter": ""}`
dbkey	`"?"`

Step 54: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_find_and_replace/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/86755160afbf/text_processing/find_and_replace' -o '/tmp/tmpncnnfuyd/job_working_directory/000/49/outputs/dataset_8cad2a05-6fe1-4ce2-88c5-632f3e393975.dat' -g     '#' 'Number of' '/tmp/tmpncnnfuyd/files/2/3/c/dataset_23c4702f-2735-4469-a20e-a849f097c969.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"507b23709a6511efbdb11d9d2ea5f43f"`
chromInfo	`"/tmp/tmpncnnfuyd/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
find_and_replace	`[{"__index__": 0, "caseinsensitive": false, "find_pattern": "#", "global": true, "is_regex": false, "replace_pattern": "Number of", "searchwhere": {"__current_case__": 0, "searchwhere_select": "line"}, "skip_first_line": false, "wholewords": false}]`

Step 7: Bits for bloom filter:
- step_state: scheduled
Step 8: Database for Busco Lineage:
- step_state: scheduled
Step 9: Lineage:
- step_state: scheduled
Step 10: Homozygous Read Coverage:
- step_state: scheduled

Other invocation details
- history_id
  - fa52bbf1afabe279
- history_state
  - ok
- invocation_id
  - fa52bbf1afabe279
- invocation_state
  - scheduled
- workflow_id
  - 0d4e36f9fd1179e1

…om 0.2 to 0.3

gxydevbot · 2024-11-11T04:20:23Z

There are new updates, they have been integrated to the PR, check the file diff.

github-actions · 2024-11-11T04:55:22Z

Test Results (powered by Planemo)

Test Summary

Test State	Count
Total	1
Passed	0
Error	0
Failure	1
Skipped	0

Failed Tests

❌ Assembly-Hifi-Trio-phasing-VGP5.ga_0

Problems:

Output with path /tmp/tmpjyjrf4w3/Assembly statistics for Hap1 and Hap2__65cf7e56-a0a9-4564-a6a2-c8421010e97a different than expected
Expected line '# contigs	85	23' in output ('Metric	hap1-Paternal	hap2-Maternal
Expected genome size	2,288,021	2,288,021
# scaffolds	81	27
Total scaffold length	1,988,019	836,724
Average scaffold length	24,543.44	30,989.78
Scaffold N50	22,011	31,085
Scaffold N50	22,011	31,085
Scaffold auN	34,607.62	51,544.22
Scaffold L50	29	7
Scaffold L50	29	7
Scaffold NG50	20,749	0
Scaffold NG50	20,749	0
Scaffold auNG	30,069.92	18,849.60
Scaffold LG50	36	0
Scaffold LG50	36	0
Largest scaffold	132,684	132,684
Smallest scaffold	15,406	16,240
# contigs	81	27
Total contig length	1,988,019	836,724
Average contig length	24,543.44	30,989.78
Contig N50	22,011	31,085
Contig N50	22,011	31,085
Contig auN	34,607.62	51,544.22
Contig L50	29	7
Contig L50	29	7
Contig NG50	20,749	0
Contig NG50	20,749	0
Contig auNG	30,069.92	18,849.60
Contig LG50	36	0
Contig LG50	36	0
Largest contig	132,684	132,684
Smallest contig	15,406	16,240
# gaps in scaffolds	0	0
Total gap length in scaffolds	0	0
Average gap length in scaffolds	0.00	0.00
Gap N50 in scaffolds	0	0
Gap auN in scaffolds	0.00	0.00
Gap L50 in scaffolds	0	0
Largest gap in scaffolds	0	0
Smallest gap in scaffolds	0	0
Base composition (A:C:G:T)	606,195:384,545:388,054:609,225	252,099:164,572:166,355:253,698
GC content %	38.86	39.55
# soft-masked bases	0	0
# segments	81	27
Total segment length	1,988,019	836,724
Average segment length	24,543.44	30,989.78
# gaps	0	0
# paths	81	27
# edges	4	.
Average degree	0.05	.
# connected components	1	.
Largest connected component length	89,366	.
# dead ends	159	.
# disconnected components	78	.
Total length disconnected components	1,898,653	.
# separated components	79	.
# bubbles	0	.
# circular segments	0	.
# circular paths	0	.
Scaffold N10	93,875	132,684
Scaffold N20	39,024	93,875
Scaffold N30	26,760	46,449
Scaffold N40	24,154	43,611
Scaffold N50	22,011	31,085
Scaffold N50	22,011	31,085
Scaffold N60	20,442	24,012
Scaffold N70	19,760	21,778
Scaffold N80	19,051	19,871
Scaffold N90	17,544	17,885
Scaffold N100	15,406	16,240
Scaffold L10	2	1
Scaffold L20	6	2
Scaffold L30	13	3
Scaffold L40	21	5
Scaffold L50	29	7
Scaffold L50	29	7
Scaffold L60	39	11
Scaffold L70	49	14
Scaffold L80	59	18
Scaffold L90	70	23
Scaffold L100	81	27
Scaffold NG10	46,449	46,449
Scaffold NG20	33,978	24,991
Scaffold NG30	25,221	19,760
Scaffold NG40	23,338	0
Scaffold NG50	20,749	0
Scaffold NG50	20,749	0
Scaffold NG60	19,814	0
Scaffold NG70	19,045	0
Scaffold NG80	17,501	0
Scaffold NG90	0	0
Scaffold NG100	0	0
Scaffold LG10	3	3
Scaffold LG20	8	9
Scaffold LG30	16	19
Scaffold LG40	26	0
Scaffold LG50	36	0
Scaffold LG50	36	0
Scaffold LG60	48	0
Scaffold LG70	60	0
Scaffold LG80	72	0
Scaffold LG90	0	0
Scaffold LG100	0	0
Contig N10	93,875	132,684
Contig N20	39,024	93,875
Contig N30	26,760	46,449
Contig N40	24,154	43,611
Contig N50	22,011	31,085
Contig N50	22,011	31,085
Contig N60	20,442	24,012
Contig N70	19,760	21,778
Contig N80	19,051	19,871
Contig N90	17,544	17,885
Contig N100	15,406	16,240
Contig L10	2	1
Contig L20	6	2
Contig L30	13	3
Contig L40	21	5
Contig L50	29	7
Contig L50	29	7
Contig L60	39	11
Contig L70	49	14
Contig L80	59	18
Contig L90	70	23
Contig L100	81	27
Contig NG10	46,449	46,449
Contig NG20	33,978	24,991
Contig NG30	25,221	19,760
Contig NG40	23,338	0
Contig NG50	20,749	0
Contig NG50	20,749	0
Contig NG60	19,814	0
Contig NG70	19,045	0
Contig NG80	17,501	0
Contig NG90	0	0
Contig NG100	0	0
Contig LG10	3	3
Contig LG20	8	9
Contig LG30	16	19
Contig LG40	26	0
Contig LG50	36	0
Contig LG50	36	0
Contig LG60	48	0
Contig LG70	60	0
Contig LG80	72	0
Contig LG90	0	0
Contig LG100	0	0
Gap N10	0	0
Gap N20	0	0
Gap N30	0	0
Gap N40	0	0
Gap N50	0	0
Gap N60	0	0
Gap N70	0	0
Gap N80	0	0
Gap N90	0	0
Gap N100	0	0
Gap L10	0	0
Gap L20	0	0
Gap L30	0	0
Gap L40	0	0
Gap L50	0	0
Gap L60	0	0
Gap L70	0	0
Gap L80	0	0
Gap L90	0	0
Gap L100	0	0
')

Output with path /tmp/tmpd2bni5ag/usable hap1 gfa__953e7273-0bc3-4183-ac67-a9ebe69b7d2d different than expected
Expected 175+-0 lines in the output found 167

Output with path /tmp/tmp78an4sr3/Hifiasm Trio hap1__dabfcbbf-79ee-4feb-8389-f41b2f240512 different than expected
Expected 170+-0 lines in the output found 162

Output with path /tmp/tmp9nlk0_kl/Busco on data 40 short summary__3bbc834f-d3f8-4fa2-9be9-17477b2c7c28 different than expected
Expected text 'C:1.2%[S:1.2%,D:0.0%],F:0.4%,M:98.4%,n:3354' in output ('# BUSCO version is: 5.8.0 
# The lineage dataset is: vertebrata_odb10 (Creation date: 2021-02-19, number of genomes: 67, number of BUSCOs: 3354)
# Summarized benchmarking in BUSCO notation for file /tmp/tmpba1za83k/files/d/a/b/dataset_dabfcbbf-79ee-4feb-8389-f41b2f240512.dat
# BUSCO was run in mode: euk_genome_min
# Gene predictor used: miniprot

	***** Results: *****

	C:1.1%[S:1.1%,D:0.0%],F:0.1%,M:98.7%,n:3354,E:5.3%	   
	38	Complete BUSCOs (C)	(of which 2 contain internal stop codons)		   
	37	Complete and single-copy BUSCOs (S)	   
	1	Complete and duplicated BUSCOs (D)	   
	4	Fragmented BUSCOs (F)			   
	3312	Missing BUSCOs (M)			   
	3354	Total BUSCO groups searched		   

Assembly Statistics:
	81	Number of scaffolds
	81	Number of contigs
	1988019	Total length
	0.000%	Percent gaps
	22 KB	Scaffold N50
	22 KB	Contigs N50


Dependencies and versions:
	hmmsearch: 3.4
	bbtools: None
	miniprot_index: 0.13-r248
	miniprot_align: 0.13-r248
	python: sys.version_info(major=3, minor=10, micro=15, releaselevel='final', serial=0)
	busco: 5.8.0
')

Workflow invocation details

Invocation Messages

Steps

Step 1: Pacbio Reads Collection : child:
- step_state: scheduled
Step 2: Paternal Illumina reads (hap1):
- step_state: scheduled
Step 11: Genomescope Model Parameters:
- step_state: scheduled
Step 12: Genomescope Summary:
- step_state: scheduled
Step 13: Utilize homology information to correct trio-phasing errors:
- step_state: scheduled
Step 14: SAK input file (Optional):
- step_state: scheduled
Step 15: Name for Haplotype 1:
- step_state: scheduled
Step 16: Name for Haplotype 2:
- step_state: scheduled

Step 17: toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.9+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -f -s '/tmp/tmpba1za83k/files/9/0/2/dataset_9028186d-630f-4e69-9125-656a7fd5d11c.dat' 'yeast_reads_sub1_fastq_gz.fq.gz' &&  cutadapt  -j=${GALAXY_SLOTS:-4}   -b 'ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT'   -b 'ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT'    --error-rate=0.1 --times=1 --overlap=35    --action=trim --rc     --discard-trimmed   --minimum-length=1      --json=stats.json -o 'out1.fq.gz'  'yeast_reads_sub1_fastq_gz.fq.gz'  > report.txt

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"68dc04ea9fe511ef82fd7b3c31f91d5d"`
adapter_options	`{"action": "trim", "error_rate": "0.1", "match_read_wildcards": false, "no_indels": false, "no_match_adapter_wildcards": true, "overlap": "35", "revcomp": true, "times": "1"}`
chromInfo	`"/tmp/tmpba1za83k/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter_options	`{"discard_casava": false, "discard_trimmed": true, "discard_untrimmed": false, "max_average_error_rate": null, "max_expected_errors": null, "max_n": null, "maximum_length": null, "maximum_length2": null, "minimum_length": "1", "minimum_length2": null, "pair_filter": "any"}`
library	{"__current_case__": 0, "input_1": {"values": [{"id": 1, "src": "dce"}]}, "r1": {"adapters": [], "anywhere_adapters": [{"__index__": 0, "adapter_source": {"__current_case__": 0, "adapter": "ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT", "adapter_name": "", "adapter_source_list": "user"}, "single_noindels": false}, {"__index__": 1, "adapter_source": {"__current_case__": 0, "adapter": "ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT", "adapter_name": "", "adapter_source_list": "user"}, "single_noindels": false}], "front_adapters": []}, "type": "single"}
other_trimming_options	`{"cut": "0", "cut2": "0", "nextseq_trim": "0", "poly_a": false, "quality_cutoff": "0", "quality_cutoff2": "", "shorten_options": {"__current_case__": 1, "shorten_values": "False"}, "shorten_options_r2": {"__current_case__": 1, "shorten_values_r2": "False"}, "trim_n": false}`
output_selector	`["json_stats", "report"]`
read_mod_options	`{"length_tag": "", "rename": "", "strip_suffix": "", "zero_cap": false}`

Step 18: toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types float,float,float,float,float,int  --file '/tmp/tmpba1za83k/job_working_directory/000/12/configs/tmpwq_l12vj' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmpba1za83k/files/d/b/7/dataset_db785d39-1fed-49d7-be0c-022097a26f01.dat' '/tmp/tmpba1za83k/job_working_directory/000/12/outputs/dataset_2a8fb3a2-88cd-4084-96b7-f833dfb56a1b.dat'

Exit Code:

```
0
```

Standard Output:

c3*2
Computing 1 new columns with instructions ['c3*2;;']
Computed new column values for 100.00% of 1 lines written.

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"68dc04ea9fe511ef82fd7b3c31f91d5d"`
avoid_scientific_notation	`false`
chromInfo	`"/tmp/tmpba1za83k/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
error_handling	`{"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}}`
ops	`{"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3*2"}], "header_lines_select": "no"}`

Step 19: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

grep -G -A 0 -B 0 --no-group-separator  -i -- 'Haploid' '/tmp/tmpba1za83k/files/6/d/5/dataset_6d536fde-3f3c-4742-b08a-1157ed9e9b45.dat' > '/tmp/tmpba1za83k/job_working_directory/000/13/outputs/dataset_1b3d9341-0935-40eb-80a4-b8bd093504fb.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"68dc04ea9fe511ef82fd7b3c31f91d5d"`
case_sensitive	`"-i"`
chromInfo	`"/tmp/tmpba1za83k/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
color	`"NOCOLOR"`
dbkey	`"?"`
invert	`""`
lines_after	`"0"`
lines_before	`"0"`
regex_type	`"-G"`
url_paste	`"Haploid"`

Step 20: toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

die() { echo "$@" 1>&2 ; exit 1; } &&  mkdir multiqc_WDir &&   mkdir multiqc_WDir/cutadapt_0 &&     ln -s '/tmp/tmpba1za83k/files/5/0/6/dataset_506b217f-ad8b-4f3b-bbb7-a58e19edeed3.dat' 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' && sed -i.old 's/You are running/This is/' 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' && grep -q "This is cutadapt" 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' || die "'This is cutadapt' or 'You are running cutadapt' not found in the file" &&   multiqc multiqc_WDir --filename 'report'       && mkdir -p ./plots && ls -l ./report_data/ && cp ./report_data/*plot*.txt ./plots/ | true

Exit Code:

```
0
```

Standard Error:

/// MultiQC 🔍 v1.24.1

     version_check | MultiQC Version v1.25.1 now available!
       file_search | Search path: /tmp/tmpba1za83k/job_working_directory/000/14/working/multiqc_WDir

          cutadapt | Found 1 reports

     write_results | Data        : report_data
     write_results | Report      : report.html
           multiqc | MultiQC complete

Standard Output:

total 72
-rw-r--r-- 1 1001 127    93 Nov 11 04:30 cutadapt_filtered_reads_plot.txt
-rw-r--r-- 1 1001 127    66 Nov 11 04:30 cutadapt_trimmed_sequences_plot_default_Counts.txt
-rw-r--r-- 1 1001 127    70 Nov 11 04:30 cutadapt_trimmed_sequences_plot_default_Obs_Exp.txt
-rw-r--r-- 1 1001 127   124 Nov 11 04:30 multiqc_citations.txt
-rw-r--r-- 1 1001 127   222 Nov 11 04:30 multiqc_cutadapt.txt
-rw-r--r-- 1 1001 127 39114 Nov 11 04:30 multiqc_data.json
-rw-r--r-- 1 1001 127   105 Nov 11 04:30 multiqc_general_stats.txt
-rw-r--r-- 1 1001 127    29 Nov 11 04:30 multiqc_software_versions.txt
-rw-r--r-- 1 1001 127   194 Nov 11 04:30 multiqc_sources.txt

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"68dc04ea9fe511ef82fd7b3c31f91d5d"`
chromInfo	`"/tmp/tmpba1za83k/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
comment	`""`
dbkey	`"?"`
export	`false`
flat	`false`
results	`[{"__index__": 0, "software_cond": {"__current_case__": 5, "input": {"values": [{"id": 5, "src": "hdca"}]}, "software": "cutadapt"}}]`
saveLog	`"false"`
title	`""`

Step 3: Maternal Illumina reads (hap2):
- step_state: scheduled

Step 21: Cut1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl '/tmp/tmpba1za83k/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpba1za83k/files/2/a/8/dataset_2a8fb3a2-88cd-4084-96b7-f833dfb56a1b.dat' 'c7' T '/tmp/tmpba1za83k/job_working_directory/000/15/outputs/dataset_316971f9-dc07-49cf-aced-410563e1f357.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"68dc04ea9fe511ef82fd7b3c31f91d5d"`
chromInfo	`"/tmp/tmpba1za83k/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
columnList	`"c7"`
dbkey	`"?"`
delimiter	`"T"`

Step 22: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

sed -r --sandbox -e 's/bp//g' -e 's/,//g' -e 's/([a-z])\s+([A-Z])/\1_\2/g' '/tmp/tmpba1za83k/files/1/b/3/dataset_1b3d9341-0935-40eb-80a4-b8bd093504fb.dat' > '/tmp/tmpba1za83k/job_working_directory/000/16/outputs/dataset_ffdbdf79-5fb6-4481-ac0e-107124417cc6.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"68dc04ea9fe511ef82fd7b3c31f91d5d"`
chromInfo	`"/tmp/tmpba1za83k/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
replacements	`[{"__index__": 0, "find_pattern": "bp", "replace_pattern": ""}, {"__index__": 1, "find_pattern": ",", "replace_pattern": ""}, {"__index__": 2, "find_pattern": "([a-z])\\s+([A-Z])", "replace_pattern": "\\1_\\2"}]`

Step 23: param_value_from_file:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"68dc04ea9fe511ef82fd7b3c31f91d5d"`
chromInfo	`"/tmp/tmpba1za83k/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
param_type	`"integer"`
remove_newlines	`true`

Step 24: Convert characters1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python /tmp/tmpba1za83k/galaxy-dev/tools/filters/convert_characters.py --strip --condense /tmp/tmpba1za83k/files/f/f/d/dataset_ffdbdf79-5fb6-4481-ac0e-107124417cc6.dat s /tmp/tmpba1za83k/job_working_directory/000/18/outputs/dataset_e1a0d109-6889-49cb-b9a8-dc9cb2924fe4.dat

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"txt"`
__workflow_invocation_uuid__	`"68dc04ea9fe511ef82fd7b3c31f91d5d"`
chromInfo	`"/tmp/tmpba1za83k/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
condense	`true`
convert_from	`"s"`
dbkey	`"?"`
strip	`true`

Step 25: Homozygous read coverage for Hifiasm:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"68dc04ea9fe511ef82fd7b3c31f91d5d"`
chromInfo	`"/tmp/tmpba1za83k/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
style_cond	`{"__current_case__": 0, "pick_style": "first", "type_cond": {"__current_case__": 1, "param_type": "integer", "pick_from": [{"__index__": 0, "value": null}, {"__index__": 1, "value": "21"}]}}`

Step 26: Cut1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl '/tmp/tmpba1za83k/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpba1za83k/files/e/1/a/dataset_e1a0d109-6889-49cb-b9a8-dc9cb2924fe4.dat' 'c3' T '/tmp/tmpba1za83k/job_working_directory/000/19/outputs/dataset_dfb1f172-ab6a-40af-a1a3-edcfc41819b6.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"68dc04ea9fe511ef82fd7b3c31f91d5d"`
chromInfo	`"/tmp/tmpba1za83k/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
columnList	`"c3"`
dbkey	`"?"`
delimiter	`"T"`

Step 27: toolshed.g2.bx.psu.edu/repos/bgruening/hifiasm/hifiasm/0.20.0+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -s '/tmp/tmpba1za83k/files/5/8/4/dataset_584c2a27-74a9-4068-a9f0-ef853519ab97.dat' input_0.fastq.gz &&  ln -s '/tmp/tmpba1za83k/files/e/c/f/dataset_ecf10f4c-5da3-4576-b14c-dc33d9b3a32a.dat' hap1_input_0.fastqsanger &&  ln -s '/tmp/tmpba1za83k/files/7/3/c/dataset_73c24ccf-ace5-472a-8860-27c3c7e2b7e2.dat' hap1_input_1.fastqsanger &&  ln -s '/tmp/tmpba1za83k/files/6/4/b/dataset_64bcf46b-fb32-45c0-9053-baa16dccf390.dat' hap2_input_0.fastqsanger &&  ln -s '/tmp/tmpba1za83k/files/f/6/0/dataset_f60e3690-d550-4638-907a-8bcaed8e6c0c.dat' hap2_input_1.fastqsanger &&  yak count -k31 -b32 -t${GALAXY_SLOTS:-1} -o hap1.yak hap1_input_0.fastqsanger hap1_input_1.fastqsanger && yak count -k31 -b32 -t${GALAXY_SLOTS:-1} -o hap2.yak hap2_input_0.fastqsanger hap2_input_1.fastqsanger && hifiasm -t ${GALAXY_SLOTS:-1} -o output -f 32 -a 4 -z 0 -m 10000000 -p 100000 -n 3 -x 0.8 -y 0.2   --hom-cov 21 -1 hap1.yak -2 hap2.yak -c 2 -d 5 --trio-dual    --primary input_0.fastq.gz 2> output.log  && mkdir noseq_files && mv *.noseq.gfa noseq_files

Exit Code:

```
0
```

Standard Error:

[M::worker_pipeline::0.248*1.00] processed 10 sequences; 0 distinct k-mers in the hash table
[M::worker_pipeline::0.288*1.00] processed 10 sequences; 0 distinct k-mers in the hash table
[M::main_count] 0 distinct k-mers after shrinking
[M::yak_ch_dump] dumpped the hash table to file 'hap1.yak'.
[M::main] Version: 0.1-r69-dirty
[M::main] CMD: yak count -k31 -b32 -t1 -o hap1.yak hap1_input_0.fastqsanger hap1_input_1.fastqsanger
[M::main] Real time: 0.289 sec; CPU: 0.289 sec; Peak RSS: 0.506 GB
[M::worker_pipeline::0.235*0.97] processed 10 sequences; 0 distinct k-mers in the hash table
[M::worker_pipeline::0.288*0.97] processed 10 sequences; 0 distinct k-mers in the hash table
[M::main_count] 0 distinct k-mers after shrinking
[M::yak_ch_dump] dumpped the hash table to file 'hap2.yak'.
[M::main] Version: 0.1-r69-dirty
[M::main] CMD: yak count -k31 -b32 -t1 -o hap2.yak hap2_input_0.fastqsanger hap2_input_1.fastqsanger
[M::main] Real time: 0.289 sec; CPU: 0.280 sec; Peak RSS: 0.508 GB

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"fastq.gz"`
__workflow_invocation_uuid__	`"68dc04ea9fe511ef82fd7b3c31f91d5d"`
advanced_options	`{"__current_case__": 0, "advanced_selector": "blank"}`
assembly_options	`{"__current_case__": 1, "adapter_length": "0", "assembly_selector": "set", "cleaning_rounds": "4", "disable_post_join": false, "hom_cov": "21", "ignore_error_corrected": false, "max_overlap": "0.8", "min_overlap": "0.2", "pop_contigs": "10000000", "pop_unitigs": "100000", "remove_tips": "3"}`
bins_out	`false`
chromInfo	`"/tmp/tmpba1za83k/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter_bits	`"32"`
hic_partition	`{"__current_case__": 0, "hic_partition_selector": "blank"}`
log_out	`true`
mode	`{"__current_case__": 1, "max_kmers": "2", "min_kmers": "5", "mode_selector": "trio", "reads": {"values": [{"id": 4, "src": "hdca"}]}, "trio_dual": true, "trioinput": {"__current_case__": 0, "hap1_reads": {"values": [{"id": 2, "src": "hdca"}]}, "hap2_reads": {"values": [{"id": 3, "src": "hdca"}]}, "trio_input_selector": "reads"}, "yak_kmer_length": "31"}`
ont_integration	`{"__current_case__": 0, "ont_integration_selector": "blank"}`
purge_options	`{"__current_case__": 0, "purge_selector": "blank"}`
scaffolding_options	`{"__current_case__": 0, "scaffold_selector": "blank"}`

Step 28: Estimated genome size:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"68dc04ea9fe511ef82fd7b3c31f91d5d"`
chromInfo	`"/tmp/tmpba1za83k/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
param_type	`"integer"`
remove_newlines	`true`

Step 29: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.9+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmpba1za83k/files/e/3/e/dataset_e3e1e724-bfe2-484a-ba88-c50e3df6a8be.dat' --discover-paths  -o dataset.gfa --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset

Exit Code:

```
0
```

Standard Output:

+++Assembly summary+++: 
# scaffolds: 81
Total scaffold length: 1988019
Average scaffold length: 24543.44
Scaffold N50: 22011
Scaffold auN: 34607.62
Scaffold L50: 29
Largest scaffold: 132684
Smallest scaffold: 15406
# contigs: 81
Total contig length: 1988019
Average contig length: 24543.44
Contig N50: 22011
Contig auN: 34607.62
Contig L50: 29
Largest contig: 132684
Smallest contig: 15406
# gaps in scaffolds: 0
Total gap length in scaffolds: 0
Average gap length in scaffolds: 0.00
Gap N50 in scaffolds: 0
Gap auN in scaffolds: 0.00
Gap L50 in scaffolds: 0
Largest gap in scaffolds: 0
Smallest gap in scaffolds: 0
Base composition (A:C:G:T): 606195:384545:388054:609225
GC content %: 38.86
# soft-masked bases: 0
# segments: 81
Total segment length: 1988019
Average segment length: 24543.44
# gaps: 0
# paths: 81
# edges: 4
Average degree: 0.05
# connected components: 1
Largest connected component length: 89366
# dead ends: 159
# disconnected components: 78
Total length disconnected components: 1898653
# separated components: 79
# bubbles: 0
# circular segments: 0
# circular paths: 0

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"68dc04ea9fe511ef82fd7b3c31f91d5d"`
chromInfo	`"/tmp/tmpba1za83k/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 4, "out_format": "gfa", "terminal_overlaps_condition": {"__current_case__": 0, "terminal_overlaps_select": "no"}}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 30: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.9+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmpba1za83k/files/a/6/a/dataset_a6a39355-6523-4f14-896c-a524bee6d7b7.dat' --discover-paths  -o dataset.gfa --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset

Exit Code:

```
0
```

Standard Output:

+++Assembly summary+++: 
# scaffolds: 27
Total scaffold length: 836724
Average scaffold length: 30989.78
Scaffold N50: 31085
Scaffold auN: 51544.22
Scaffold L50: 7
Largest scaffold: 132684
Smallest scaffold: 16240
# contigs: 27
Total contig length: 836724
Average contig length: 30989.78
Contig N50: 31085
Contig auN: 51544.22
Contig L50: 7
Largest contig: 132684
Smallest contig: 16240
# gaps in scaffolds: 0
Total gap length in scaffolds: 0
Average gap length in scaffolds: 0.00
Gap N50 in scaffolds: 0
Gap auN in scaffolds: 0.00
Gap L50 in scaffolds: 0
Largest gap in scaffolds: 0
Smallest gap in scaffolds: 0
Base composition (A:C:G:T): 252099:164572:166355:253698
GC content %: 39.55
# soft-masked bases: 0
# segments: 27
Total segment length: 836724
Average segment length: 30989.78
# gaps: 0
# paths: 27

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"68dc04ea9fe511ef82fd7b3c31f91d5d"`
chromInfo	`"/tmp/tmpba1za83k/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 4, "out_format": "gfa", "terminal_overlaps_condition": {"__current_case__": 0, "terminal_overlaps_select": "no"}}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 4: Meryl Database : Child:
- step_state: scheduled

Step 31: Raw Unitig Image:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -s '/tmp/tmpba1za83k/files/9/c/4/dataset_9c4bfabc-3c42-41c3-aa0c-37b8fe41a158.dat' input.gfa &&  export QT_QPA_PLATFORM='offscreen' && Bandage image input.gfa 'out.png' --height '2000' --nodewidth '25.0'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"68dc04ea9fe511ef82fd7b3c31f91d5d"`
chromInfo	`"/tmp/tmpba1za83k/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
fontsize	`None`
height	`"2000"`
lengths	`false`
names	`false`
nodewidth	`"25.0"`
output_format	`"png"`
width	`None`

Step 32: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.9+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmpba1za83k/files/e/3/e/dataset_e3e1e724-bfe2-484a-ba88-c50e3df6a8be.dat' --discover-paths  -o dataset.fasta --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset

Exit Code:

```
0
```

Standard Output:

+++Assembly summary+++: 
# scaffolds: 81
Total scaffold length: 1988019
Average scaffold length: 24543.44
Scaffold N50: 22011
Scaffold auN: 34607.62
Scaffold L50: 29
Largest scaffold: 132684
Smallest scaffold: 15406
# contigs: 81
Total contig length: 1988019
Average contig length: 24543.44
Contig N50: 22011
Contig auN: 34607.62
Contig L50: 29
Largest contig: 132684
Smallest contig: 15406
# gaps in scaffolds: 0
Total gap length in scaffolds: 0
Average gap length in scaffolds: 0.00
Gap N50 in scaffolds: 0
Gap auN in scaffolds: 0.00
Gap L50 in scaffolds: 0
Largest gap in scaffolds: 0
Smallest gap in scaffolds: 0
Base composition (A:C:G:T): 606195:384545:388054:609225
GC content %: 38.86
# soft-masked bases: 0
# segments: 81
Total segment length: 1988019
Average segment length: 24543.44
# gaps: 0
# paths: 81
# edges: 4
Average degree: 0.05
# connected components: 1
Largest connected component length: 89366
# dead ends: 159
# disconnected components: 78
Total length disconnected components: 1898653
# separated components: 79
# bubbles: 0
# circular segments: 0
# circular paths: 0

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"68dc04ea9fe511ef82fd7b3c31f91d5d"`
chromInfo	`"/tmp/tmpba1za83k/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 0, "line_length": null, "out_format": "fasta"}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 33: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.9+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmpba1za83k/files/a/6/a/dataset_a6a39355-6523-4f14-896c-a524bee6d7b7.dat' --discover-paths  -o dataset.fasta --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset

Exit Code:

```
0
```

Standard Output:

+++Assembly summary+++: 
# scaffolds: 27
Total scaffold length: 836724
Average scaffold length: 30989.78
Scaffold N50: 31085
Scaffold auN: 51544.22
Scaffold L50: 7
Largest scaffold: 132684
Smallest scaffold: 16240
# contigs: 27
Total contig length: 836724
Average contig length: 30989.78
Contig N50: 31085
Contig auN: 51544.22
Contig L50: 7
Largest contig: 132684
Smallest contig: 16240
# gaps in scaffolds: 0
Total gap length in scaffolds: 0
Average gap length in scaffolds: 0.00
Gap N50 in scaffolds: 0
Gap auN in scaffolds: 0.00
Gap L50 in scaffolds: 0
Largest gap in scaffolds: 0
Smallest gap in scaffolds: 0
Base composition (A:C:G:T): 252099:164572:166355:253698
GC content %: 39.55
# soft-masked bases: 0
# segments: 27
Total segment length: 836724
Average segment length: 30989.78
# gaps: 0
# paths: 27

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"68dc04ea9fe511ef82fd7b3c31f91d5d"`
chromInfo	`"/tmp/tmpba1za83k/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 0, "line_length": null, "out_format": "fasta"}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 34: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.9+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmpba1za83k/files/e/3/e/dataset_e3e1e724-bfe2-484a-ba88-c50e3df6a8be.dat' --out-size c  --discover-paths --tabular > '/tmp/tmpba1za83k/job_working_directory/000/28/outputs/dataset_54a27d83-21a1-49a9-80f2-652a9fbb5f0a.dat' --threads ${GALAXY_SLOTS:-8}

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"68dc04ea9fe511ef82fd7b3c31f91d5d"`
chromInfo	`"/tmp/tmpba1za83k/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 1, "discover_paths": true, "locale": false, "selector": "statistics", "statistics_condition": {"__current_case__": 0, "out_size": "c", "selector": "size"}, "tabular": true}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 35: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.9+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmpba1za83k/files/a/6/a/dataset_a6a39355-6523-4f14-896c-a524bee6d7b7.dat' --out-size c  --discover-paths --tabular > '/tmp/tmpba1za83k/job_working_directory/000/29/outputs/dataset_40eac5e9-a58c-47fe-bc5c-63ab738efb13.dat' --threads ${GALAXY_SLOTS:-8}

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"68dc04ea9fe511ef82fd7b3c31f91d5d"`
chromInfo	`"/tmp/tmpba1za83k/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 1, "discover_paths": true, "locale": false, "selector": "statistics", "statistics_condition": {"__current_case__": 0, "out_size": "c", "selector": "size"}, "tabular": true}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 36: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.9+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmpba1za83k/files/a/6/a/dataset_a6a39355-6523-4f14-896c-a524bee6d7b7.dat' 2288021 --nstar-report --locale en_US.UTF-8 --discover-paths --tabular > '/tmp/tmpba1za83k/job_working_directory/000/30/outputs/dataset_1f95b61e-d838-422b-b555-38319887e065.dat' --threads ${GALAXY_SLOTS:-8}

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"68dc04ea9fe511ef82fd7b3c31f91d5d"`
chromInfo	`"/tmp/tmpba1za83k/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 1, "discover_paths": true, "locale": true, "selector": "statistics", "statistics_condition": {"__current_case__": 2, "expected_genomesize": "2288021", "selector": "assembly"}, "tabular": true}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 37: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.9+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmpba1za83k/files/e/3/e/dataset_e3e1e724-bfe2-484a-ba88-c50e3df6a8be.dat' 2288021 --nstar-report --locale en_US.UTF-8 --discover-paths --tabular > '/tmp/tmpba1za83k/job_working_directory/000/31/outputs/dataset_03c4ed48-c0f3-42b6-ade0-17e23383403b.dat' --threads ${GALAXY_SLOTS:-8}

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"68dc04ea9fe511ef82fd7b3c31f91d5d"`
chromInfo	`"/tmp/tmpba1za83k/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 1, "discover_paths": true, "locale": true, "selector": "statistics", "statistics_condition": {"__current_case__": 2, "expected_genomesize": "2288021", "selector": "assembly"}, "tabular": true}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 38: toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.8.0+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

busco --in '/tmp/tmpba1za83k/files/d/a/b/dataset_dabfcbbf-79ee-4feb-8389-f41b2f240512.dat' --mode 'geno' --out busco_galaxy --cpu ${GALAXY_SLOTS:-4} --evalue 0.001 --limit 3 --contig_break 10  --offline --download_path /cvmfs/data.galaxyproject.org/byhand/busco/v5  --lineage_dataset 'vertebrata_odb10'  --miniprot  && mkdir BUSCO_summaries && ls -l busco_galaxy/run_*/ && cp busco_galaxy/short_summary.*.txt BUSCO_summaries/ && generate_plot.py -wd BUSCO_summaries -rt specific  && echo "##gff-version 3" > busco_output.gff && cat busco_galaxy/run_*/busco_sequences/*busco_sequences/*.gff >> busco_output.gff 2> /dev/null || true

Exit Code:

```
0
```

Standard Error:

2024-11-11 04:54:11 ERROR:	
Warning message:
The `size` argument of `element_line()` is deprecated as of ggplot2 3.4.0.
ℹ Please use the `linewidth` argument instead.

Standard Output:

2024-11-11 04:36:03 INFO:	***** Start a BUSCO v5.8.0 analysis, current time: 11/11/2024 04:36:03 *****
2024-11-11 04:36:03 INFO:	Configuring BUSCO with local environment
2024-11-11 04:36:03 INFO:	Running genome mode
2024-11-11 04:36:05 INFO:	Input file is /tmp/tmpba1za83k/files/d/a/b/dataset_dabfcbbf-79ee-4feb-8389-f41b2f240512.dat
2024-11-11 04:36:05 WARNING:	Option evalue was provided but is not used in the selected run mode, euk_genome_min
2024-11-11 04:36:05 WARNING:	Option limit was provided but is not used in the selected run mode, euk_genome_min
2024-11-11 04:36:05 INFO:	Running BUSCO using lineage dataset vertebrata_odb10 (eukaryota, 2021-02-19)
2024-11-11 04:36:05 INFO:	Running 1 job(s) on bbtools, starting at 11/11/2024 04:36:05
2024-11-11 04:36:07 INFO:	[bbtools]	1 of 1 task(s) completed
2024-11-11 04:36:07 INFO:	Running 1 job(s) on miniprot_index, starting at 11/11/2024 04:36:07
2024-11-11 04:36:07 INFO:	[miniprot_index]	1 of 1 task(s) completed
2024-11-11 04:36:07 INFO:	Running 1 job(s) on miniprot_align, starting at 11/11/2024 04:36:07
2024-11-11 04:53:30 INFO:	[miniprot_align]	1 of 1 task(s) completed
2024-11-11 04:53:37 INFO:	***** Run HMMER on gene sequences *****
2024-11-11 04:53:38 INFO:	Running 617 job(s) on hmmsearch, starting at 11/11/2024 04:53:38
2024-11-11 04:53:43 INFO:	[hmmsearch]	62 of 617 task(s) completed
2024-11-11 04:53:46 INFO:	[hmmsearch]	124 of 617 task(s) completed
2024-11-11 04:53:48 INFO:	[hmmsearch]	186 of 617 task(s) completed
2024-11-11 04:53:50 INFO:	[hmmsearch]	247 of 617 task(s) completed
2024-11-11 04:53:54 INFO:	[hmmsearch]	309 of 617 task(s) completed
2024-11-11 04:53:57 INFO:	[hmmsearch]	371 of 617 task(s) completed
2024-11-11 04:53:59 INFO:	[hmmsearch]	432 of 617 task(s) completed
2024-11-11 04:54:01 INFO:	[hmmsearch]	494 of 617 task(s) completed
2024-11-11 04:54:05 INFO:	[hmmsearch]	556 of 617 task(s) completed
2024-11-11 04:54:07 INFO:	[hmmsearch]	617 of 617 task(s) completed
2024-11-11 04:54:07 INFO:	48 exons in total
2024-11-11 04:54:07 WARNING:	2 of 38 Complete matches (5.3%) contain internal stop codons in Miniprot gene predictions
2024-11-11 04:54:07 WARNING:	BUSCO gene predictions from Miniprot have low average identity (0.46). You may want to repeat the analysis using the Metaeuk pipeline.
2024-11-11 04:54:08 INFO:	

    -------------------------------------------------------------------------------------------
    |Results from dataset vertebrata_odb10                                                     |
    -------------------------------------------------------------------------------------------
    |C:1.1%[S:1.1%,D:0.0%],F:0.1%,M:98.7%,n:3354,E:5.3%                                        |
    |38    Complete BUSCOs (C)    (of which 2 contain internal stop codons)                    |
    |37    Complete and single-copy BUSCOs (S)                                                 |
    |1    Complete and duplicated BUSCOs (D)                                                   |
    |4    Fragmented BUSCOs (F)                                                                |
    |3312    Missing BUSCOs (M)                                                                |
    |3354    Total BUSCO groups searched                                                       |
    -------------------------------------------------------------------------------------------
2024-11-11 04:54:08 INFO:	BUSCO analysis done with WARNING(s). Total running time: 1082 seconds

***** Summary of warnings: *****
2024-11-11 04:36:05 WARNING:busco.BuscoConfig	Option evalue was provided but is not used in the selected run mode, euk_genome_min
2024-11-11 04:36:05 WARNING:busco.BuscoConfig	Option limit was provided but is not used in the selected run mode, euk_genome_min
2024-11-11 04:54:07 WARNING:busco.busco_tools.hmmer	2 of 38 Complete matches (5.3%) contain internal stop codons in Miniprot gene predictions
2024-11-11 04:54:07 WARNING:busco.busco_tools.hmmer	BUSCO gene predictions from Miniprot have low average identity (0.46). You may want to repeat the analysis using the Metaeuk pipeline.

2024-11-11 04:54:08 INFO:	Results written in /tmp/tmpba1za83k/job_working_directory/000/32/working/busco_galaxy
2024-11-11 04:54:08 INFO:	For assistance with interpreting the results, please consult the userguide: https://busco.ezlab.org/busco_userguide.html

2024-11-11 04:54:08 INFO:	Visit this page https://gitlab.com/ezlab/busco#how-to-cite-busco to see how to cite BUSCO
total 156
drwxr-xr-x 5 1001 127  4096 Nov 11 04:36 busco_sequences
-rw-r--r-- 1 1001 127 75300 Nov 11 04:54 full_table.tsv
drwxr-xr-x 2 1001 127 20480 Nov 11 04:54 hmmer_output
drwxr-xr-x 3 1001 127  4096 Nov 11 04:53 miniprot_output
-rw-r--r-- 1 1001 127 42493 Nov 11 04:54 missing_busco_list.tsv
-rw-r--r-- 1 1001 127  2869 Nov 11 04:54 short_summary.json
-rw-r--r-- 1 1001 127  1051 Nov 11 04:54 short_summary.txt
2024-11-11 04:54:09 INFO:	****************** Start plot generation at 11/11/2024 04:54:09 ******************
2024-11-11 04:54:09 INFO:	Load data ...
2024-11-11 04:54:09 INFO:	Loaded BUSCO_summaries/short_summary.specific.vertebrata_odb10.busco_galaxy.txt successfully
2024-11-11 04:54:09 INFO:	Generate the R code ...
2024-11-11 04:54:09 INFO:	Run the R code ...
2024-11-11 04:54:11 INFO:	
[1] "Plotting the figure ..."
[1] "Done"

2024-11-11 04:54:11 INFO:	Plot generation done. Total running time: 2.0429978370666504 seconds
2024-11-11 04:54:11 INFO:	Results written in BUSCO_summaries/

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"68dc04ea9fe511ef82fd7b3c31f91d5d"`
adv	`{"contig_break": "10", "evalue": "0.001", "limit": "3"}`
busco_mode	`{"__current_case__": 0, "mode": "geno", "use_augustus": {"__current_case__": 1, "use_augustus_selector": "miniprot"}}`
chromInfo	`"/tmp/tmpba1za83k/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
lineage	`{"__current_case__": 1, "lineage_dataset": "vertebrata_odb10", "lineage_mode": "select_lineage"}`
lineage_conditional	`{"__current_case__": 0, "cached_db": "v5", "selector": "cached"}`
outputs	`["short_summary", "missing", "image", "gff"]`

Step 39: toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.8.0+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

busco --in '/tmp/tmpba1za83k/files/0/9/b/dataset_09ba0b6f-7bdd-441d-892e-83e5025964ee.dat' --mode 'geno' --out busco_galaxy --cpu ${GALAXY_SLOTS:-4} --evalue 0.001 --limit 3 --contig_break 10  --offline --download_path /cvmfs/data.galaxyproject.org/byhand/busco/v5  --lineage_dataset 'vertebrata_odb10'  --miniprot  && mkdir BUSCO_summaries && ls -l busco_galaxy/run_*/ && cp busco_galaxy/short_summary.*.txt BUSCO_summaries/ && generate_plot.py -wd BUSCO_summaries -rt specific  && echo "##gff-version 3" > busco_output.gff && cat busco_galaxy/run_*/busco_sequences/*busco_sequences/*.gff >> busco_output.gff 2> /dev/null || true

Exit Code:

```
0
```

Standard Error:

2024-11-11 04:46:48 ERROR:	
Warning message:
The `size` argument of `element_line()` is deprecated as of ggplot2 3.4.0.
ℹ Please use the `linewidth` argument instead.

Standard Output:

2024-11-11 04:36:03 INFO:	***** Start a BUSCO v5.8.0 analysis, current time: 11/11/2024 04:36:03 *****
2024-11-11 04:36:03 INFO:	Configuring BUSCO with local environment
2024-11-11 04:36:03 INFO:	Running genome mode
2024-11-11 04:36:05 INFO:	Input file is /tmp/tmpba1za83k/files/0/9/b/dataset_09ba0b6f-7bdd-441d-892e-83e5025964ee.dat
2024-11-11 04:36:05 WARNING:	Option evalue was provided but is not used in the selected run mode, euk_genome_min
2024-11-11 04:36:05 WARNING:	Option limit was provided but is not used in the selected run mode, euk_genome_min
2024-11-11 04:36:05 INFO:	Running BUSCO using lineage dataset vertebrata_odb10 (eukaryota, 2021-02-19)
2024-11-11 04:36:05 INFO:	Running 1 job(s) on bbtools, starting at 11/11/2024 04:36:05
2024-11-11 04:36:07 INFO:	[bbtools]	1 of 1 task(s) completed
2024-11-11 04:36:07 INFO:	Running 1 job(s) on miniprot_index, starting at 11/11/2024 04:36:07
2024-11-11 04:36:07 INFO:	[miniprot_index]	1 of 1 task(s) completed
2024-11-11 04:36:07 INFO:	Running 1 job(s) on miniprot_align, starting at 11/11/2024 04:36:07
2024-11-11 04:46:08 INFO:	[miniprot_align]	1 of 1 task(s) completed
2024-11-11 04:46:10 INFO:	***** Run HMMER on gene sequences *****
2024-11-11 04:46:11 INFO:	Running 383 job(s) on hmmsearch, starting at 11/11/2024 04:46:11
2024-11-11 04:46:16 INFO:	[hmmsearch]	39 of 383 task(s) completed
2024-11-11 04:46:19 INFO:	[hmmsearch]	77 of 383 task(s) completed
2024-11-11 04:46:22 INFO:	[hmmsearch]	115 of 383 task(s) completed
2024-11-11 04:46:25 INFO:	[hmmsearch]	154 of 383 task(s) completed
2024-11-11 04:46:29 INFO:	[hmmsearch]	192 of 383 task(s) completed
2024-11-11 04:46:32 INFO:	[hmmsearch]	230 of 383 task(s) completed
2024-11-11 04:46:35 INFO:	[hmmsearch]	269 of 383 task(s) completed
2024-11-11 04:46:38 INFO:	[hmmsearch]	307 of 383 task(s) completed
2024-11-11 04:46:41 INFO:	[hmmsearch]	345 of 383 task(s) completed
2024-11-11 04:46:45 INFO:	[hmmsearch]	383 of 383 task(s) completed
2024-11-11 04:46:45 INFO:	14 exons in total
2024-11-11 04:46:45 WARNING:	1 of 10 Complete matches (10.0%) contain internal stop codons in Miniprot gene predictions
2024-11-11 04:46:45 INFO:	

    -------------------------------------------------------------------------------------------
    |Results from dataset vertebrata_odb10                                                     |
    -------------------------------------------------------------------------------------------
    |C:0.3%[S:0.3%,D:0.0%],F:0.0%,M:99.7%,n:3354,E:10.0%                                       |
    |10    Complete BUSCOs (C)    (of which 1 contain internal stop codons)                    |
    |9    Complete and single-copy BUSCOs (S)                                                  |
    |1    Complete and duplicated BUSCOs (D)                                                   |
    |1    Fragmented BUSCOs (F)                                                                |
    |3343    Missing BUSCOs (M)                                                                |
    |3354    Total BUSCO groups searched                                                       |
    -------------------------------------------------------------------------------------------
2024-11-11 04:46:45 INFO:	BUSCO analysis done with WARNING(s). Total running time: 640 seconds

***** Summary of warnings: *****
2024-11-11 04:36:05 WARNING:busco.BuscoConfig	Option evalue was provided but is not used in the selected run mode, euk_genome_min
2024-11-11 04:36:05 WARNING:busco.BuscoConfig	Option limit was provided but is not used in the selected run mode, euk_genome_min
2024-11-11 04:46:45 WARNING:busco.busco_tools.hmmer	1 of 10 Complete matches (10.0%) contain internal stop codons in Miniprot gene predictions

2024-11-11 04:46:45 INFO:	Results written in /tmp/tmpba1za83k/job_working_directory/000/33/working/busco_galaxy
2024-11-11 04:46:45 INFO:	For assistance with interpreting the results, please consult the userguide: https://busco.ezlab.org/busco_userguide.html

2024-11-11 04:46:45 INFO:	Visit this page https://gitlab.com/ezlab/busco#how-to-cite-busco to see how to cite BUSCO
total 152
drwxr-xr-x 5 1001 127  4096 Nov 11 04:36 busco_sequences
-rw-r--r-- 1 1001 127 71390 Nov 11 04:46 full_table.tsv
drwxr-xr-x 2 1001 127 20480 Nov 11 04:46 hmmer_output
drwxr-xr-x 3 1001 127  4096 Nov 11 04:46 miniprot_output
-rw-r--r-- 1 1001 127 42890 Nov 11 04:46 missing_busco_list.tsv
-rw-r--r-- 1 1001 127  2867 Nov 11 04:46 short_summary.json
-rw-r--r-- 1 1001 127  1050 Nov 11 04:46 short_summary.txt
2024-11-11 04:46:46 INFO:	****************** Start plot generation at 11/11/2024 04:46:46 ******************
2024-11-11 04:46:46 INFO:	Load data ...
2024-11-11 04:46:46 INFO:	Loaded BUSCO_summaries/short_summary.specific.vertebrata_odb10.busco_galaxy.txt successfully
2024-11-11 04:46:46 INFO:	Generate the R code ...
2024-11-11 04:46:46 INFO:	Run the R code ...
2024-11-11 04:46:48 INFO:	
[1] "Plotting the figure ..."
[1] "Done"

2024-11-11 04:46:48 INFO:	Plot generation done. Total running time: 2.118044853210449 seconds
2024-11-11 04:46:48 INFO:	Results written in BUSCO_summaries/

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"68dc04ea9fe511ef82fd7b3c31f91d5d"`
adv	`{"contig_break": "10", "evalue": "0.001", "limit": "3"}`
busco_mode	`{"__current_case__": 0, "mode": "geno", "use_augustus": {"__current_case__": 1, "use_augustus_selector": "miniprot"}}`
chromInfo	`"/tmp/tmpba1za83k/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
lineage	`{"__current_case__": 1, "lineage_dataset": "vertebrata_odb10", "lineage_mode": "select_lineage"}`
lineage_conditional	`{"__current_case__": 0, "cached_db": "v5", "selector": "cached"}`
outputs	`["short_summary", "missing", "image", "gff"]`

Step 40: toolshed.g2.bx.psu.edu/repos/iuc/merqury/merqury/1.3+galaxy4:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

mkdir -p output_files && mkdir -p read-db.meryl pat.meryl mat.meryl && tar -zxf /tmp/tmpba1za83k/files/1/f/4/dataset_1f45efae-23b9-4e93-821a-013a4b5e79e8.dat -C read-db.meryl --strip-components=1 && tar -zxf /tmp/tmpba1za83k/files/4/8/8/dataset_4884fee1-0bf4-463d-99bb-df49a2d8c8ee.dat -C pat.meryl --strip-components=1 && tar -zxf /tmp/tmpba1za83k/files/7/1/f/dataset_71fa8912-72a5-4fb8-a581-1aaf63ad9cea.dat -C mat.meryl --strip-components=1 && ln -s '/tmp/tmpba1za83k/files/d/a/b/dataset_dabfcbbf-79ee-4feb-8389-f41b2f240512.dat' assembly_01.fasta && ln -s '/tmp/tmpba1za83k/files/0/9/b/dataset_09ba0b6f-7bdd-441d-892e-83e5025964ee.dat' assembly_02.fasta && merqury.sh read-db.meryl pat.meryl mat.meryl assembly_01.fasta assembly_02.fasta output_merqury &> /tmp/tmpba1za83k/job_working_directory/000/34/outputs/dataset_156a74ae-143a-4b8c-b8b9-c43cc522caee.dat && mv output_merqury* output_files && find . -maxdepth 1 -name 'assembly_only*' -type f -print0 | xargs -0r mv -t output_files  && sed -i '1s/^/assembly\tk-mer set\tsolid k-mers in assembly\tsolid k-mers in reads\tcompleteness %\n/' 'output_files/output_merqury.completeness.stats' && sed -i '1s/^/assembly\tunique k-mers\tcommon k-mers\tQV\terror rate\n/' 'output_files/output_merqury.qv'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"68dc04ea9fe511ef82fd7b3c31f91d5d"`
chromInfo	`"/tmp/tmpba1za83k/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
label	`"output_merqury"`
mode	`{"__current_case__": 1, "assembly_options": {"__current_case__": 1, "assembly_01": {"values": [{"id": 33, "src": "hda"}]}, "assembly_02": {"values": [{"id": 34, "src": "hda"}]}, "number_assemblies": "two"}, "meryldb_F1": {"values": [{"id": 1, "src": "hda"}]}, "meryldb_MAT": {"values": [{"id": 3, "src": "hda"}]}, "meryldb_PAT": {"values": [{"id": 2, "src": "hda"}]}, "options": "trio"}`
output_add_headers	`true`
output_selector	`["qv", "plots", "sizes", "stats", "bed", "wig", "log", "hist"]`

Step 5: Hapmer Database : Paternal:
- step_state: scheduled

Step 41: Data prep Hap1:

step_state: scheduled

Subworkflow Steps

Step 1: gfa_stats:
- step_state: scheduled

Step 2: sort1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/tmpba1za83k/galaxy-dev/tools/filters/sorter.py'  --input='/tmp/tmpba1za83k/files/5/4/a/dataset_54a27d83-21a1-49a9-80f2-652a9fbb5f0a.dat' --output='/tmp/tmpba1za83k/job_working_directory/000/35/outputs/dataset_9c487ac7-a556-41bc-98b3-b6f17c6f9cab.dat'    --key=2,2nr   --header 0

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"68dc04eb9fe511ef82fd7b3c31f91d5d"`
chromInfo	`"/tmp/tmpba1za83k/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
column	`"2"`
column_set	`[]`
dbkey	`"?"`
header_lines	`"0"`
order	`"DESC"`
style	`"num"`

Step 3: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmpba1za83k/job_working_directory/000/36/configs/tmp99kdu0qf' '/tmp/tmpba1za83k/files/9/c/4/dataset_9c487ac7-a556-41bc-98b3-b6f17c6f9cab.dat' > '/tmp/tmpba1za83k/job_working_directory/000/36/outputs/dataset_aa6cdf2c-d1da-494d-a9f3-580f78968929.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"68dc04eb9fe511ef82fd7b3c31f91d5d"`
chromInfo	`"/tmp/tmpba1za83k/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
code	`"{total += $2; $3 = total}1"`
dbkey	`"?"`

Step 4: toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.8+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

datamash         absmax 3 < /tmp/tmpba1za83k/files/a/a/6/dataset_aa6cdf2c-d1da-494d-a9f3-580f78968929.dat > '/tmp/tmpba1za83k/job_working_directory/000/37/outputs/dataset_bc76f9f9-d534-4ec6-b8f0-1613222bedb4.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"68dc04eb9fe511ef82fd7b3c31f91d5d"`
chromInfo	`"/tmp/tmpba1za83k/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
grouping	`""`
header_in	`false`
header_out	`false`
ignore_case	`false`
narm	`false`
need_sort	`false`
operations	`[{"__index__": 0, "op_column": "3", "op_name": "absmax"}]`
print_full_line	`false`

Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpba1za83k/files/a/a/6/dataset_aa6cdf2c-d1da-494d-a9f3-580f78968929.dat" "/tmp/tmpba1za83k/job_working_directory/000/38/outputs/dataset_0c1e76f6-4a4d-4212-8a79-0920038eafa0.dat" "1" "yes"

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"68dc04eb9fe511ef82fd7b3c31f91d5d"`
chromInfo	`"/tmp/tmpba1za83k/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
exp	`"1"`
iterate	`"yes"`

Step 6: param_value_from_file:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"68dc04eb9fe511ef82fd7b3c31f91d5d"`
chromInfo	`"/tmp/tmpba1za83k/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
param_type	`"integer"`
remove_newlines	`true`

Step 7: toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"68dc04eb9fe511ef82fd7b3c31f91d5d"`
chromInfo	`"/tmp/tmpba1za83k/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
components	`[{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "c3/", "select_param_type": "text"}}, {"__index__": 1, "param_type": {"__current_case__": 1, "component_value": "1988019", "select_param_type": "integer"}}]`
dbkey	`"?"`

Step 8: toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types str,int,int,int  --file '/tmp/tmpba1za83k/job_working_directory/000/58/configs/tmp3jyobe_1' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmpba1za83k/files/0/c/1/dataset_0c1e76f6-4a4d-4212-8a79-0920038eafa0.dat' '/tmp/tmpba1za83k/job_working_directory/000/58/outputs/dataset_91cc5265-7a4e-4029-983e-ad2cef79a919.dat'

Exit Code:

```
0
```

Standard Output:

c3/1988019
c2/1000000
c3/1000000
Computing 3 new columns with instructions ['c3/1988019;;', 'c2/1000000;;', 'c3/1000000;;']
Computed new column values for 100.00% of 81 lines written.

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"68dc04eb9fe511ef82fd7b3c31f91d5d"`
avoid_scientific_notation	`false`
chromInfo	`"/tmp/tmpba1za83k/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
error_handling	`{"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}}`
ops	`{"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1988019"}, {"__index__": 1, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c2/1000000"}, {"__index__": 2, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1000000"}], "header_lines_select": "no"}`

Step 42: Data Prep Hap2:

step_state: scheduled

Subworkflow Steps

Step 1: gfa_stats:
- step_state: scheduled

Step 2: sort1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/tmpba1za83k/galaxy-dev/tools/filters/sorter.py'  --input='/tmp/tmpba1za83k/files/4/0/e/dataset_40eac5e9-a58c-47fe-bc5c-63ab738efb13.dat' --output='/tmp/tmpba1za83k/job_working_directory/000/40/outputs/dataset_5c1d1bd8-5492-42b4-b31c-3efa57afb6b7.dat'    --key=2,2nr   --header 0

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"68dc04ec9fe511ef82fd7b3c31f91d5d"`
chromInfo	`"/tmp/tmpba1za83k/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
column	`"2"`
column_set	`[]`
dbkey	`"?"`
header_lines	`"0"`
order	`"DESC"`
style	`"num"`

Step 3: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmpba1za83k/job_working_directory/000/41/configs/tmpcjzqe5os' '/tmp/tmpba1za83k/files/5/c/1/dataset_5c1d1bd8-5492-42b4-b31c-3efa57afb6b7.dat' > '/tmp/tmpba1za83k/job_working_directory/000/41/outputs/dataset_c4b4c4e8-d86c-4ff3-a136-a05935ac1c73.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"68dc04ec9fe511ef82fd7b3c31f91d5d"`
chromInfo	`"/tmp/tmpba1za83k/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
code	`"{total += $2; $3 = total}1"`
dbkey	`"?"`

Step 4: toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.8+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

datamash         absmax 3 < /tmp/tmpba1za83k/files/c/4/b/dataset_c4b4c4e8-d86c-4ff3-a136-a05935ac1c73.dat > '/tmp/tmpba1za83k/job_working_directory/000/42/outputs/dataset_db1b2eb4-f9d0-4e62-a896-34983316f9e4.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"68dc04ec9fe511ef82fd7b3c31f91d5d"`
chromInfo	`"/tmp/tmpba1za83k/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
grouping	`""`
header_in	`false`
header_out	`false`
ignore_case	`false`
narm	`false`
need_sort	`false`
operations	`[{"__index__": 0, "op_column": "3", "op_name": "absmax"}]`
print_full_line	`false`

Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpba1za83k/files/c/4/b/dataset_c4b4c4e8-d86c-4ff3-a136-a05935ac1c73.dat" "/tmp/tmpba1za83k/job_working_directory/000/43/outputs/dataset_79f20f59-128d-4ac8-a2f2-08f302be02a6.dat" "1" "yes"

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"68dc04ec9fe511ef82fd7b3c31f91d5d"`
chromInfo	`"/tmp/tmpba1za83k/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
exp	`"1"`
iterate	`"yes"`

Step 6: param_value_from_file:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"68dc04ec9fe511ef82fd7b3c31f91d5d"`
chromInfo	`"/tmp/tmpba1za83k/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
param_type	`"integer"`
remove_newlines	`true`

Step 7: toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"68dc04ec9fe511ef82fd7b3c31f91d5d"`
chromInfo	`"/tmp/tmpba1za83k/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
components	`[{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "c3/", "select_param_type": "text"}}, {"__index__": 1, "param_type": {"__current_case__": 1, "component_value": "836724", "select_param_type": "integer"}}]`
dbkey	`"?"`

Step 8: toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types str,int,int,int  --file '/tmp/tmpba1za83k/job_working_directory/000/59/configs/tmpya29ty5_' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmpba1za83k/files/7/9/f/dataset_79f20f59-128d-4ac8-a2f2-08f302be02a6.dat' '/tmp/tmpba1za83k/job_working_directory/000/59/outputs/dataset_05c6d860-7cae-4664-83b6-680490eee61d.dat'

Exit Code:

```
0
```

Standard Output:

c3/836724
c2/1000000
c3/1000000
Computing 3 new columns with instructions ['c3/836724;;', 'c2/1000000;;', 'c3/1000000;;']
Computed new column values for 100.00% of 27 lines written.

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"68dc04ec9fe511ef82fd7b3c31f91d5d"`
avoid_scientific_notation	`false`
chromInfo	`"/tmp/tmpba1za83k/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
error_handling	`{"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}}`
ops	`{"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/836724"}, {"__index__": 1, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c2/1000000"}, {"__index__": 2, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1000000"}], "header_lines_select": "no"}`

Step 43: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmpba1za83k/job_working_directory/000/45/configs/tmpbyu6zoz6' '/tmp/tmpba1za83k/files/1/f/9/dataset_1f95b61e-d838-422b-b555-38319887e065.dat' > '/tmp/tmpba1za83k/job_working_directory/000/45/outputs/dataset_2d84b215-cacb-45db-a2c3-55c4e5b2e2d0.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"68dc04ea9fe511ef82fd7b3c31f91d5d"`
chromInfo	`"/tmp/tmpba1za83k/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
code	`"BEGIN{print \"Metric\\thap2-Maternal\"}; {print}; "`
dbkey	`"?"`

Step 44: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmpba1za83k/job_working_directory/000/46/configs/tmpbbmfblyh' '/tmp/tmpba1za83k/files/0/3/c/dataset_03c4ed48-c0f3-42b6-ade0-17e23383403b.dat' > '/tmp/tmpba1za83k/job_working_directory/000/46/outputs/dataset_53f36822-f6ad-4589-a0f1-6e9e2b2401b1.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"68dc04ea9fe511ef82fd7b3c31f91d5d"`
chromInfo	`"/tmp/tmpba1za83k/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
code	`"BEGIN{print \"Metric\\thap1-Paternal\"}; {print}; "`
dbkey	`"?"`

Step 45: merqury_qv:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"68dc04ea9fe511ef82fd7b3c31f91d5d"`
input	`{"values": [{"id": 10, "src": "hdca"}]}`
which	`{"__current_case__": 1, "identifier": "output_merqury", "which_dataset": "by_identifier"}`

Step 46: output_merqury.spectra-cn.fl:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"68dc04ea9fe511ef82fd7b3c31f91d5d"`
input	`{"values": [{"id": 11, "src": "hdca"}]}`
which	`{"__current_case__": 1, "identifier": "output_merqury.spectra-cn.fl", "which_dataset": "by_identifier"}`

Step 47: output_merqury.spectra-asm.fl:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"68dc04ea9fe511ef82fd7b3c31f91d5d"`
input	`{"values": [{"id": 11, "src": "hdca"}]}`
which	`{"__current_case__": 1, "identifier": "output_merqury.spectra-asm.fl", "which_dataset": "by_identifier"}`

Step 48: output_merqury.assembly_01.spectra-cn.fl:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"68dc04ea9fe511ef82fd7b3c31f91d5d"`
input	`{"values": [{"id": 11, "src": "hdca"}]}`
which	`{"__current_case__": 1, "identifier": "output_merqury.assembly_01.spectra-cn.fl", "which_dataset": "by_identifier"}`

Step 49: output_merqury.assembly_02.spectra-cn.fl:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"68dc04ea9fe511ef82fd7b3c31f91d5d"`
input	`{"values": [{"id": 11, "src": "hdca"}]}`
which	`{"__current_case__": 1, "identifier": "output_merqury.assembly_02.spectra-cn.fl", "which_dataset": "by_identifier"}`

Step 50: merqury_stats:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"68dc04ea9fe511ef82fd7b3c31f91d5d"`
input	`{"values": [{"id": 13, "src": "hdca"}]}`
which	`{"__current_case__": 1, "identifier": "output_merqury.completeness", "which_dataset": "by_identifier"}`

Step 6: Hapmer Database : Maternal:
- step_state: scheduled

Step 51: Plots:

step_state: scheduled

Subworkflow Steps

Step 1: Primary data:
- step_state: scheduled
Step 2: Alternate data:
- step_state: scheduled

Step 11: Size Plot:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

cat '/tmp/tmpba1za83k/job_working_directory/000/66/configs/tmp6ledaj3_' && Rscript '/tmp/tmpba1za83k/job_working_directory/000/66/configs/tmp6ledaj3_'

Exit Code:

```
0
```

Standard Error:

Warning message:
In Sys.setlocale("LC_MESSAGES", "en_US.UTF-8") :
  OS reports request to set locale to "en_US.UTF-8" cannot be honored
Warning message:
package ‘ggplot2’ was built under R version 4.1.3 
Warning message:
Using `size` aesthetic for lines was deprecated in ggplot2 3.4.0.
ℹ Please use `linewidth` instead.

Standard Output:

        options(show.error.messages=F, error=function(){cat(geterrmessage(), file=stderr()); q("no",1,F)})

        loc <- Sys.setlocale("LC_MESSAGES", "en_US.UTF-8")
    

library(ggplot2)


        #Choose between automatically scaled x and y axis or user defined
            gg_scalex = NULL
            gg_scaley = NULL
    


            gg_theme = theme_bw()
    


            gg_legend = theme(legend.position="right")
    

input <- read.csv('/tmp/tmpba1za83k/files/3/e/5/dataset_3e58ef3d-8ab5-4866-b3b7-7a40f620792d.dat', sep='\t', header=TRUE)

names(input)[2] <- "xcol"
names(input)[3] <- "ycol"

    gg_facet = NULL
    gg_factor = aes(colour=factor(factor))

        gg_line = geom_line(size=1, alpha=1, gg_factor)

        color_scale = scale_color_brewer(palette='Set1', direction='1')

    names(input)[1] <- "factor"


    

    gg_axistitle = theme(axis.title = element_text(color = NULL, size = NULL, face = NULL))

    gg_axistext = theme(axis.text = element_text(color = NULL, size = NULL, face = NULL))

    gg_plottitle = theme(plot.title = element_text(color = NULL, size = NULL, face = NULL))

    gg_gridline = NULL

    gg_point = NULL

#this is the actual ggplot command to make the final plot(s)
plot_out <- ggplot(input, aes(xcol, ycol)) + gg_point + gg_line + gg_facet +
    gg_theme + gg_scalex + gg_scaley + color_scale + gg_legend + ggtitle('') + xlab('Scaffold number') + ylab('Cumulative Size (Mb)')+
    gg_axistitle + gg_axistext + gg_plottitle + gg_gridline


        gg_width <- as.double('6.0')
        gg_height <- as.double('4.0')
        gg_unit <- 'in'
        gg_dpi <- as.double('300.0')
        gg_add_device <- 'none'
        output1 <- '/tmp/tmpba1za83k/job_working_directory/000/66/outputs/dataset_6356ef32-9eb0-41f5-9234-5aa59b42c9cd.dat'
        output2 <- 'XXXX'

        ggsave(filename = output1, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = "png")
        if(gg_add_device != "none"){
          ggsave(filename = output2, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = gg_add_device)
        }

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"68dc04ed9fe511ef82fd7b3c31f91d5d"`
adv	{"axis_text_customization": {"__current_case__": 0, "axis_customization": "default"}, "axis_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "factor": {"__current_case__": 1, "colororder": "1", "colors": "Set1", "factorcol": "1", "factoring": "Single"}, "gridlinecust": "default", "legend": "yes", "plot_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "scaling": {"__current_case__": 0, "plot_scaling": "Automatic"}, "theme": "bw", "transform": "none", "type_conditional": {"__current_case__": 2, "type_options": "lines"}}
chromInfo	`"/tmp/tmpba1za83k/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
out	`{"additional_output_format": "none", "dpi_output_dim": "300.0", "height_output_dim": "4.0", "unit_output_dim": "in", "width_output_dim": "6.0"}`
title	`""`
xlab	`"Scaffold number"`
xplot	`"2"`
ylab	`"Cumulative Size (Mb)"`
yplot	`"3"`

Step 3: Name of primary assembly:
- step_state: scheduled
Step 4: Name of alternate assembly:
- step_state: scheduled

Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpba1za83k/files/9/1/c/dataset_91cc5265-7a4e-4029-983e-ad2cef79a919.dat" "/tmp/tmpba1za83k/job_working_directory/000/60/outputs/dataset_3c560fcf-1b0b-43fd-ba16-7247a40100c6.dat" "Hap1" "no"

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"68dc04ed9fe511ef82fd7b3c31f91d5d"`
chromInfo	`"/tmp/tmpba1za83k/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
exp	`"Hap1"`
iterate	`"no"`

Step 6: toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpba1za83k/files/0/5/c/dataset_05c6d860-7cae-4664-83b6-680490eee61d.dat" "/tmp/tmpba1za83k/job_working_directory/000/61/outputs/dataset_bf43a921-9c21-450c-bb90-35d8b333eb93.dat" "Hap2" "no"

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"68dc04ed9fe511ef82fd7b3c31f91d5d"`
chromInfo	`"/tmp/tmpba1za83k/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
exp	`"Hap2"`
iterate	`"no"`

Step 7: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cat/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

cat '/tmp/tmpba1za83k/files/3/c/5/dataset_3c560fcf-1b0b-43fd-ba16-7247a40100c6.dat' >> '/tmp/tmpba1za83k/job_working_directory/000/62/outputs/dataset_c2e6b7fc-6d06-4ec3-a6cc-f12091f48de3.dat' && cat '/tmp/tmpba1za83k/files/b/f/4/dataset_bf43a921-9c21-450c-bb90-35d8b333eb93.dat' >> '/tmp/tmpba1za83k/job_working_directory/000/62/outputs/dataset_c2e6b7fc-6d06-4ec3-a6cc-f12091f48de3.dat' && exit 0

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"68dc04ed9fe511ef82fd7b3c31f91d5d"`
chromInfo	`"/tmp/tmpba1za83k/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
queries	`[{"__index__": 0, "inputs2": {"values": [{"id": 143, "src": "hda"}]}}]`

Step 8: Cut1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl '/tmp/tmpba1za83k/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpba1za83k/files/c/2/e/dataset_c2e6b7fc-6d06-4ec3-a6cc-f12091f48de3.dat' 'c8,c5,c6' T '/tmp/tmpba1za83k/job_working_directory/000/63/outputs/dataset_480c9b10-8805-4210-bd61-13ef1cade38f.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"68dc04ed9fe511ef82fd7b3c31f91d5d"`
chromInfo	`"/tmp/tmpba1za83k/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
columnList	`"c8,c5,c6"`
dbkey	`"?"`
delimiter	`"T"`

Step 9: Cut1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl '/tmp/tmpba1za83k/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpba1za83k/files/c/2/e/dataset_c2e6b7fc-6d06-4ec3-a6cc-f12091f48de3.dat' 'c8,c4,c7' T '/tmp/tmpba1za83k/job_working_directory/000/64/outputs/dataset_3e58ef3d-8ab5-4866-b3b7-7a40f620792d.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"68dc04ed9fe511ef82fd7b3c31f91d5d"`
chromInfo	`"/tmp/tmpba1za83k/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
columnList	`"c8,c4,c7"`
dbkey	`"?"`
delimiter	`"T"`

Step 10: Nx Plot:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

cat '/tmp/tmpba1za83k/job_working_directory/000/65/configs/tmpdikls7rv' && Rscript '/tmp/tmpba1za83k/job_working_directory/000/65/configs/tmpdikls7rv'

Exit Code:

```
0
```

Standard Error:

Warning message:
In Sys.setlocale("LC_MESSAGES", "en_US.UTF-8") :
  OS reports request to set locale to "en_US.UTF-8" cannot be honored
Warning message:
package ‘ggplot2’ was built under R version 4.1.3 
Warning message:
Using `size` aesthetic for lines was deprecated in ggplot2 3.4.0.
ℹ Please use `linewidth` instead.

Standard Output:

        options(show.error.messages=F, error=function(){cat(geterrmessage(), file=stderr()); q("no",1,F)})

        loc <- Sys.setlocale("LC_MESSAGES", "en_US.UTF-8")
    

library(ggplot2)


        #Choose between automatically scaled x and y axis or user defined
            gg_scalex = NULL
            gg_scaley = NULL
    


            gg_theme = theme_bw()
    


            gg_legend = theme(legend.position="right")
    

input <- read.csv('/tmp/tmpba1za83k/files/4/8/0/dataset_480c9b10-8805-4210-bd61-13ef1cade38f.dat', sep='\t', header=TRUE)

names(input)[2] <- "xcol"
names(input)[3] <- "ycol"

    gg_facet = NULL
    gg_factor = aes(colour=factor(factor))

        gg_line = geom_line(size=1, alpha=1, gg_factor)

        color_scale = scale_color_brewer(palette='Set1', direction='1')

    names(input)[1] <- "factor"


    

    gg_axistitle = theme(axis.title = element_text(color = NULL, size = NULL, face = NULL))

    gg_axistext = theme(axis.text = element_text(color = NULL, size = NULL, face = NULL))

    gg_plottitle = theme(plot.title = element_text(color = NULL, size = NULL, face = NULL))

    gg_gridline = NULL

    gg_point = NULL

#this is the actual ggplot command to make the final plot(s)
plot_out <- ggplot(input, aes(xcol, ycol)) + gg_point + gg_line + gg_facet +
    gg_theme + gg_scalex + gg_scaley + color_scale + gg_legend + ggtitle('') + xlab('x') + ylab('Nx (Mb)')+
    gg_axistitle + gg_axistext + gg_plottitle + gg_gridline


        gg_width <- as.double('6.0')
        gg_height <- as.double('4.0')
        gg_unit <- 'in'
        gg_dpi <- as.double('300.0')
        gg_add_device <- 'none'
        output1 <- '/tmp/tmpba1za83k/job_working_directory/000/65/outputs/dataset_471cfac8-f0cd-417f-bf06-32503c737e7d.dat'
        output2 <- 'XXXX'

        ggsave(filename = output1, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = "png")
        if(gg_add_device != "none"){
          ggsave(filename = output2, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = gg_add_device)
        }

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"68dc04ed9fe511ef82fd7b3c31f91d5d"`
adv	{"axis_text_customization": {"__current_case__": 0, "axis_customization": "default"}, "axis_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "factor": {"__current_case__": 1, "colororder": "1", "colors": "Set1", "factorcol": "1", "factoring": "Single"}, "gridlinecust": "default", "legend": "yes", "plot_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "scaling": {"__current_case__": 0, "plot_scaling": "Automatic"}, "theme": "bw", "transform": "none", "type_conditional": {"__current_case__": 2, "type_options": "lines"}}
chromInfo	`"/tmp/tmpba1za83k/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
out	`{"additional_output_format": "none", "dpi_output_dim": "300.0", "height_output_dim": "4.0", "unit_output_dim": "in", "width_output_dim": "6.0"}`
title	`""`
xlab	`"x"`
xplot	`"2"`
ylab	`"Nx (Mb)"`
yplot	`"3"`

Step 52: join1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/tmpba1za83k/galaxy-dev/tools/filters/join.py' '/tmp/tmpba1za83k/files/5/3/f/dataset_53f36822-f6ad-4589-a0f1-6e9e2b2401b1.dat' '/tmp/tmpba1za83k/files/2/d/8/dataset_2d84b215-cacb-45db-a2c3-55c4e5b2e2d0.dat' 1 1 '/tmp/tmpba1za83k/job_working_directory/000/47/outputs/dataset_45c8adf2-4434-4ecb-b7a9-bf6cbb143c9a.dat' -u -p --index_depth=3 --buffer=50000000 --fill_options_file=/tmp/tmpba1za83k/job_working_directory/000/47/configs/tmpu1ajwsan

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"68dc04ea9fe511ef82fd7b3c31f91d5d"`
chromInfo	`"/tmp/tmpba1za83k/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
field1	`"1"`
field2	`"1"`
fill_empty_columns	`{"__current_case__": 1, "do_fill_empty_columns": {"__current_case__": 0, "column_fill_type": "single_fill_value", "fill_value": "."}, "fill_columns_by": "fill_unjoined_only", "fill_empty_columns_switch": "fill_empty"}`
header	`""`
partial	`"-p"`
unmatched	`"-u"`

Step 53: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cut_tool/9.3+galaxy2:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

cut --complement -f '3' '/tmp/tmpba1za83k/files/4/5/c/dataset_45c8adf2-4434-4ecb-b7a9-bf6cbb143c9a.dat' > '/tmp/tmpba1za83k/job_working_directory/000/48/outputs/dataset_65cf7e56-a0a9-4564-a6a2-c8421010e97a.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"68dc04ea9fe511ef82fd7b3c31f91d5d"`
chromInfo	`"/tmp/tmpba1za83k/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
complement	`"--complement"`
cut_type_options	`{"__current_case__": 0, "colnames_option": {"__current_case__": 1, "header": "N", "list": ["3"]}, "cut_element": "-f", "delimiter": ""}`
dbkey	`"?"`

Step 54: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_find_and_replace/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/86755160afbf/text_processing/find_and_replace' -o '/tmp/tmpba1za83k/job_working_directory/000/49/outputs/dataset_ef41ee49-7fc2-4af3-868c-871c6e65c6b4.dat' -g     '#' 'Number of' '/tmp/tmpba1za83k/files/6/5/c/dataset_65cf7e56-a0a9-4564-a6a2-c8421010e97a.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"68dc04ea9fe511ef82fd7b3c31f91d5d"`
chromInfo	`"/tmp/tmpba1za83k/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
find_and_replace	`[{"__index__": 0, "caseinsensitive": false, "find_pattern": "#", "global": true, "is_regex": false, "replace_pattern": "Number of", "searchwhere": {"__current_case__": 0, "searchwhere_select": "line"}, "skip_first_line": false, "wholewords": false}]`

Step 7: Bits for bloom filter:
- step_state: scheduled
Step 8: Database for Busco Lineage:
- step_state: scheduled
Step 9: Lineage:
- step_state: scheduled
Step 10: Homozygous Read Coverage:
- step_state: scheduled

Other invocation details
- history_id
  - 2d993513d38fe5d5
- history_state
  - ok
- invocation_id
  - 2d993513d38fe5d5
- invocation_state
  - scheduled
- workflow_id
  - de5d1b2d4519a966

gxydevbot changed the title ~~Updating workflows/VGP-assembly-v2/Assembly-Hifi-Trio-phasing-VGP5 from 0.2 to 0.3~~ Updating workflows/VGP-assembly-v2/Assembly-Hifi-Trio-phasing-VGP5 from 0.2 to 0.3 Sep 23, 2024

gxydevbot force-pushed the workflows/VGP-assembly-v2/Assembly-Hifi-Trio-phasing-VGP5 branch from ae2cebc to 1cd7c88 Compare September 23, 2024 13:56

gxydevbot force-pushed the workflows/VGP-assembly-v2/Assembly-Hifi-Trio-phasing-VGP5 branch from 1cd7c88 to 0a1ddab Compare September 24, 2024 13:32

gxydevbot force-pushed the workflows/VGP-assembly-v2/Assembly-Hifi-Trio-phasing-VGP5 branch from 0a1ddab to 4c90e50 Compare October 14, 2024 04:20

gxydevbot force-pushed the workflows/VGP-assembly-v2/Assembly-Hifi-Trio-phasing-VGP5 branch from 4c90e50 to 852fe34 Compare October 28, 2024 04:19

gxydevbot force-pushed the workflows/VGP-assembly-v2/Assembly-Hifi-Trio-phasing-VGP5 branch from 852fe34 to fa3775c Compare November 4, 2024 04:18

Updating workflows/VGP-assembly-v2/Assembly-Hifi-Trio-phasing-VGP5 fr…

b752bfb

…om 0.2 to 0.3

gxydevbot force-pushed the workflows/VGP-assembly-v2/Assembly-Hifi-Trio-phasing-VGP5 branch from fa3775c to b752bfb Compare November 11, 2024 04:20

Provide feedback

Saved searches

Use saved searches to filter your results more quickly

Updating workflows/VGP-assembly-v2/Assembly-Hifi-Trio-phasing-VGP5 from 0.2 to 0.3 #508

Updating workflows/VGP-assembly-v2/Assembly-Hifi-Trio-phasing-VGP5 from 0.2 to 0.3 #508

gxydevbot commented Aug 19, 2024

gxydevbot commented Aug 22, 2024

gxydevbot commented Aug 26, 2024

gxydevbot commented Sep 2, 2024

gxydevbot commented Sep 9, 2024

gxydevbot commented Sep 16, 2024

gxydevbot commented Sep 23, 2024

gxydevbot commented Sep 23, 2024

github-actions bot commented Sep 23, 2024

Workflow invocation details

gxydevbot commented Sep 24, 2024

github-actions bot commented Sep 24, 2024

Workflow invocation details

gxydevbot commented Oct 14, 2024

github-actions bot commented Oct 14, 2024

Workflow invocation details

gxydevbot commented Oct 28, 2024

github-actions bot commented Oct 28, 2024

Workflow invocation details

gxydevbot commented Nov 4, 2024

github-actions bot commented Nov 4, 2024

Workflow invocation details

gxydevbot commented Nov 11, 2024

github-actions bot commented Nov 11, 2024

Workflow invocation details

Updating workflows/VGP-assembly-v2/Assembly-Hifi-Trio-phasing-VGP5 from 0.2 to 0.3 #508

Are you sure you want to change the base?

Updating workflows/VGP-assembly-v2/Assembly-Hifi-Trio-phasing-VGP5 from 0.2 to 0.3 #508

Conversation

gxydevbot commented Aug 19, 2024

gxydevbot commented Aug 22, 2024

gxydevbot commented Aug 26, 2024

gxydevbot commented Sep 2, 2024

gxydevbot commented Sep 9, 2024

gxydevbot commented Sep 16, 2024

gxydevbot commented Sep 23, 2024

gxydevbot commented Sep 23, 2024

github-actions bot commented Sep 23, 2024

Test Results (powered by Planemo)

Test Summary

Workflow invocation details

gxydevbot commented Sep 24, 2024

github-actions bot commented Sep 24, 2024

Test Results (powered by Planemo)

Test Summary

Workflow invocation details

gxydevbot commented Oct 14, 2024

github-actions bot commented Oct 14, 2024

Test Results (powered by Planemo)

Test Summary

Workflow invocation details

gxydevbot commented Oct 28, 2024

github-actions bot commented Oct 28, 2024

Test Results (powered by Planemo)

Test Summary

Workflow invocation details

gxydevbot commented Nov 4, 2024

github-actions bot commented Nov 4, 2024

Test Results (powered by Planemo)

Test Summary

Workflow invocation details

gxydevbot commented Nov 11, 2024

github-actions bot commented Nov 11, 2024

Test Results (powered by Planemo)

Test Summary

Workflow invocation details