cbiot.from_file.log.txt

Namespace(csv=True, f='genes.txt', g=None, o='cbiot.from_file.csv', timeout=300.0)
The input gene names are:
['TP53', 'EGFR', 'NRAS', 'PIK3CA', 'hras', 'pten']
The gene entrez IDs are:
['TP53 ==> 7157', 'EGFR ==> 1956', 'NRAS ==> 4893', 'PIK3CA ==> 5290', 'hras ==> 3265', 'pten ==> 5728']
There are 287 studies.
There are 869 cancer types.
There are 1196 molecular profiles.
There are 1560 sample lists.
There are 91539 samples.
There are 342 combinations of molecular profile and sample list.
doing 1 now.
Molecular profile ID is chol_nccs_2013_mutations.
Sample list ID is chol_nccs_2013_all.
There are 3 mutations returned.
doing 2 now.
Molecular profile ID is escc_ucla_2014_mutations.
Sample list ID is escc_ucla_2014_all.
There are 110 mutations returned.
doing 3 now.
Molecular profile ID is hnsc_mdanderson_2013_mutations.
Sample list ID is hnsc_mdanderson_2013_all.
There are 26 mutations returned.
doing 4 now.
Molecular profile ID is hcc_inserm_fr_2015_mutations.
Sample list ID is hcc_inserm_fr_2015_all.
There are 71 mutations returned.
doing 5 now.
Molecular profile ID is um_qimr_2016_mutations.
Sample list ID is um_qimr_2016_all.
There are 0 mutations returned.
doing 6 now.
Molecular profile ID is nbl_amc_2012_mutations.
Sample list ID is nbl_amc_2012_all.
There are 0 mutations returned.
doing 7 now.
Molecular profile ID is npc_nusingapore_mutations.
Sample list ID is npc_nusingapore_all.
There are 9 mutations returned.
doing 8 now.
Molecular profile ID is tet_nci_2014_mutations.
Sample list ID is tet_nci_2014_all.
There are 4 mutations returned.
doing 9 now.
Molecular profile ID is nbl_ucologne_2015_mutations.
Sample list ID is nbl_ucologne_2015_all.
There are 1 mutations returned.
doing 10 now.
Molecular profile ID is mds_tokyo_2011_mutations.
Sample list ID is mds_tokyo_2011_all.
There are 6 mutations returned.
doing 11 now.
Molecular profile ID is nhl_bcgsc_2011_mutations.
Sample list ID is nhl_bcgsc_2011_all.
There are 0 mutations returned.
doing 12 now.
Molecular profile ID is nhl_bcgsc_2013_mutations.
Sample list ID is nhl_bcgsc_2013_all.
There are 14 mutations returned.
doing 13 now.
Molecular profile ID is panet_shanghai_2013_mutations.
Sample list ID is panet_shanghai_2013_all.
There are 0 mutations returned.
doing 14 now.
Molecular profile ID is plmeso_nyu_2015_mutations.
Sample list ID is plmeso_nyu_2015_all.
There are 2 mutations returned.
doing 15 now.
Molecular profile ID is pact_jhu_2011_mutations.
Sample list ID is pact_jhu_2011_all.
There are 2 mutations returned.
doing 16 now.
Molecular profile ID is past_dkfz_heidelberg_2013_mutations.
Sample list ID is past_dkfz_heidelberg_2013_all.
There are 1 mutations returned.
doing 17 now.
Molecular profile ID is lihc_riken_mutations.
Sample list ID is lihc_riken_all.
There are 14 mutations returned.
doing 18 now.
Molecular profile ID is mbl_icgc_mutations.
Sample list ID is mbl_icgc_all.
There are 10 mutations returned.
doing 19 now.
Molecular profile ID is mbl_sickkids_2016_mutations.
Sample list ID is mbl_sickkids_2016_all.
There are 12 mutations returned.
doing 20 now.
Molecular profile ID is kirc_bgi_mutations.
Sample list ID is kirc_bgi_all.
There are 7 mutations returned.
doing 21 now.
Molecular profile ID is hnsc_jhu_mutations.
Sample list ID is hnsc_jhu_all.
There are 31 mutations returned.
doing 22 now.
Molecular profile ID is liad_inserm_fr_2014_mutations.
Sample list ID is liad_inserm_fr_2014_all.
There are 0 mutations returned.
doing 23 now.
Molecular profile ID is ampca_bcm_2016_mutations.
Sample list ID is ampca_bcm_2016_all.
There are 138 mutations returned.
doing 24 now.
Molecular profile ID is blca_dfarber_mskcc_2014_mutations.
Sample list ID is blca_dfarber_mskcc_2014_all.
There are 52 mutations returned.
doing 25 now.
Molecular profile ID is nccrcc_genentech_2014_mutations.
Sample list ID is nccrcc_genentech_2014_all.
There are 18 mutations returned.
doing 26 now.
Molecular profile ID is stad_pfizer_uhongkong_mutations.
Sample list ID is stad_pfizer_uhongkong_all.
There are 70 mutations returned.
doing 27 now.
Molecular profile ID is dlbc_broad_2012_mutations.
Sample list ID is dlbc_broad_2012_all.
There are 20 mutations returned.
doing 28 now.
Molecular profile ID is mixed_allen_2018_mutations.
Sample list ID is mixed_allen_2018_all.
There are 232 mutations returned.
doing 29 now.
Molecular profile ID is ccrcc_utokyo_2013_mutations.
Sample list ID is ccrcc_utokyo_2013_all.
There are 13 mutations returned.
doing 30 now.
Molecular profile ID is chol_jhu_2013_mutations.
Sample list ID is chol_jhu_2013_all.
There are 14 mutations returned.
doing 31 now.
Molecular profile ID is skcm_broad_dfarber_mutations.
Sample list ID is skcm_broad_dfarber_all.
There are 17 mutations returned.
doing 32 now.
Molecular profile ID is ucs_jhu_2014_mutations.
Sample list ID is ucs_jhu_2014_all.
There are 49 mutations returned.
doing 33 now.
Molecular profile ID is skcm_broad_brafresist_2012_mutations.
Sample list ID is skcm_broad_brafresist_2012_all.
There are 46 mutations returned.
doing 34 now.
Molecular profile ID is acyc_sanger_2013_mutations.
Sample list ID is acyc_sanger_2013_all.
There are 1 mutations returned.
doing 35 now.
Molecular profile ID is vsc_cuk_2018_mutations.
Sample list ID is vsc_cuk_2018_all.
There are 10 mutations returned.
doing 36 now.
Molecular profile ID is esca_broad_mutations.
Sample list ID is esca_broad_all.
There are 124 mutations returned.
doing 37 now.
Molecular profile ID is paac_jhu_2014_mutations.
Sample list ID is paac_jhu_2014_all.
There are 5 mutations returned.
doing 38 now.
Molecular profile ID is rms_nih_2014_mutations.
Sample list ID is rms_nih_2014_all.
There are 10 mutations returned.
doing 39 now.
Molecular profile ID is egc_tmucih_2015_mutations.
Sample list ID is egc_tmucih_2015_all.
There are 51 mutations returned.
doing 40 now.
Molecular profile ID is brca_bccrc_mutations.
Sample list ID is brca_bccrc_all.
There are 51 mutations returned.
doing 41 now.
Molecular profile ID is panet_arcnet_2017_mutations.
Sample list ID is panet_arcnet_2017_all.
There are 10 mutations returned.
doing 42 now.
Molecular profile ID is pcnsl_mayo_2015_mutations.
Sample list ID is pcnsl_mayo_2015_all.
There are 1 mutations returned.
doing 43 now.
Molecular profile ID is mm_broad_mutations.
Sample list ID is mm_broad_all.
There are 58 mutations returned.
doing 44 now.
Molecular profile ID is nbl_broad_2013_mutations.
Sample list ID is nbl_broad_2013_all.
There are 6 mutations returned.
doing 45 now.
Molecular profile ID is mrt_bcgsc_2016_mutations.
Sample list ID is mrt_bcgsc_2016_all.
There are 0 mutations returned.
doing 46 now.
Molecular profile ID is gbc_shanghai_2014_mutations.
Sample list ID is gbc_shanghai_2014_all.
There are 12 mutations returned.
doing 47 now.
Molecular profile ID is luad_mskcc_2015_mutations.
Sample list ID is luad_mskcc_2015_all.
There are 22 mutations returned.
doing 48 now.
Molecular profile ID is mbl_broad_2012_mutations.
Sample list ID is mbl_broad_2012_all.
There are 5 mutations returned.
doing 49 now.
Molecular profile ID is mixed_pipseq_2017_mutations.
Sample list ID is mixed_pipseq_2017_all.
There are 70 mutations returned.
doing 50 now.
Molecular profile ID is acyc_fmi_2014_mutations.
Sample list ID is acyc_fmi_2014_all.
There are 3 mutations returned.
doing 51 now.
Molecular profile ID is acyc_jhu_2016_mutations.
Sample list ID is acyc_jhu_2016_all.
There are 1 mutations returned.
doing 52 now.
Molecular profile ID is acyc_mda_2015_mutations.
Sample list ID is acyc_mda_2015_all.
There are 0 mutations returned.
doing 53 now.
Molecular profile ID is all_stjude_2016_mutations.
Sample list ID is all_stjude_2016_all.
There are 27 mutations returned.
doing 54 now.
Molecular profile ID is bfn_duke_nus_2015_mutations.
Sample list ID is bfn_duke_nus_2015_all.
There are 4 mutations returned.
doing 55 now.
Molecular profile ID is blca_mskcc_solit_2014_mutations.
Sample list ID is blca_mskcc_solit_2014_all.
There are 118 mutations returned.
doing 56 now.
Molecular profile ID is blca_nmibc_2017_mutations.
Sample list ID is blca_nmibc_2017_all.
There are 69 mutations returned.
doing 57 now.
Molecular profile ID is brca_broad_mutations.
Sample list ID is brca_broad_all.
There are 64 mutations returned.
doing 58 now.
Molecular profile ID is ccrcc_irc_2014_mutations.
Sample list ID is ccrcc_irc_2014_all.
There are 16 mutations returned.
doing 59 now.
Molecular profile ID is cll_iuopa_2015_mutations.
Sample list ID is cll_iuopa_2015_all.
There are 20 mutations returned.
doing 60 now.
Molecular profile ID is cllsll_icgc_2011_mutations.
Sample list ID is cllsll_icgc_2011_all.
There are 3 mutations returned.
doing 61 now.
Molecular profile ID is cscc_dfarber_2015_mutations.
Sample list ID is cscc_dfarber_2015_all.
There are 49 mutations returned.
doing 62 now.
Molecular profile ID is desm_broad_2015_mutations.
Sample list ID is desm_broad_2015_all.
There are 12 mutations returned.
doing 63 now.
Molecular profile ID is es_iocurie_2014_mutations.
Sample list ID is es_iocurie_2014_all.
There are 10 mutations returned.
doing 64 now.
Molecular profile ID is cscc_hgsc_bcm_2014_mutations.
Sample list ID is cscc_hgsc_bcm_2014_all.
There are 77 mutations returned.
doing 65 now.
Molecular profile ID is dlbcl_dfci_2018_mutations.
Sample list ID is dlbcl_dfci_2018_all.
There are 46 mutations returned.
doing 66 now.
Molecular profile ID is hcc_msk_venturaa_2018_mutations.
Sample list ID is hcc_msk_venturaa_2018_all.
There are 5 mutations returned.
doing 67 now.
Molecular profile ID is gbc_msk_2018_mutations.
Sample list ID is gbc_msk_2018_all.
There are 82 mutations returned.
doing 68 now.
Molecular profile ID is lihc_tcga_mutations.
Sample list ID is lihc_tcga_methylation_all.
There are 151 mutations returned.
doing 69 now.
Molecular profile ID is lihc_tcga_mutations.
Sample list ID is lihc_tcga_all.
There are 151 mutations returned.
doing 70 now.
Molecular profile ID is lgg_ucsf_2014_mutations.
Sample list ID is lgg_ucsf_2014_all.
There are 72 mutations returned.
doing 71 now.
Molecular profile ID is lihc_amc_prv_mutations.
Sample list ID is lihc_amc_prv_all.
There are 79 mutations returned.
doing 72 now.
Molecular profile ID is luad_tsp_mutations.
Sample list ID is luad_tsp_all.
There are 109 mutations returned.
doing 73 now.
Molecular profile ID is mbl_pcgp_mutations.
Sample list ID is mbl_pcgp_all.
There are 2 mutations returned.
doing 74 now.
Molecular profile ID is lung_msk_pdx_mutations.
Sample list ID is lung_msk_pdx_all.
There are 150 mutations returned.
doing 75 now.
Molecular profile ID is meso_tcga_mutations.
Sample list ID is meso_tcga_all.
There are 17 mutations returned.
doing 76 now.
Molecular profile ID is meso_tcga_mutations.
Sample list ID is meso_tcga_methylation_all.
There are 17 mutations returned.
doing 77 now.
Molecular profile ID is paad_icgc_mutations.
Sample list ID is paad_icgc_all.
There are 33 mutations returned.
doing 78 now.
Molecular profile ID is mcl_idibips_2013_mutations.
Sample list ID is mcl_idibips_2013_all.
There are 9 mutations returned.
doing 79 now.
Molecular profile ID is msk_impact_2017_mutations.
Sample list ID is msk_impact_2017_all.
There are 8516 mutations returned.
doing 80 now.
Molecular profile ID is paad_tcga_mutations.
Sample list ID is paad_tcga_all.
There are 113 mutations returned.
doing 81 now.
Molecular profile ID is paad_tcga_mutations.
Sample list ID is paad_tcga_methylation_all.
There are 113 mutations returned.
doing 82 now.
Molecular profile ID is pcpg_tcga_mutations.
Sample list ID is pcpg_tcga_all.
There are 19 mutations returned.
doing 83 now.
Molecular profile ID is pcpg_tcga_mutations.
Sample list ID is pcpg_tcga_methylation_all.
There are 19 mutations returned.
doing 84 now.
Molecular profile ID is paad_utsw_2015_mutations.
Sample list ID is paad_utsw_2015_all.
There are 61 mutations returned.
doing 85 now.
Molecular profile ID is panet_jhu_2011_mutations.
Sample list ID is panet_jhu_2011_all.
There are 3 mutations returned.
doing 86 now.
Molecular profile ID is prad_mich_mutations.
Sample list ID is prad_mich_all.
There are 31 mutations returned.
doing 87 now.
Molecular profile ID is sarc_tcga_mutations.
Sample list ID is sarc_tcga_all.
There are 107 mutations returned.
doing 88 now.
Molecular profile ID is sarc_tcga_mutations.
Sample list ID is sarc_tcga_methylation_all.
There are 107 mutations returned.
doing 89 now.
Molecular profile ID is sclc_clcgp_mutations.
Sample list ID is sclc_clcgp_all.
There are 33 mutations returned.
doing 90 now.
Molecular profile ID is scco_mskcc_mutations.
Sample list ID is scco_mskcc_all.
There are 0 mutations returned.
doing 91 now.
Molecular profile ID is prad_mskcc_2017_mutations.
Sample list ID is prad_mskcc_2017_all.
There are 240 mutations returned.
doing 92 now.
Molecular profile ID is tgct_tcga_mutations.
Sample list ID is tgct_tcga_all.
There are 15 mutations returned.
doing 93 now.
Molecular profile ID is tgct_tcga_mutations.
Sample list ID is tgct_tcga_methylation_all.
There are 15 mutations returned.
doing 94 now.
Molecular profile ID is thca_tcga_mutations.
Sample list ID is thca_tcga_all.
There are 56 mutations returned.
doing 95 now.
Molecular profile ID is thca_tcga_mutations.
Sample list ID is thca_tcga_methylation_all.
There are 56 mutations returned.
doing 96 now.
Molecular profile ID is skcm_broad_mutations.
Sample list ID is skcm_broad_all.
There are 88 mutations returned.
doing 97 now.
Molecular profile ID is skcm_yale_mutations.
Sample list ID is skcm_yale_all.
There are 39 mutations returned.
doing 98 now.
Molecular profile ID is stad_uhongkong_mutations.
Sample list ID is stad_uhongkong_all.
There are 21 mutations returned.
doing 99 now.
Molecular profile ID is thym_tcga_mutations.
Sample list ID is thym_tcga_all.
There are 17 mutations returned.
doing 100 now.
Molecular profile ID is thym_tcga_mutations.
Sample list ID is thym_tcga_methylation_all.
There are 17 mutations returned.
doing 101 now.
Molecular profile ID is ucec_tcga_mutations.
Sample list ID is ucec_tcga_all.
There are 518 mutations returned.
doing 102 now.
Molecular profile ID is ucec_tcga_mutations.
Sample list ID is ucec_tcga_methylation_all.
There are 523 mutations returned.
doing 103 now.
Molecular profile ID is ucs_tcga_mutations.
Sample list ID is ucs_tcga_all.
There are 96 mutations returned.
doing 104 now.
Molecular profile ID is ucs_tcga_mutations.
Sample list ID is ucs_tcga_methylation_all.
There are 96 mutations returned.
doing 105 now.
Molecular profile ID is thyroid_mskcc_2016_mutations.
Sample list ID is thyroid_mskcc_2016_all.
There are 84 mutations returned.
doing 106 now.
Molecular profile ID is nsclc_tcga_broad_2016_mutations.
Sample list ID is nsclc_tcga_broad_2016_all.
There are 1143 mutations returned.
doing 107 now.
Molecular profile ID is uccc_nih_2017_mutations.
Sample list ID is uccc_nih_2017_all.
There are 12 mutations returned.
doing 108 now.
Molecular profile ID is lusc_tcga_mutations.
Sample list ID is lusc_tcga_all.
There are 210 mutations returned.
doing 109 now.
Molecular profile ID is lusc_tcga_mutations.
Sample list ID is lusc_tcga_methylation_all.
There are 210 mutations returned.
doing 110 now.
Molecular profile ID is stad_tcga_mutations.
Sample list ID is stad_tcga_all.
There are 345 mutations returned.
doing 111 now.
Molecular profile ID is stad_tcga_mutations.
Sample list ID is stad_tcga_methylation_all.
There are 345 mutations returned.
doing 112 now.
Molecular profile ID is hnsc_broad_mutations.
Sample list ID is hnsc_broad_all.
There are 64 mutations returned.
doing 113 now.
Molecular profile ID is nsclc_unito_2016_mutations.
Sample list ID is nsclc_unito_2016_all.
There are 49 mutations returned.
doing 114 now.
Molecular profile ID is mpnst_mskcc_mutations.
Sample list ID is mpnst_mskcc_all.
There are 3 mutations returned.
doing 115 now.
Molecular profile ID is acyc_mskcc_2013_mutations.
Sample list ID is acyc_mskcc_2013_all.
There are 9 mutations returned.
doing 116 now.
Molecular profile ID is tmb_mskcc_2018_mutations.
Sample list ID is tmb_mskcc_2018_all.
There are 1493 mutations returned.
doing 117 now.
Molecular profile ID is uvm_tcga_mutations.
Sample list ID is uvm_tcga_all.
There are 0 mutations returned.
doing 118 now.
Molecular profile ID is uvm_tcga_mutations.
Sample list ID is uvm_tcga_methylation_all.
There are 0 mutations returned.
doing 119 now.
Molecular profile ID is acbc_mskcc_2015_mutations.
Sample list ID is acbc_mskcc_2015_all.
There are 0 mutations returned.
doing 120 now.
Molecular profile ID is ov_tcga_pub_mutations.
Sample list ID is ov_tcga_pub_all.
There are 318 mutations returned.
doing 121 now.
Molecular profile ID is ov_tcga_pub_mutations.
Sample list ID is ov_tcga_pub_methylation_all.
There are 318 mutations returned.
doing 122 now.
Molecular profile ID is prad_broad_2013_mutations.
Sample list ID is prad_broad_2013_all.
There are 10 mutations returned.
doing 123 now.
Molecular profile ID is luad_tcga_pub_mutations.
Sample list ID is luad_tcga_pub_all.
There are 181 mutations returned.
doing 124 now.
Molecular profile ID is luad_tcga_pub_mutations.
Sample list ID is luad_tcga_pub_methylation_all.
There are 180 mutations returned.
doing 125 now.
Molecular profile ID is blca_cornell_2016_mutations.
Sample list ID is blca_cornell_2016_all.
There are 67 mutations returned.
doing 126 now.
Molecular profile ID is laml_tcga_pub_mutations.
Sample list ID is laml_tcga_pub_all.
There are 37 mutations returned.
doing 127 now.
Molecular profile ID is laml_tcga_pub_mutations.
Sample list ID is laml_tcga_pub_methylation_all.
There are 37 mutations returned.
doing 128 now.
Molecular profile ID is lgggbm_tcga_pub_mutations.
Sample list ID is lgggbm_tcga_pub_all.
There are 672 mutations returned.
doing 129 now.
Molecular profile ID is odg_msk_2017_mutations.
Sample list ID is odg_msk_2017_all.
There are 5 mutations returned.
doing 130 now.
Molecular profile ID is gct_msk_2016_mutations.
Sample list ID is gct_msk_2016_all.
There are 34 mutations returned.
doing 131 now.
Molecular profile ID is metastatic_solid_tumors_mich_2017_mutations.
Sample list ID is metastatic_solid_tumors_mich_2017_all.
There are 426 mutations returned.
doing 132 now.
Molecular profile ID is lusc_tcga_pub_mutations.
Sample list ID is lusc_tcga_pub_all.
There are 215 mutations returned.
doing 133 now.
Molecular profile ID is lusc_tcga_pub_mutations.
Sample list ID is lusc_tcga_pub_methylation_all.
There are 124 mutations returned.
doing 134 now.
Molecular profile ID is mnm_washu_2016_mutations.
Sample list ID is mnm_washu_2016_all.
There are 43 mutations returned.
doing 135 now.
Molecular profile ID is coad_caseccc_2015_mutations.
Sample list ID is coad_caseccc_2015_all.
There are 31 mutations returned.
doing 136 now.
Molecular profile ID is mpn_cimr_2013_mutations.
Sample list ID is mpn_cimr_2013_all.
There are 4 mutations returned.
doing 137 now.
Molecular profile ID is ccrcc_dfci_2019_mutations.
Sample list ID is ccrcc_dfci_2019_all.
There are 4 mutations returned.
doing 138 now.
Molecular profile ID is nsclc_mskcc_2015_mutations.
Sample list ID is nsclc_mskcc_2015_all.
There are 9 mutations returned.
doing 139 now.
Molecular profile ID is prad_tcga_mutations.
Sample list ID is prad_tcga_all.
There are 104 mutations returned.
doing 140 now.
Molecular profile ID is prad_tcga_mutations.
Sample list ID is prad_tcga_methylation_all.
There are 104 mutations returned.
doing 141 now.
Molecular profile ID is lung_msk_2017_mutations.
Sample list ID is lung_msk_2017_all.
There are 991 mutations returned.
doing 142 now.
Molecular profile ID is nsclc_pd1_msk_2018_mutations.
Sample list ID is nsclc_pd1_msk_2018_all.
There are 213 mutations returned.
doing 143 now.
Molecular profile ID is ucec_msk_2018_mutations.
Sample list ID is ucec_msk_2018_all.
There are 307 mutations returned.
doing 144 now.
Molecular profile ID is skcm_tcga_mutations.
Sample list ID is skcm_tcga_all.
There are 252 mutations returned.
doing 145 now.
Molecular profile ID is skcm_tcga_mutations.
Sample list ID is skcm_tcga_methylation_all.
There are 249 mutations returned.
doing 146 now.
Molecular profile ID is ov_tcga_mutations.
Sample list ID is ov_tcga_all.
There are 292 mutations returned.
doing 147 now.
Molecular profile ID is ov_tcga_mutations.
Sample list ID is ov_tcga_methylation_all.
There are 0 mutations returned.
doing 148 now.
Molecular profile ID is coad_cptac_2019_mutations.
Sample list ID is coad_cptac_2019_all.
There are 106 mutations returned.
doing 149 now.
Molecular profile ID is rectal_msk_2019_mutations.
Sample list ID is rectal_msk_2019_all.
There are 353 mutations returned.
doing 150 now.
Molecular profile ID is urcc_mskcc_2016_mutations.
Sample list ID is urcc_mskcc_2016_all.
There are 10 mutations returned.
doing 151 now.
Molecular profile ID is egc_msk_2017_mutations.
Sample list ID is egc_msk_2017_all.
There are 313 mutations returned.
doing 152 now.
Molecular profile ID is chol_msk_2018_mutations.
Sample list ID is chol_msk_2018_all.
There are 78 mutations returned.
doing 153 now.
Molecular profile ID is ihch_smmu_2014_mutations.
Sample list ID is ihch_smmu_2014_all.
There are 59 mutations returned.
doing 154 now.
Molecular profile ID is nsclc_mskcc_2018_mutations.
Sample list ID is nsclc_mskcc_2018_all.
There are 71 mutations returned.
doing 155 now.
Molecular profile ID is prad_p1000_mutations.
Sample list ID is prad_p1000_all.
There are 288 mutations returned.
doing 156 now.
Molecular profile ID is coadread_dfci_2016_mutations.
Sample list ID is coadread_dfci_2016_all.
There are 620 mutations returned.
doing 157 now.
Molecular profile ID is utuc_mskcc_2015_mutations.
Sample list ID is utuc_mskcc_2015_all.
There are 54 mutations returned.
doing 158 now.
Molecular profile ID is brca_igr_2015_mutations.
Sample list ID is brca_igr_2015_all.
There are 176 mutations returned.
doing 159 now.
Molecular profile ID is luad_tcga_mutations.
Sample list ID is luad_tcga_all.
There are 180 mutations returned.
doing 160 now.
Molecular profile ID is luad_tcga_mutations.
Sample list ID is luad_tcga_methylation_all.
There are 179 mutations returned.
doing 161 now.
Molecular profile ID is blca_tcga_pub_mutations.
Sample list ID is blca_tcga_pub_all.
There are 115 mutations returned.
doing 162 now.
Molecular profile ID is blca_tcga_pub_mutations.
Sample list ID is blca_tcga_pub_methylation_all.
There are 115 mutations returned.
doing 163 now.
Molecular profile ID is kirc_tcga_pub_mutations.
Sample list ID is kirc_tcga_pub_all.
There are 47 mutations returned.
doing 164 now.
Molecular profile ID is kirc_tcga_pub_mutations.
Sample list ID is kirc_tcga_pub_methylation_all.
There are 23 mutations returned.
doing 165 now.
Molecular profile ID is gbm_tcga_pub2013_mutations.
Sample list ID is gbm_tcga_pub2013_all.
There are 217 mutations returned.
doing 166 now.
Molecular profile ID is hnsc_tcga_pub_mutations.
Sample list ID is hnsc_tcga_pub_all.
There are 337 mutations returned.
doing 167 now.
Molecular profile ID is hnsc_tcga_pub_mutations.
Sample list ID is hnsc_tcga_pub_methylation_all.
There are 337 mutations returned.
doing 168 now.
Molecular profile ID is blca_mskcc_solit_2012_mutations.
Sample list ID is blca_mskcc_solit_2012_all.
There are 53 mutations returned.
doing 169 now.
Molecular profile ID is blca_mskcc_solit_2012_mutations.
Sample list ID is blca_mskcc_solit_2012_methylation_all.
There are 14 mutations returned.
doing 170 now.
Molecular profile ID is cellline_nci60_mutations.
Sample list ID is cellline_nci60_all.
There are 62 mutations returned.
doing 171 now.
Molecular profile ID is mel_ucla_2016_mutations.
Sample list ID is mel_ucla_2016_all.
There are 29 mutations returned.
doing 172 now.
Molecular profile ID is all_stjude_2015_mutations.
Sample list ID is all_stjude_2015_all.
There are 14 mutations returned.
doing 173 now.
Molecular profile ID is brca_bccrc_xenograft_2014_mutations.
Sample list ID is brca_bccrc_xenograft_2014_all.
There are 55 mutations returned.
doing 174 now.
Molecular profile ID is coadread_genentech_mutations.
Sample list ID is coadread_genentech_all.
There are 81 mutations returned.
doing 175 now.
Molecular profile ID is sclc_jhu_mutations.
Sample list ID is sclc_jhu_all.
There are 42 mutations returned.
doing 176 now.
Molecular profile ID is acyc_mgh_2016_mutations.
Sample list ID is acyc_mgh_2016_all.
There are 0 mutations returned.
doing 177 now.
Molecular profile ID is prad_cpcg_2017_mutations.
Sample list ID is prad_cpcg_2017_all.
There are 27 mutations returned.
doing 178 now.
Molecular profile ID is summit_2018_mutations.
Sample list ID is summit_2018_all.
There are 89 mutations returned.
doing 179 now.
Molecular profile ID is all_phase2_target_2018_pub_mutations.
Sample list ID is all_phase2_target_2018_pub_all.
There are 22 mutations returned.
doing 180 now.
Molecular profile ID is all_phase2_target_2018_pub_mutations.
Sample list ID is all_phase2_target_2018_pub_methylation_all.
There are 9 mutations returned.
doing 181 now.
Molecular profile ID is dlbcl_duke_2017_mutations.
Sample list ID is dlbcl_duke_2017_all.
There are 118 mutations returned.
doing 182 now.
Molecular profile ID is blca_plasmacytoid_mskcc_2016_mutations.
Sample list ID is blca_plasmacytoid_mskcc_2016_all.
There are 42 mutations returned.
doing 183 now.
Molecular profile ID is coadread_mskcc_mutations.
Sample list ID is coadread_mskcc_all.
There are 150 mutations returned.
doing 184 now.
Molecular profile ID is hcc_mskimpact_2018_mutations.
Sample list ID is hcc_mskimpact_2018_all.
There are 49 mutations returned.
doing 185 now.
Molecular profile ID is breast_msk_2018_mutations.
Sample list ID is breast_msk_2018_all.
There are 1717 mutations returned.
doing 186 now.
Molecular profile ID is histiocytosis_cobi_msk_2019_mutations.
Sample list ID is histiocytosis_cobi_msk_2019_all.
There are 3 mutations returned.
doing 187 now.
Molecular profile ID is lcll_broad_2013_mutations.
Sample list ID is lcll_broad_2013_all.
There are 27 mutations returned.
doing 188 now.
Molecular profile ID is lymphoma_cellline_msk_2020_mutations.
Sample list ID is lymphoma_cellline_msk_2020_all.
There are 39 mutations returned.
doing 189 now.
Molecular profile ID is luad_broad_mutations.
Sample list ID is luad_broad_all.
There are 152 mutations returned.
doing 190 now.
Molecular profile ID is acc_tcga_pan_can_atlas_2018_mutations.
Sample list ID is acc_tcga_pan_can_atlas_2018_all.
There are 23 mutations returned.
doing 191 now.
Molecular profile ID is blca_tcga_pan_can_atlas_2018_mutations.
Sample list ID is blca_tcga_pan_can_atlas_2018_all.
There are 394 mutations returned.
doing 192 now.
Molecular profile ID is brca_tcga_pan_can_atlas_2018_mutations.
Sample list ID is brca_tcga_pan_can_atlas_2018_all.
There are 835 mutations returned.
doing 193 now.
Molecular profile ID is cesc_tcga_pan_can_atlas_2018_mutations.
Sample list ID is cesc_tcga_pan_can_atlas_2018_all.
There are 170 mutations returned.
doing 194 now.
Molecular profile ID is coadread_tcga_pan_can_atlas_2018_mutations.
Sample list ID is coadread_tcga_pan_can_atlas_2018_all.
There are 615 mutations returned.
doing 195 now.
Molecular profile ID is brca_tcga_pub2015_mutations.
Sample list ID is brca_tcga_pub2015_all.
There are 655 mutations returned.
doing 196 now.
Molecular profile ID is brca_tcga_pub2015_mutations.
Sample list ID is brca_tcga_pub2015_methylation_all.
There are 655 mutations returned.
doing 197 now.
Molecular profile ID is chol_tcga_pan_can_atlas_2018_mutations.
Sample list ID is chol_tcga_pan_can_atlas_2018_all.
There are 10 mutations returned.
doing 198 now.
Molecular profile ID is dlbc_tcga_pan_can_atlas_2018_mutations.
Sample list ID is dlbc_tcga_pan_can_atlas_2018_all.
There are 6 mutations returned.
doing 199 now.
Molecular profile ID is esca_tcga_pan_can_atlas_2018_mutations.
Sample list ID is esca_tcga_pan_can_atlas_2018_all.
There are 211 mutations returned.
doing 200 now.
Molecular profile ID is gbm_tcga_pan_can_atlas_2018_mutations.
Sample list ID is gbm_tcga_pan_can_atlas_2018_all.
There are 463 mutations returned.
doing 201 now.
Molecular profile ID is hnsc_tcga_pan_can_atlas_2018_mutations.
Sample list ID is hnsc_tcga_pan_can_atlas_2018_all.
There are 594 mutations returned.
doing 202 now.
Molecular profile ID is kich_tcga_pan_can_atlas_2018_mutations.
Sample list ID is kich_tcga_pan_can_atlas_2018_all.
There are 33 mutations returned.
doing 203 now.
Molecular profile ID is kirc_tcga_pan_can_atlas_2018_mutations.
Sample list ID is kirc_tcga_pan_can_atlas_2018_all.
There are 33 mutations returned.
doing 204 now.
Molecular profile ID is kirp_tcga_pan_can_atlas_2018_mutations.
Sample list ID is kirp_tcga_pan_can_atlas_2018_all.
There are 20 mutations returned.
doing 205 now.
Molecular profile ID is laml_tcga_pan_can_atlas_2018_mutations.
Sample list ID is laml_tcga_pan_can_atlas_2018_all.
There are 38 mutations returned.
doing 206 now.
Molecular profile ID is lgg_tcga_pan_can_atlas_2018_mutations.
Sample list ID is lgg_tcga_pan_can_atlas_2018_all.
There are 443 mutations returned.
doing 207 now.
Molecular profile ID is lihc_tcga_pan_can_atlas_2018_mutations.
Sample list ID is lihc_tcga_pan_can_atlas_2018_all.
There are 146 mutations returned.
doing 208 now.
Molecular profile ID is luad_tcga_pan_can_atlas_2018_mutations.
Sample list ID is luad_tcga_pan_can_atlas_2018_all.
There are 447 mutations returned.
doing 209 now.
Molecular profile ID is cfdna_msk_2019_mutations.
Sample list ID is cfdna_msk_2019_all.
There are 307 mutations returned.
doing 210 now.
Molecular profile ID is glioma_mskcc_2019_mutations.
Sample list ID is glioma_mskcc_2019_all.
There are 1217 mutations returned.
doing 211 now.
Molecular profile ID is lusc_tcga_pan_can_atlas_2018_mutations.
Sample list ID is lusc_tcga_pan_can_atlas_2018_all.
There are 570 mutations returned.
doing 212 now.
Molecular profile ID is meso_tcga_pan_can_atlas_2018_mutations.
Sample list ID is meso_tcga_pan_can_atlas_2018_all.
There are 19 mutations returned.
doing 213 now.
Molecular profile ID is ov_tcga_pan_can_atlas_2018_mutations.
Sample list ID is ov_tcga_pan_can_atlas_2018_all.
There are 410 mutations returned.
doing 214 now.
Molecular profile ID is paad_tcga_pan_can_atlas_2018_mutations.
Sample list ID is paad_tcga_pan_can_atlas_2018_all.
There are 115 mutations returned.
doing 215 now.
Molecular profile ID is pcpg_tcga_pan_can_atlas_2018_mutations.
Sample list ID is pcpg_tcga_pan_can_atlas_2018_all.
There are 19 mutations returned.
doing 216 now.
Molecular profile ID is prad_tcga_pan_can_atlas_2018_mutations.
Sample list ID is prad_tcga_pan_can_atlas_2018_all.
There are 113 mutations returned.
doing 217 now.
Molecular profile ID is sarc_tcga_pan_can_atlas_2018_mutations.
Sample list ID is sarc_tcga_pan_can_atlas_2018_all.
There are 118 mutations returned.
doing 218 now.
Molecular profile ID is skcm_tcga_pan_can_atlas_2018_mutations.
Sample list ID is skcm_tcga_pan_can_atlas_2018_all.
There are 342 mutations returned.
doing 219 now.
Molecular profile ID is stad_tcga_pan_can_atlas_2018_mutations.
Sample list ID is stad_tcga_pan_can_atlas_2018_all.
There are 383 mutations returned.
doing 220 now.
Molecular profile ID is tgct_tcga_pan_can_atlas_2018_mutations.
Sample list ID is tgct_tcga_pan_can_atlas_2018_all.
There are 11 mutations returned.
doing 221 now.
Molecular profile ID is thca_tcga_pan_can_atlas_2018_mutations.
Sample list ID is thca_tcga_pan_can_atlas_2018_all.
There are 65 mutations returned.
doing 222 now.
Molecular profile ID is thym_tcga_pan_can_atlas_2018_mutations.
Sample list ID is thym_tcga_pan_can_atlas_2018_all.
There are 17 mutations returned.
doing 223 now.
Molecular profile ID is ucec_tcga_pan_can_atlas_2018_mutations.
Sample list ID is ucec_tcga_pan_can_atlas_2018_all.
There are 1287 mutations returned.
doing 224 now.
Molecular profile ID is ucs_tcga_pan_can_atlas_2018_mutations.
Sample list ID is ucs_tcga_pan_can_atlas_2018_all.
There are 96 mutations returned.
doing 225 now.
Molecular profile ID is uvm_tcga_pan_can_atlas_2018_mutations.
Sample list ID is uvm_tcga_pan_can_atlas_2018_all.
There are 0 mutations returned.
doing 226 now.
Molecular profile ID is acc_tcga_mutations.
Sample list ID is acc_tcga_all.
There are 24 mutations returned.
doing 227 now.
Molecular profile ID is acc_tcga_mutations.
Sample list ID is acc_tcga_methylation_all.
There are 21 mutations returned.
doing 228 now.
Molecular profile ID is blca_tcga_mutations.
Sample list ID is blca_tcga_all.
There are 117 mutations returned.
doing 229 now.
Molecular profile ID is blca_tcga_mutations.
Sample list ID is blca_tcga_methylation_all.
There are 117 mutations returned.
doing 230 now.
Molecular profile ID is brca_tcga_mutations.
Sample list ID is brca_tcga_all.
There are 705 mutations returned.
doing 231 now.
Molecular profile ID is brca_tcga_mutations.
Sample list ID is brca_tcga_methylation_all.
There are 488 mutations returned.
doing 232 now.
Molecular profile ID is cesc_tcga_mutations.
Sample list ID is cesc_tcga_all.
There are 94 mutations returned.
doing 233 now.
Molecular profile ID is cesc_tcga_mutations.
Sample list ID is cesc_tcga_methylation_all.
There are 94 mutations returned.
doing 234 now.
Molecular profile ID is coadread_tcga_mutations.
Sample list ID is coadread_tcga_all.
There are 204 mutations returned.
doing 235 now.
Molecular profile ID is coadread_tcga_mutations.
Sample list ID is coadread_tcga_methylation_all.
There are 9 mutations returned.
doing 236 now.
Molecular profile ID is dlbc_tcga_mutations.
Sample list ID is dlbc_tcga_all.
There are 13 mutations returned.
doing 237 now.
Molecular profile ID is dlbc_tcga_mutations.
Sample list ID is dlbc_tcga_methylation_all.
There are 13 mutations returned.
doing 238 now.
Molecular profile ID is laml_tcga_mutations.
Sample list ID is laml_tcga_all.
There are 37 mutations returned.
doing 239 now.
Molecular profile ID is laml_tcga_mutations.
Sample list ID is laml_tcga_methylation_all.
There are 37 mutations returned.
doing 240 now.
Molecular profile ID is kirc_tcga_mutations.
Sample list ID is kirc_tcga_all.
There are 60 mutations returned.
doing 241 now.
Molecular profile ID is kirc_tcga_mutations.
Sample list ID is kirc_tcga_methylation_all.
There are 60 mutations returned.
doing 242 now.
Molecular profile ID is kich_tcga_mutations.
Sample list ID is kich_tcga_all.
There are 41 mutations returned.
doing 243 now.
Molecular profile ID is kich_tcga_mutations.
Sample list ID is kich_tcga_methylation_all.
There are 41 mutations returned.
doing 244 now.
Molecular profile ID is esca_tcga_mutations.
Sample list ID is esca_tcga_all.
There are 215 mutations returned.
doing 245 now.
Molecular profile ID is esca_tcga_mutations.
Sample list ID is esca_tcga_methylation_all.
There are 215 mutations returned.
doing 246 now.
Molecular profile ID is gbm_tcga_mutations.
Sample list ID is gbm_tcga_all.
There are 325 mutations returned.
doing 247 now.
Molecular profile ID is gbm_tcga_mutations.
Sample list ID is gbm_tcga_methylation_all.
There are 275 mutations returned.
doing 248 now.
Molecular profile ID is hnsc_tcga_mutations.
Sample list ID is hnsc_tcga_all.
There are 611 mutations returned.
doing 249 now.
Molecular profile ID is hnsc_tcga_mutations.
Sample list ID is hnsc_tcga_methylation_all.
There are 611 mutations returned.
doing 250 now.
Molecular profile ID is kirp_tcga_mutations.
Sample list ID is kirp_tcga_all.
There are 24 mutations returned.
doing 251 now.
Molecular profile ID is kirp_tcga_mutations.
Sample list ID is kirp_tcga_methylation_all.
There are 24 mutations returned.
doing 252 now.
Molecular profile ID is brca_mbcproject_wagle_2017_mutations.
Sample list ID is brca_mbcproject_wagle_2017_all.
There are 184 mutations returned.
doing 253 now.
Molecular profile ID is blca_bgi_mutations.
Sample list ID is blca_bgi_all.
There are 79 mutations returned.
doing 254 now.
Molecular profile ID is chol_nus_2012_mutations.
Sample list ID is chol_nus_2012_all.
There are 5 mutations returned.
doing 255 now.
Molecular profile ID is gbm_columbia_2019_mutations.
Sample list ID is gbm_columbia_2019_all.
There are 14 mutations returned.
doing 256 now.
Molecular profile ID is prad_su2c_2015_mutations.
Sample list ID is prad_su2c_2015_all.
There are 101 mutations returned.
doing 257 now.
Molecular profile ID is prad_tcga_pub_mutations.
Sample list ID is prad_tcga_pub_all.
There are 47 mutations returned.
doing 258 now.
Molecular profile ID is prad_tcga_pub_mutations.
Sample list ID is prad_tcga_pub_methylation_all.
There are 47 mutations returned.
doing 259 now.
Molecular profile ID is prad_su2c_2019_mutations.
Sample list ID is prad_su2c_2019_all.
There are 215 mutations returned.
doing 260 now.
Molecular profile ID is prostate_dkfz_2018_mutations.
Sample list ID is prostate_dkfz_2018_all.
There are 45 mutations returned.
doing 261 now.
Molecular profile ID is prad_mskcc_cheny1_organoids_2014_mutations.
Sample list ID is prad_mskcc_cheny1_organoids_2014_all.
There are 7 mutations returned.
doing 262 now.
Molecular profile ID is sarc_mskcc_mutations.
Sample list ID is sarc_mskcc_all.
There are 12 mutations returned.
doing 263 now.
Molecular profile ID is sarc_tcga_pub_mutations.
Sample list ID is sarc_tcga_pub_all.
There are 83 mutations returned.
doing 264 now.
Molecular profile ID is skcm_mskcc_2014_mutations.
Sample list ID is skcm_mskcc_2014_all.
There are 36 mutations returned.
doing 265 now.
Molecular profile ID is rt_target_2018_pub_mutations.
Sample list ID is rt_target_2018_pub_all.
There are 0 mutations returned.
doing 266 now.
Molecular profile ID is ccle_broad_2019_mutations.
Sample list ID is ccle_broad_2019_all.
There are 1899 mutations returned.
doing 267 now.
Molecular profile ID is skcm_dfci_2015_mutations.
Sample list ID is skcm_dfci_2015_all.
There are 81 mutations returned.
doing 268 now.
Molecular profile ID is prad_mcspc_mskcc_2020_mutations.
Sample list ID is prad_mcspc_mskcc_2020_all.
There are 231 mutations returned.
doing 269 now.
Molecular profile ID is chol_tcga_mutations.
Sample list ID is chol_tcga_all.
There are 11 mutations returned.
doing 270 now.
Molecular profile ID is chol_tcga_mutations.
Sample list ID is chol_tcga_methylation_all.
There are 11 mutations returned.
doing 271 now.
Molecular profile ID is brca_sanger_mutations.
Sample list ID is brca_sanger_all.
There are 77 mutations returned.
doing 272 now.
Molecular profile ID is lgg_tcga_mutations.
Sample list ID is lgg_tcga_all.
There are 249 mutations returned.
doing 273 now.
Molecular profile ID is lgg_tcga_mutations.
Sample list ID is lgg_tcga_methylation_all.
There are 249 mutations returned.
doing 274 now.
Molecular profile ID is prad_mskcc_mutations.
Sample list ID is prad_mskcc_all.
There are 14 mutations returned.
doing 275 now.
Molecular profile ID is all_stjude_2013_mutations.
Sample list ID is all_stjude_2013_all.
There are 21 mutations returned.
doing 276 now.
Molecular profile ID is hnc_mskcc_2016_mutations.
Sample list ID is hnc_mskcc_2016_all.
There are 127 mutations returned.
doing 277 now.
Molecular profile ID is crc_msk_2017_mutations.
Sample list ID is crc_msk_2017_all.
There are 1328 mutations returned.
doing 278 now.
Molecular profile ID is sclc_ucologne_2015_mutations.
Sample list ID is sclc_ucologne_2015_all.
There are 122 mutations returned.
doing 279 now.
Molecular profile ID is stad_oncosg_2018_mutations.
Sample list ID is stad_oncosg_2018_all.
There are 87 mutations returned.
doing 280 now.
Molecular profile ID is breast_alpelisib_2020_mutations.
Sample list ID is breast_alpelisib_2020_all.
There are 251 mutations returned.
doing 281 now.
Molecular profile ID is pediatric_dkfz_2017_mutations.
Sample list ID is pediatric_dkfz_2017_all.
There are 144 mutations returned.
doing 282 now.
Molecular profile ID is cellline_ccle_broad_mutations.
Sample list ID is cellline_ccle_broad_all.
There are 1016 mutations returned.
doing 283 now.
Molecular profile ID is kich_tcga_pub_mutations.
Sample list ID is kich_tcga_pub_all.
There are 32 mutations returned.
doing 284 now.
Molecular profile ID is kich_tcga_pub_mutations.
Sample list ID is kich_tcga_pub_methylation_all.
There are 32 mutations returned.
doing 285 now.
Molecular profile ID is coadread_tcga_pub_mutations.
Sample list ID is coadread_tcga_pub_all.
There are 219 mutations returned.
doing 286 now.
Molecular profile ID is coadread_tcga_pub_mutations.
Sample list ID is coadread_tcga_pub_nonhypermut_all.
There are 174 mutations returned.
doing 287 now.
Molecular profile ID is coadread_tcga_pub_mutations.
Sample list ID is coadread_tcga_pub_hypermut_all.
There are 45 mutations returned.
doing 288 now.
Molecular profile ID is coadread_tcga_pub_mutations.
Sample list ID is coadread_tcga_pub_methylation_all.
There are 212 mutations returned.
doing 289 now.
Molecular profile ID is gbm_tcga_pub_mutations.
Sample list ID is gbm_tcga_pub_all.
There are 91 mutations returned.
doing 290 now.
Molecular profile ID is gbm_tcga_pub_mutations.
Sample list ID is gbm_tcga_pub_methylation_all.
There are 91 mutations returned.
doing 291 now.
Molecular profile ID is cll_broad_2015_mutations.
Sample list ID is cll_broad_2015_all.
There are 64 mutations returned.
doing 292 now.
Molecular profile ID is es_dfarber_broad_2014_mutations.
Sample list ID is es_dfarber_broad_2014_all.
There are 19 mutations returned.
doing 293 now.
Molecular profile ID is sclc_cancercell_gardner_2017_mutations.
Sample list ID is sclc_cancercell_gardner_2017_all.
There are 40 mutations returned.
doing 294 now.
Molecular profile ID is brca_tcga_pub_mutations.
Sample list ID is brca_tcga_pub_all.
There are 412 mutations returned.
doing 295 now.
Molecular profile ID is brca_tcga_pub_mutations.
Sample list ID is brca_tcga_pub_methylation_all.
There are 241 mutations returned.
doing 296 now.
Molecular profile ID is brca_metabric_mutations.
Sample list ID is brca_metabric_all.
There are 2151 mutations returned.
doing 297 now.
Molecular profile ID is wt_target_2018_pub_mutations.
Sample list ID is wt_target_2018_pub_all.
There are 15 mutations returned.
doing 298 now.
Molecular profile ID is wt_target_2018_pub_mutations.
Sample list ID is wt_target_2018_pub_methylation_all.
There are 15 mutations returned.
doing 299 now.
Molecular profile ID is blca_tcga_pub_2017_mutations.
Sample list ID is blca_tcga_pub_2017_all.
There are 379 mutations returned.
doing 300 now.
Molecular profile ID is blca_tcga_pub_2017_mutations.
Sample list ID is blca_tcga_pub_2017_methylation_all.
There are 379 mutations returned.
doing 301 now.
Molecular profile ID is bcc_unige_2016_mutations.
Sample list ID is bcc_unige_2016_all.
There are 375 mutations returned.
doing 302 now.
Molecular profile ID is escc_icgc_mutations.
Sample list ID is escc_icgc_all.
There are 87 mutations returned.
doing 303 now.
Molecular profile ID is skcm_vanderbilt_mskcc_2015_mutations.
Sample list ID is skcm_vanderbilt_mskcc_2015_all.
There are 30 mutations returned.
doing 304 now.
Molecular profile ID is angs_project_painter_2018_mutations.
Sample list ID is angs_project_painter_2018_all.
There are 37 mutations returned.
doing 305 now.
Molecular profile ID is glioma_msk_2018_mutations.
Sample list ID is glioma_msk_2018_all.
There are 139 mutations returned.
doing 306 now.
Molecular profile ID is prad_msk_2019_mutations.
Sample list ID is prad_msk_2019_all.
There are 1 mutations returned.
doing 307 now.
Molecular profile ID is acc_2019_mutations.
Sample list ID is acc_2019_all.
There are 238 mutations returned.
doing 308 now.
Molecular profile ID is brca_mskcc_2019_mutations.
Sample list ID is brca_mskcc_2019_all.
There are 78 mutations returned.
doing 309 now.
Molecular profile ID is ntrk_msk_2019_mutations.
Sample list ID is ntrk_msk_2019_all.
There are 21 mutations returned.
doing 310 now.
Molecular profile ID is prad_cdk12_mskcc_2020_mutations.
Sample list ID is prad_cdk12_mskcc_2020_all.
There are 617 mutations returned.
doing 311 now.
Molecular profile ID is mds_mskcc_2020_mutations.
Sample list ID is mds_mskcc_2020_all.
There are 1055 mutations returned.
doing 312 now.
Molecular profile ID is stad_utokyo_mutations.
Sample list ID is stad_utokyo_all.
There are 12 mutations returned.
doing 313 now.
Molecular profile ID is prad_mpcproject_2018_mutations.
Sample list ID is prad_mpcproject_2018_all.
There are 15 mutations returned.
doing 314 now.
Molecular profile ID is utuc_cornell_baylor_mdacc_2019_mutations.
Sample list ID is utuc_cornell_baylor_mdacc_2019_all.
There are 22 mutations returned.
doing 315 now.
Molecular profile ID is pptc_2019_mutations.
Sample list ID is pptc_2019_all.
There are 89 mutations returned.
doing 316 now.
Molecular profile ID is utuc_msk_2019_mutations.
Sample list ID is utuc_msk_2019_all.
There are 83 mutations returned.
doing 317 now.
Molecular profile ID is utuc_pdx_msk_2019_mutations.
Sample list ID is utuc_pdx_msk_2019_all.
There are 62 mutations returned.
doing 318 now.
Molecular profile ID is egc_trap_msk_2020_mutations.
Sample list ID is egc_trap_msk_2020_all.
There are 48 mutations returned.
doing 319 now.
Molecular profile ID is usarc_msk_2020_mutations.
Sample list ID is usarc_msk_2020_all.
There are 59 mutations returned.
doing 320 now.
Molecular profile ID is prad_fhcrc_mutations.
Sample list ID is prad_fhcrc_all.
There are 64 mutations returned.
doing 321 now.
Molecular profile ID is prad_broad_mutations.
Sample list ID is prad_broad_all.
There are 21 mutations returned.
doing 322 now.
Molecular profile ID is stad_tcga_pub_mutations.
Sample list ID is stad_tcga_pub_all.
There are 273 mutations returned.
doing 323 now.
Molecular profile ID is thca_tcga_pub_mutations.
Sample list ID is thca_tcga_pub_all.
There are 55 mutations returned.
doing 324 now.
Molecular profile ID is thca_tcga_pub_mutations.
Sample list ID is thca_tcga_pub_methylation_all.
There are 55 mutations returned.
doing 325 now.
Molecular profile ID is ucec_tcga_pub_mutations.
Sample list ID is ucec_tcga_pub_all.
There are 522 mutations returned.
doing 326 now.
Molecular profile ID is ucec_tcga_pub_mutations.
Sample list ID is ucec_tcga_pub_methylation_all.
There are 255 mutations returned.
doing 327 now.
Molecular profile ID is paad_qcmg_uq_2016_mutations.
Sample list ID is paad_qcmg_uq_2016_all.
There are 264 mutations returned.
doing 328 now.
Molecular profile ID is mel_tsam_liang_2017_mutations.
Sample list ID is mel_tsam_liang_2017_all.
There are 14 mutations returned.
doing 329 now.
Molecular profile ID is nbl_target_2018_pub_mutations.
Sample list ID is nbl_target_2018_pub_all.
There are 1 mutations returned.
doing 330 now.
Molecular profile ID is mbn_mdacc_2013_mutations.
Sample list ID is mbn_mdacc_2013_all.
There are 135 mutations returned.
doing 331 now.
Molecular profile ID is pcpg_tcga_pub_mutations.
Sample list ID is pcpg_tcga_pub_all.
There are 18 mutations returned.
doing 332 now.
Molecular profile ID is pcpg_tcga_pub_mutations.
Sample list ID is pcpg_tcga_pub_methylation_all.
There are 18 mutations returned.
doing 333 now.
Molecular profile ID is prad_eururol_2017_mutations.
Sample list ID is prad_eururol_2017_all.
There are 6 mutations returned.
doing 334 now.
Molecular profile ID is aml_ohsu_2018_mutations.
Sample list ID is aml_ohsu_2018_all.
There are 148 mutations returned.
doing 335 now.
Molecular profile ID is gbm_mayo_pdx_sarkaria_2019_mutations.
Sample list ID is gbm_mayo_pdx_sarkaria_2019_all.
There are 88 mutations returned.
doing 336 now.
Molecular profile ID is gbm_mayo_pdx_sarkaria_2019_mutations.
Sample list ID is gbm_mayo_pdx_sarkaria_2019_methylation_all.
There are 80 mutations returned.
doing 337 now.
Molecular profile ID is nepc_wcm_2016_mutations.
Sample list ID is nepc_wcm_2016_all.
There are 32 mutations returned.
doing 338 now.
Molecular profile ID is aml_target_2018_pub_mutations.
Sample list ID is aml_target_2018_pub_all.
There are 22 mutations returned.
doing 339 now.
Molecular profile ID is aml_target_2018_pub_mutations.
Sample list ID is aml_target_2018_pub_methylation_all.
There are 16 mutations returned.
doing 340 now.
Molecular profile ID is ctcl_columbia_2015_mutations.
Sample list ID is ctcl_columbia_2015_all.
There are 4 mutations returned.
doing 341 now.
Molecular profile ID is stes_tcga_pub_mutations.
Sample list ID is stes_tcga_pub_all.
There are 506 mutations returned.
doing 342 now.
Molecular profile ID is nsclc_tracerx_2017_mutations.
Sample list ID is nsclc_tracerx_2017_all.
There are 410 mutations returned.
      Chr      Start  ...                                       UniqueSample    Gene
0      17    7578457  ...                     MjAwMDEyMzpjaG9sX25jY3NfMjAxMw    TP53
1      17    7577124  ...                         MTIwMjpjaG9sX25jY3NfMjAxMw    TP53
2      17    7579716  ...                       OTkwMTk2OmNob2xfbmNjc18yMDEz    TP53
3       7   55259502  ...                     RVNDQy1EMzplc2NjX3VjbGFfMjAxNA    EGFR
4       3  178936091  ...                    RVNDQy1GNjc6ZXNjY191Y2xhXzIwMTQ  PIK3CA
...    ..        ...  ...                                                ...     ...
61716  17    7579398  ...           Q1JVSzAwMjQtUjY6bnNjbGNfdHJhY2VyeF8yMDE3    TP53
61717  17    7579398  ...  Q1JVSzAwMjQtUHJlLWN0RE5BOm5zY2xjX3RyYWNlcnhfMj...    TP53
61718  17    7579558  ...           Q1JVSzAwMjctUjE6bnNjbGNfdHJhY2VyeF8yMDE3    TP53
61719  17    7579558  ...           Q1JVSzAwMjctUjI6bnNjbGNfdHJhY2VyeF8yMDE3    TP53
61720  17    7579558  ...           Q1JVSzAwMjctUjM6bnNjbGNfdHJhY2VyeF8yMDE3    TP53

[61721 rows x 7 columns]
                                                      UniqueSample
Gene Chr Start    End      Ref                   Var              
EGFR 7   55086984 55086984 G                     C               2
         55086998 55087018 GCGCTCCTGGCGCTGCTGGCT -               1
         55087007 55087007 G                     A               3
         55087016 55087016 G                     A               1
         55087020 55087020 C                     T               2
...                                                            ...
TP53 17  7590693  7590693  A                     G               2
         7590694  7590694  C                     A               4
                                                 G               1
                                                 T               4
         7590697  7590697  A                     T               1

[6404 rows x 1 columns]
There are 53788 unique samples.
There are 54374 mutations returned.
      Chr     Start  ...                                       UniqueSample  Gene
0       7  55241711  ...               UzAyLTE0ODc1OmNzY2NfZGZhcmJlcl8yMDE1  EGFR
1       7  55241711  ...       UC0wMDA3NTgwLVQwMS1JTTU6bXNrX2ltcGFjdF8yMDE3  EGFR
2       7  55241711  ...        UC0wMDA3NTgwLVQwMS1JTTU6dG1iX21za2NjXzIwMTg  EGFR
3       7  55241711  ...  TU9fMTE4OTptZXRhc3RhdGljX3NvbGlkX3R1bW9yc19taW...  EGFR
4       7  55241711  ...         UC0wMDA3NTgwLVQwMS1JTTU6bHVuZ19tc2tfMjAxNw  EGFR
...    ..       ...  ...                                                ...   ...
53847  17   7579398  ...           Q1JVSzAwMjQtUjY6bnNjbGNfdHJhY2VyeF8yMDE3  TP53
53848  17   7579398  ...  Q1JVSzAwMjQtUHJlLWN0RE5BOm5zY2xjX3RyYWNlcnhfMj...  TP53
53849  17   7579558  ...           Q1JVSzAwMjctUjE6bnNjbGNfdHJhY2VyeF8yMDE3  TP53
53850  17   7579558  ...           Q1JVSzAwMjctUjI6bnNjbGNfdHJhY2VyeF8yMDE3  TP53
53851  17   7579558  ...           Q1JVSzAwMjctUjM6bnNjbGNfdHJhY2VyeF8yMDE3  TP53

[53852 rows x 7 columns]
                                                      UniqueSample
Gene Chr Start    End      Ref                   Var              
EGFR 7   55086984 55086984 G                     C               2
         55086998 55087018 GCGCTCCTGGCGCTGCTGGCT -               1
         55087007 55087007 G                     A               3
         55087016 55087016 G                     A               1
         55087020 55087020 C                     T               2
...                                                            ...
TP53 17  7590693  7590693  A                     G               2
         7590694  7590694  C                     A               4
                                                 G               1
                                                 T               4
         7590697  7590697  A                     T               1

[6404 rows x 1 columns]
There are 53852 unique samples.
merge before

                                                      UniqueSample_x  UniqueSample_y
Gene Chr Start    End      Ref                   Var                                
EGFR 7   55086984 55086984 G                     C                 2               2
         55086998 55087018 GCGCTCCTGGCGCTGCTGGCT -                 1               1
         55087007 55087007 G                     A                 3               3
         55087016 55087016 G                     A                 1               1
         55087020 55087020 C                     T                 2               2
...                                                              ...             ...
TP53 17  7590693  7590693  A                     G                 2               2
         7590694  7590694  C                     A                 4               4
                                                 G                 1               1
                                                 T                 4               4
         7590697  7590697  A                     T                 1               1

[6404 rows x 2 columns]
merge after

                                                      UniqueSample_x  ...  Diff
Gene Chr Start    End      Ref                   Var                  ...      
EGFR 7   55086984 55086984 G                     C                 2  ...     0
         55086998 55087018 GCGCTCCTGGCGCTGCTGGCT -                 1  ...     0
         55087007 55087007 G                     A                 3  ...     0
         55087016 55087016 G                     A                 1  ...     0
         55087020 55087020 C                     T                 2  ...     0
...                                                              ...  ...   ...
TP53 17  7590693  7590693  A                     G                 2  ...     0
         7590694  7590694  C                     A                 4  ...     0
                                                 G                 1  ...     0
                                                 T                 4  ...     0
         7590697  7590697  A                     T                 1  ...     0

[6404 rows x 3 columns]