Skip to content
New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Multiple variants by @phillipeloher #2

Open
lpantano opened this issue Jul 16, 2018 · 1 comment
Open

Multiple variants by @phillipeloher #2

lpantano opened this issue Jul 16, 2018 · 1 comment

Comments

@lpantano
Copy link
Contributor

Are multiple variants allowed for the same reported isomiR sequence?

For example, isomiR Sequence TGGGGCGGAGCTTCCGGAGGC has the following possible locations just within miRBase22.
MIMAT0015058_2&hsa-miR-3180-3p&offsets|0|-1
MIMAT0018178_1&hsa-miR-3180&offsets|0|+2
MIMAT0015058_1&hsa-miR-3180-3p&offsets|0|-1
MIMAT0015058&hsa-miR-3180-3p&offsets|0|-1

If so, what would the recommendation of the above be? Should folks generating the GFF3 file be encouraged to report all four (including the 0|-1 and 0|+2 offsets) above within Column 9->Attributes->variant?

@lpantano
Copy link
Contributor Author

Hi,

Right now this is solve by adding the sequence 4 times in the GFF and each of them with a Variant attribute and Hits will be = 4. As well, the attribute TAG can be a specific one. It would be good to have some ideas of this.

I think for me works adding four lines, and I think I'll like to have a TAG that says ambiguous, beside the number of Hits.

In the case of the same read is exactly the same just mapping equally to other precursors of the same miRNA, but the Variants for instance being the same value, we can put multiple precursors under Parent. This happens if the same miRNA have different precursors like some of hsa-let7 but actually nothing else change.

other ideas?

Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment
Labels
None yet
Projects
None yet
Development

No branches or pull requests

1 participant