add new jasminecv features, update test data

galaxyproject · Oct 21, 2021 · 542ae69 · 542ae69
1 parent 1f53a44
commit 542ae69
Show file tree

Hide file tree

Showing 3 changed files with 36 additions and 3 deletions.
diff --git a/tools/jasminesv/jasminesv.xml b/tools/jasminesv/jasminesv.xml
@@ -35,6 +35,7 @@
     ## Flags:
     '${ignore_strand}'
     '${ignore_type}'
+    '${combine_translocations}'
     #if $dup_to_ins.dup_to_ins:
         '${dup_to_ins}'
     #end if
@@ -58,6 +59,13 @@
     #if $normalize.normalize_chrs and $normalize.chr_norm_file:
         'chr_norm_file=${normalize.chr_norm_file}'
     #end if
+    '${non_mutual_distance}'
+    #if $sample_dists.sample_dists:
+        'sample_dists=${sample_dists.sample_dists_file}'
+    #end if
+    #if $min_overlap:
+        'min_overlap=${min_overlap}'
+    #end if
 
     ## Required args
     file_list='${vcffilelist}'
@@ -82,8 +90,8 @@ ${vcf_file}
             Params
         -->
         <param argument="max_dist" type="integer" value="1000" min="0" label="The maximum distance variants can be apart when being merged" help="Setting both max_dist_linear and max_dist sets thresholds to minimum of max_dist and max_dist_linear * sv_length"/>
-        <param argument="min_dist" type="integer" value="-1" min="-1" label="The minimum distance threshold a variant can have when using max_dist_linear" />
-        <param argument="max_dist_linear" type="float" value="0." min="0.0" label="Make max_dist this proportion of the length of each variant" help="Setting both max_dist_linear and max_dist sets thresholds to minimum of max_dist and max_dist_linear * sv_length"/>
+        <param argument="min_dist" type="integer" value="100" min="-1" label="The minimum distance threshold a variant can have when using max_dist_linear" />
+        <param argument="max_dist_linear" type="float" value="0.0" min="0.0" label="Make max_dist this proportion of the length of each variant" help="Setting both max_dist_linear and max_dist sets thresholds to minimum of max_dist and max_dist_linear * sv_length"/>
         <param argument="kd_tree_norm" type="integer" value="2" min="1" label="The power to use in kd-tree distances (1 is Manhattan, 2 is Euclidean, etc.)" />
         <param argument="min_seq_id" type="float" value="0." min="0." label="The minimum sequence identity for two insertions to be merged" />
         <param argument="k_jaccard" type="integer" value="9" min="1" label="The kmer size to use when computing Jaccard similarity of insertions" />
@@ -96,6 +104,7 @@ ${vcf_file}
         -->
         <param argument="--ignore_strand" type="boolean" checked="false" truevalue="--ignore_strand" falsevalue="" label="Allow variants with different strands to be merged" />
         <param argument="--ignore_type" type="boolean" checked="false" truevalue="--ignore_type" falsevalue="" label="Allow variants with different types to be merged" />
+        <param argument="--combine_translocations" type="boolean" checked="false" truevalue="--combine_translocations" falsevalue="" label="Keep all translocations together to reduce number of groups" />
         <conditional name="dup_to_ins">
             <param argument="--dup_to_ins" type="select" checked="false" label="Convert duplications to insertions for SV merging and then convert them back?" help="Requires reference genome" >
                 <option value="--dup_to_ins">Convert duplications to insertions for SV merging and then convert them back</option>
@@ -131,6 +140,18 @@ ${vcf_file}
             </when>
             <when value=""/>
         </conditional>
+        <param argument="--non_mutual_distance" type="boolean" checked="false" truevalue="--non_mutual_distance" falsevalue="" label="Do not require a pair of points to be within both of their distance thresholds" />
+        <conditional name="sample_dists">
+            <param name="sample_dists" type="select" checked="false" label="Specify distance thresholds for each sample?">
+                <option value="sample_dists">Specify distance thresholds</option>
+                <option value="" selected="true">Don't specify distance thresholds</option>
+            </param>
+            <when value="sample_dists">
+                <param name="sample_dists_file" type="data" format="txt,tsv" value="" label="A file containing distance thresholds for each sample, one per line"/>
+            </when>
+            <when value=""/>
+        </conditional>
+        <param argument="min_overlap" type="float" value="0.0" min="0.0" label="The minimum reciprocal overlap for DEL/INV/DUP SVs" optional="true"/>
     </inputs>
     <outputs>
         <!-- standard -->
@@ -172,7 +193,16 @@ ${vcf_file}
             </conditional>
             <output name="out_vcf" file="out1.vcf"/>
         </test>
-
+        <!-- test 1.0.11 -> 1.1.4 features -->
+        <test expect_num_outputs="1">
+            <param name="vcf_list" value="a.vcf,b.vcf" ftype="vcf"/>
+            <param name="combine_translocations" value="--combine_translocations"/>
+            <param name="non_mutual_distance" value="--non_mutual_distance"/>
+            <param name="sample_dists" value="sample_dists"/>
+            <param name="sample_dists_file" value="sample_dists.txt"/>
+            <param name="min_overlap" value="0.1"/>
+            <output name="out_vcf" file="out1.vcf"/>
+        </test>
     </tests>
     <help><![CDATA[
 .. class:: infomark

diff --git a/tools/jasminesv/test-data/out1.vcf b/tools/jasminesv/test-data/out1.vcf
@@ -21,6 +21,7 @@
 ##INFO=<ID=AVG_START,Number=1,Type=String,Description="Average start position for variants merged into this one">
 ##INFO=<ID=AVG_END,Number=1,Type=String,Description="Average end position for variants merged into this one">
 ##INFO=<ID=AVG_LEN,Number=1,Type=String,Description="Average length for variants merged into this one">
+##INFO=<ID=IMPRECISE,Number=0,Type=Flag,Description="Imprecise structural variation">
 ##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
 1	100	0_1	CACGTACGTACGTACGTACGTACGTACTGACGTACGT	C	.	PASS	PRECISE;CHR2=1;END=136;SVTYPE=DEL;SUPTYPE=AL;SVLEN=-36;STRANDS=+-;RE=12;IS_SPECIFIC=1;STARTVARIANCE=0.000000;ENDVARIANCE=4.000000;AVG_LEN=-34.000000;AVG_START=100.000000;AVG_END=134.000000;SUPP_VEC_EXT=11;IDLIST_EXT=1,1;SUPP_EXT=2;SUPP_VEC=11;SUPP=2;SVMETHOD=JASMINE;IDLIST=1,1	GT	1/1
 1	200	0_2	C	CACGTACGTACGTACGTACGTACGTACTGACGTACGT	.	PASS	PRECISE;CHR2=1;END=200;SVTYPE=INS;SUPTYPE=AL;SVLEN=36;STRANDS=+-;RE=10;IS_SPECIFIC=1;STARTVARIANCE=6.250000;ENDVARIANCE=6.250000;AVG_LEN=38.000000;AVG_START=202.500000;AVG_END=202.500000;SUPP_VEC_EXT=11;IDLIST_EXT=2,2;SUPP_EXT=2;SUPP_VEC=11;SUPP=2;SVMETHOD=JASMINE;IDLIST=2,2	GT	1/1

diff --git a/tools/jasminesv/test-data/sample_dists.txt b/tools/jasminesv/test-data/sample_dists.txt
@@ -0,0 +1,2 @@
+10
+50