Skip to content

Commit

Permalink
Fix bam2fastx outputs
Browse files Browse the repository at this point in the history
The outputs were never going to be produced. Together with galaxyproject/galaxy#17829
we ended up with passing tests when they should have failed.
  • Loading branch information
mvdbeek committed Mar 25, 2024
1 parent a95dcf3 commit 152b584
Showing 1 changed file with 10 additions and 10 deletions.
20 changes: 10 additions & 10 deletions tools/pbtk/bam2fastx.xml
Original file line number Diff line number Diff line change
Expand Up @@ -18,9 +18,9 @@ pbindex input.bam &&
#end if
input.bam
--num-threads "\${GALAXY_SLOTS:-1}" &&
#if $output_format == "fasta":
#if $output_format == "fasta_gz":
mv output.fasta.gz '$output_fasta_gz'
#elif $output_format == "fastq":
#elif $output_format == "fastq_gz":
mv output.fastq.gz '$output_fastq_gz'
#end if
]]></command>
Expand All @@ -33,28 +33,28 @@ input.bam
</inputs>
<outputs>
<data name="output_fasta_gz" format="fasta.gz" label="${tool.name} on ${on_string}: Fasta">
<filter>output_format == "fasta"</filter>
<filter>output_format == "fasta_gz"</filter>
</data>
<data name="output_fastq_gz" format="fastqsanger.gz" label="${tool.name} on ${on_string}: Fastq">
<filter>output_format == "fastq"</filter>
<filter>output_format == "fastq_gz"</filter>
</data>
</outputs>
<tests>
<test expect_num_outputs="1">
<param name="input_bam" ftype="unsorted.bam" value="sample.bam"/>
<param name="output_format" value="fastq_gz" />
<output name="output_fastq_gz">
<param name="output_format" value="fastq.gz" />
<output name="output_fastq_gz" decompress="true">
<assert_contents>
<has_size min="9000" />
<has_text text="AATGCCTTATTAAGTTAAGAAATGGTTTTTTTTAAACTTACAGATGGAA" />
</assert_contents>
</output>
</test>
<test expect_num_outputs="1" >
<param name="input_bam" ftype="bam" value="sample.bam"/>
<param name="output_format" value="fasta_gz" />
<output name="output_fasta_gz" >
<param name="output_format" value="fasta.gz" />
<output name="output_fasta_gz" decompress="true">
<assert_contents>
<has_size min="9000" />
<has_text text="AATGCCTTATTAAGTTAAGAAATGGTTTTTTTTAAACTTACAGATGGAA" />
</assert_contents>
</output>
</test>
Expand Down

0 comments on commit 152b584

Please sign in to comment.