Skip to content

Commit

Permalink
add tests
Browse files Browse the repository at this point in the history
  • Loading branch information
sanjaynagi committed Aug 18, 2023
1 parent 88deffd commit 3b0f67c
Showing 1 changed file with 16 additions and 0 deletions.
16 changes: 16 additions & 0 deletions tests/test_agamprimer.py
Original file line number Diff line number Diff line change
@@ -0,0 +1,16 @@
import numpy as np
import pandas as pd
import pytest

import AgamPrimer

ace1_seq = "GCGGCGGCTTCTACTCCGG"
kdr_seq = "AGTGATAGGAAATTTAGTCGT"


@pytest.mark.parametrize(
"sequence",
[ace1_seq, kdr_seq],
)
def test_check_my_oligo(sequence):
AgamPrimer.check_my_oligo(sequence=sequence, sample_sets="AG1000G-GH")

0 comments on commit 3b0f67c

Please sign in to comment.