Merge pull request #55 from nleroy917/dev

Tweak pydantic schema's to fix Docker bugs

.gitignore

@@ -153,3 +153,4 @@ cython_debug/
 
 .DS_Store
 .Rproj.user
+.python-version

README.md

@@ -34,13 +34,13 @@ import optipyzer
 
 api = optipyzer.API()
 
-gblock = "ATGGCCCTTTAA"
+dna_seq = "ATGGCCCTTTAA"
 
 result = api.optimize(
-        seq=dna_seq,
-        seq_type="dna",
-        weights={"human": 2, "mouse": 1},
-    )
+    seq=dna_seq,
+    seq_type="dna",
+    weights={"human": 2, "mouse": 1},
+)
 
 print(result['optimized_sd'])
 ```
@@ -69,13 +69,13 @@ import optipyzer
 
 api = optipyzer.API(local=True) # <--- specify you are using a local server
 
-gblock = "ATGGCCCTTTAA"
+dna_seq = "ATGGCCCTTTAA"
 
 result = api.optimize(
-        seq=dna_seq,
-        seq_type="dna",
-        weights={"human": 2, "mouse": 1},
-    )
+    seq=dna_seq,
+    seq_type="dna",
+    weights={"human": 2, "mouse": 1},
+)
 
 print(result['optimized_sd'])
 ```

optipyzer/const.py

@@ -1,4 +1,4 @@
-VERSION = "0.2.0"
+VERSION = "0.2.1"
 
 VALID_AMINO_ACIDS = "ARNDCQEGHILKMFPSTWYV"
 

optipyzer/request_models.py

@@ -10,7 +10,7 @@ class OptimizeQuery(BaseModel):
     seed: Optional[Union[int, str]]
 
     class Config:
-        schema_extra = {
+        json_schema_extra = {
             "description": "The optimization query that includes the sequence, and the organism weights",
             "example": {
                 "seq": "ATGCGTACTAGTCAGTCAGACTGACTG",

optipyzer/response_models.py

@@ -1,21 +1,21 @@
-from typing import Dict, List
+from typing import Dict, List, Union
 from pydantic import BaseModel
 
 
 # model for an optimization result
 class OptimizationResult(BaseModel):
     query: str
-    weights: Dict[str, int]
+    weights: Dict[Union[str, int], int]
     seq_type: str
     peptide_seq: str
     dna_seq: str
     stop_codon: int
     optimized_sd: str
     min_difference_sumsquares: float
-    best_expression_sd: Dict[str, float]
+    best_expression_sd: Dict[Union[str, int], float]
     optimized_ad: str
     min_difference_absvalue: float
-    best_expression_ad: Dict[str, float]
+    best_expression_ad: Dict[Union[str, int], float]
 
     class Config:
         orm_mode = True